Autoinhibition of Escherichia coli Rep monomer helicase activity by its 2B subdomain

Brendza et al. 10.1073/pnas.0502886102.

Supporting Information

Files in this Data Supplement:

Supporting Table 1
Supporting Text
Supporting Figure 6
Supporting Figure 7
Supporting Figure 8
Supporting Figure 9
Supporting Figure 10
Supporting Table 2

Supporting Figure 6

Fig. 6. Sedimentation equilibrium ultracentrifugation of wtRep and RepD2B proteins. Experiments were performed at rotor speeds of 23,000 (red), 28,000 (blue), and 34,000 (green) rpm in Buffer M, 200 mM NaCl at 25°C, monitoring absorbance at 230 nm. (A) Data for RepD2B (2 mM loading concentration). Solid lines are simulations using Eq. 2 and the best-fit parameters obtained from a global NLLS fit of all data to a single ideal species (n = 1 in Eq. 2). A plot of the residuals for each data set is shown below. Note that the residuals are all centered around zero but shifted along y axis for clarity. (B) Data for wtRep (1.5 mM loading concentration). Solid lines are simulations using Eq. 2 and the best-fit parameters obtained from a global NLLS fit of all data to a single ideal species (n = 1 in Eq. 2). A plot of the residuals for each data set is shown below. Note that the residuals are all centered around zero but shifted along y axis for clarity.

Supporting Figure 7

Fig. 7. Sedimentation equilibrium of RepD2B bound to DNA I. The values of the apparent molecular mass, M, of the RepD2B-DNA complex (where PD is a protein monomer bound to DNA and P2D is two protein monomers bound to DNA), obtained from NLLS analysis, as a function of the RepD2B/DNA molar ratio of the loading concentrations.

Supporting Figure 8

Fig. 8. Sedimentation equilibrium ultracentrifugation of wtRep in the presence of an excess of DNA I, which contains an 18-bp duplex and 3'-(dT₂₀) tail with Cy3 covalently attached at the 5' end of the bottom strand (see cartoon in Inset). Experiments were performed at rotor speeds of 22,000 (red), 27,000 (blue), and 32,000 (green) rpm in Buffer M (plus 200 mM NaCl) at 25°C with loading concentrations of 1.5 mM wtRep and 3 mM DNA, monitoring absorbance of the Cy3 labeled DNA at 550 nm. (A) Experimental data (open circles) and simulations (solid lines) based on Eq. 2 and the best-fit parameters obtained from a global NLLS fit of all data to a two-component model (n = 2 in Eq. 2), with the two components representing free DNA and DNA bound by one wtRep monomer. A plot of the residuals for each data set is shown below the data. Note that the residuals are all centered around zero but shifted along y axis for clarity. (B) The values of M for the wtRep-DNA complex obtained from NLLS analysis as a function of the ratio of the loading concentrations.

Supporting Figure 9

Fig. 9. Sedimentation equilibrium ultracentrifugation of RepD2B in the presence of an excess of DNA I, which contains an 18-bp duplex with a 3'-(dT₂₀) tail with Cy3 covalently attached at the 5' end of the bottom strand (see cartoon in Inset). Experiments were performed at rotor speeds of 18,000 (blue), 22,000 (red), 27,000 (green), and 33,000 (gray) rpm in Buffer M plus 50 mM NaCl at 25°C with loading concentrations of 2.0 mM RepD2B and 4 mM DNA, monitoring absorbance of the Cy3 labeled DNA at 550 nm. (A) Experimental data (open circles) and simulations (solid lines) based on Eq. 2 and the best-fit parameters obtained from a global NLLS fit of all data to a two-component model (n = 2 in Eq. 2), with the two components representing free DNA and DNA bound by one RepD2B monomer. A plot of the residuals is shown below the data. Note that the residuals are all centered around zero but shifted along the y axis for clarity. (B) The values of M for the RepD2B-DNA complex obtained from NLLS analysis as a function of the ratio of the loading concentrations.

Supporting Figure 10

Fig. 10. Dependence of DNA unwinding amplitude on wtRep protein concentration in Buffer M plus 50 mM NaCl. STO DNA unwinding kinetics experiments were performed in the quenched-flow in Buffer M (plus 50 mM NaCl, 2.1 mM MgCl_2, and 0.1 mg/ml BSA at 25°C) using 40 nM DNA II and varying wtRep concentrations (40-800 nM). Experiments were initiated by the addition of ATP to a final concentration of 1.5 mM. The ATP solution also included an excess of protein trap (see Materials and Methods) to ensure that only a single cycle of DNA unwinding occurred.

Table 1. DNA Sequences

DNA	L*	Sequence
I	18	5’-d(GCCTCGCTGCCGTCGCCA)-3’
		5’-d(Cy3 TGGCGACGGCAGCGAGGCT₂₀)-3’
II	12	5’-d(GCCTCGCTGCCG)-3’
		5’-d(CGGCAGCGAGGCT₂₀)-3’
	18	5’-d(GCCTCGCTGCCGTCGCCA)-3’
		5’-d(TGGCGACGGCAGCGAGGCT₂₀)-3’
	21	5’-d(GCCTCGCTGCCGTCGCCAGTC)-3’
		5’-d(GACTGGCGACGGCAGCGAGGCT₂₀)-3’
	24	5’-d(GCCCTGCTGCCGAACAACGAAGGT)-3’
		5’-d(ACCTTCGTTGGTCGGCAGCAGGGCT₂₀)-3’
III	18	5’-d(GCCTCGCTGCCGTCGCCA Cy5-T)-3’
		5’-d(Cy3 TGGCGACGGCAGCGAGGCT₂₀)-3’
	21	5’-d(GCCCTGCTGCCGACCAACGAA Cy5-T)-3’
		5’-d(Cy3 TTCGTTGGTCGGCAGCAGGGCT₂₀)-3’
	30	5’-d(CGACCAACGATGGTTACATTCCCGCTGGTG Cy5-T)-3’
		5’-d(Cy3 CAGCAGCGGGAATGTAACCATCGTTGGTCGT₂₀)-3’
	40	5’-d(ACCCTGCTGCCGACCAACGATGGTTACATTCCCGCT-GCTG Cy5-T)-3’
		5’-d(Cy3 CAGCAGCGGGAATGTAACCATCGTTGGTCGGCA-GCAGGGCT₂₀)-3’

*Length of duplex region of DNA in base pairs.

Table 2. Kinetic parameters for DNA unwinding by RepD 2B monomer

[NaCl], mM	k_obs, s^-1	k_NP, s^-1	x^*	A^†
30	37.3 ± 1	3.8 ± 0.1	0.47 ± 0.02	0.56 ± 0.001
50	39.2 ± 1	4.4 ± 0.3	0.59 ± 0.03	0.38 ± 0.001
100	42.3 ± 2	3.6 ± 1.6	0.85 ± 0.05	0.17 ± 0.001
150	45.1 ± 3	3.4 ± 2	0.87 ± 0.07	0.09 ± 0.001
200	56.6 ± 7	8.1 ± 4	0.72 ± 0.3	0.05 ± 0.001

Kinetic parameters for unwinding of DNA III determined from NLLS analysis of the data in Fig. 4A using Scheme 1 (Eq. 1), assuming a step size m = L/n = 4 bp. Conditions: Buffer M at 25°C plus the indicated [NaCl].

*Fraction of DNA bound by protein in complexes productive for DNA unwinding.

^†Total amplitude of unwinding (arbitrary fluorescence units).