Sitkiewicz et al. 10.1073/pnas.0607669103.
Fig. 7. Recombinant exogenous SlaA lacks demonstrable cytotoxic effects on human epithelial cells. Transmission electron microscopy micrographs of cross sections of untreated D562 cells (A) and cells incubated with purified recombinant SlaA for 3 h (B). Cells treated with purified recombinant SlaA had intact cell membranes (white arrows) and pseudopodia (white triangles). Magnification: ´19,000.
Fig. 8. Schematic of cloning strategy used to construct the DslaA isogenic mutant strain. Details are provided in Supporting Text.
Fig. 9. Characterization of wild-type and DslaA GAS strains. (A) Southern blot analysis of chromosomal DNA isolated from wild-type (lane 1) and DslaA mutant strains (lane 2). DNA was transferred to a nitrocellulose membrane and probed with a fragment of the spectinomycin-resistance cassette. Southern blot analysis and detection was performed as described by the manufacturer of ECL Direct Nucleic Acid Labeling and Detection System (GE Healthcare). (B) Analysis of SlaA production by wild-type and DslaA strains. SlaA is expressed poorly during growth of GAS in broth, but coculture with human epithelial cells greatly increases the amount of immunoreactive SlaA present in the tissue culture medium (1, 2). Production of SlaA was assessed after coculture of wild-type and DslaA mutant strains with D562 epithelial cells. Aliquots of liquid medium were concentrated and equivalent volumes of each sample were analyzed by Western immunoblot with SlaA-specific antisera. Lane 1, purified recombinant SlaA; lane 2, MEM from uninfected D562 epithelial cells; lane 3, MEM from MGAS315-infected D562 cells (3 h); lane 4, MEM from DslaA-infected D562 cells (3 h). (C) Secretion of the phage-encoded protein SpeK is unaffected in the DslaA mutant. Concentrated supernatants from wild-type and DslaA mutant strains were analyzed by Western immunoblot with SpeK-specific antisera. Lane 1, purified recombinant SpeK; lane 2, culture supernatant from MGAS315; lane 3, culture supernatant from DslaA mutant strain. Size in kb (A) and kDa (B and C) are indicated at left.
Fig. 11. Enlarged micrographs of Fig. 1 A-C. The human epithelial cell line D562 was incubated with wild-type GAS or the DslaA isogenic mutant strain [multiplicity of infection (moi) = 100:1, 3 h], and adherence was assessed by light microscopy. (A) Uninfected D562 cells, (B) D562 cells incubated with wild-type strain MGAS315, (C) D562 cells incubated with the DslaA isogenic mutant strain. Magnification, ´40.
Fig. 11. Expression of SlaA is toxic for yeast. (A) Yeast carrying pYES2T/SlaA412 encoding SlaA, but not control transformants expressing LacZ (pYES2T/LacZ), express SlaA. Expression was induced with galactose for 24 h, and protein extracts were analyzed by Western immunoblot with anti-SlaA antibody. (B) Quantitative differences in cell viability between yeast transformed with the control plasmid pYES2T/LacZ encoding LacZ (LacZ) or pYES2T/SlaA412 (SlaA412) encoding SlaA. Yeast were grown in the presence of glucose (GLC, repression) or galactose (GAL, induction) for the indicated times and colony-forming units (cfus) were determined.
Table 1. Strains, plasmids, and primers used in this study
|
Strain or plasmid |
Relevant characteristics/primer sequence (5'-3') |
Source or reference |
|
MGAS315 |
S. pyogenes M3 serotype, wild type strain |
1 |
|
MGAS315DslaA |
S. pyogenes MGAS315 isogenic derivative with inactivated slaA gene |
This study |
|
950771Smslo- |
S. pyogenes M3 serotype, Dslo strain |
2 |
|
Nova Blue |
E. coli cloning strain |
Novagen |
|
pUC19 |
Cloning vector |
Fermentas |
|
pSTblue-1 |
Cloning vector |
|
|
pSL60-2 |
Source of spectinomycin resistance cassette |
3 |
|
pSI1 |
5'flank of slaA gene cloned into pUC19 |
This study |
|
pSI2 |
3'flank of slaA gene cloned into pSTblue-1 |
This study |
|
pSI3 |
pSI2 with spc cassette cloned upstream 3'slaA flank |
This study |
|
pSI4 |
pUC19 carrying spc cassette with 5' and 3' flanks cloned upstream and downstream, respectively |
This study |
|
5'F sla* |
CGCGATATCATATGGAAACGATTGATATGAGTAAAGTTAG |
|
|
5'R sla |
CCCGGGCCCAGCAGCTAATAGAATAGTATTTATTACTT |
|
|
3'F sla |
GACAGTAGGTTCTATAGGATGTTAAATTTC |
|
|
3'R sla |
GGGAAGCTTACCACCTCTTCCACTATTTCCTCAG |
|
|
yslaF |
GCCAAGCTTATGGAAAATGGCACTGAAAGTGATATTAGCTTCCA |
|
|
yslaR |
ATCGGATCCTTAACATCCTATAGAACCTACTGTCTC |
|
*Underlined nucleotides designate restriction enzyme digestion sites incorporated into the primer
1. Musser, J. M., Hauser, A. R., Kim, M. H., Schlievert, P. M., Nelson, K. & Selander, R. K. (1991) Proc. Natl. Acad. Sci. USA 88, 2668-2672.
2. Bricker, A. L., Cywes, C., Ashbaugh, C. D. & Wessels, M. R. (2002) Mol. Microbiol. 44, 257-269.
3. Lukomski, S., Sreevatsan, S., Amberg, C., Reichardt, W., Woischnik, M., Podbielski, A. & Musser, J. M. (1997) J. Clin. Invest. 99, 2574-2580.
Supporting Text
Construction of the DslaA Isogenic Mutant Strain. A detailed schematic outlining the steps used in construction of the mutant strain is shown in Fig. 8. A 579-bp region located upstream of the slaA gene (5' flank) was amplified with primers 5'Fsla and 5'Rsla (Table 1), digested with NdeI and XmaI, and cloned into pUC19 to yield plasmid pSI1. A 533-bp region located downstream of slaA (3' flank) was amplified with primers 3'Fsla and 3'Rsla, digested with HindIII, and cloned into the pSTblue-1 vector, resulting in plasmid pSI2. The spectinomycin resistance cassette (spc) containing the add9 gene was excised from plasmid pSL60-2 (1) with SmaI and cloned into plasmid pSI2 to yield plasmid pSI3. The DNA fragment encoding the spc cassette and 3' flanking region was excised from plasmid pSI3 by digestion with SnaBI and HindIII, and cloned into the SmaI site of pSI1. The resulting plasmid (pSI4) had the spc cassette located between the 5' and 3' flanking regions of the slaA gene. pSI4 was used as a template for PCR with primers 5'Fsla and 3'Rsla, and the resulting amplified fragment was used to transform serotype M3 GAS strain MGAS315. Spectinomycin-resistant transformants contained a nonpolar replacement of the slaA gene (encoding amino acids 12 to 184) with a spectinomycin resistance cassette.
Exhaustive attempts to genetically complement the strain containing the inactivated slaA gene by introducing a wild-type copy of slaA into the mutant strain were unsuccessful. Genetic tools available for manipulation of GAS are relatively limited, but two independent complementation strategies were tried. One strategy involved introduction of a plasmid-encoded copy of slaA with its native promoter region. A second strategy involved integration of the wild-type slaA gene into an ectopic site in the chromosome. Both strategies required subcloning steps to be conducted in Escherichia coli. Repeated attempts to introduce a wild-type copy of slaA containing its native promoter region into E. coli were unsuccessful, including use of a single-copy vector. Possible explanations for our lack of success include the presence of the fragment encoding a Gram-positive secretion signal within the cloned fragment, or transcription from the slaA promoter resulting in intracellular production of a product toxic for E. coli. In this regard, we note that cloning of the slaA gene devoid of its secretion signal and under a tightly controlled E. coli promoter was successful (2).
Purification of rSlaA. rSla was purified from E. coli BL21 (DE3) containing pSla (2). pSlas encodes mature SlaA (amino acids 28-191) with an amino-terminal His tag. The bacteria were grown overnight at 37°C in 2 liters of LB broth supplemented with 100 mg/liter of ampicillin; harvested by centrifugation; suspended in 30 ml of 10 mM Tris•HCl (THCl), pH 8.3; and sonicated for 15 min on ice. The cell debris was removed by centrifugation at 20,000 ´ g for 15 min, and the supernatant was loaded onto a Ni-NTA agarose (Qiagen) column (1.5 ´ 3 cm). The column was washed with 50 ml of 1.0 M NaCl in THCl, and the protein was eluted with a 40-ml linear gradient of 0-0.25 M imidazole in THCl. Recombinant protein was identified by SDS/PAGE, and peak fractions were pooled. The protein was dialyzed against 3 liters of THCl at 4°C overnight and loaded on a DEAE Sepharose column (1.5 ´ 5 cm) equilibrated with THCl. Protein was eluted with a 60-ml linear gradient of 0-0.15 M NaCl. The purified protein was again dialyzed against 3.5 liters of THCl. Purified rSla was free of contaminating proteins as assessed by Coomassie blue-stained SDS/PAGE. All reagents and glassware used for toxin purification and biological assays were pyrogen-free.
Expression of SlaA in Yeast. The coding sequence for mature SlaA (amino acids 28-191) was amplified by PCR with primers yslaF and yslaR (Table 1), digested with HindIII and BamHI, and cloned into HindIII/BamHI-digested pYES2/CT vector (Invitrogen). The resulting plasmid (pYES2/SlaA412) contained the slaA gene under control of the yeast galactose-inducible promoter, GAL1. The control plasmid pYES2/LacZ and plasmid pYES2/SlaA412 were transformed by standard methods (3) into Saccharomyces cerevisiae strain INVSc1 (Invitrogen) and selected on SC minimal medium plates without uracyl and supplemented with 2% glucose at 30°C. For induction of SlaA, yeast were grown overnight in minimal media and washed two times with sterile water to remove glucose. Each culture (containing pYES2/LacZ or pYES2/SlaA412) was used to inoculate 5 ml of minimal medium with 2% glucose or 2% galactose. Aliquots were removed at various time points, serially diluted, and plated (10 ml) on YPD plates to determine the number of viable cells. To confirm SlaA production, yeast cells were mechanically disrupted at 24 h postinduction and protein extracts were analyzed by Western immunoblot with anti-SlaA antisera.
1. Lukomski, S., Sreevatsan, S., Amberg, C., Reichardt, W., Woischnik, M., Podbielski, A. & Musser, J. M. (1997) J. Clin. Invest. 99, 2574-2580.
2. Beres, S. B., Sylva, G. L., Barbian, K. D., Lei, B., Hoff, J. S., Mammarella, N. D., Liu, M. Y., Smoot, J. C., Porcella, S. F., Parkins, L. D., et al. (2002) Proc. Natl. Acad. Sci. USA 99, 10078-10083.
3. Gietz, R. D. & Woods, R. A. (2002) Methods Enzymol. 350, 87-96.