Wnt signaling regulates pancreatic β cell proliferation

Rulifson et al. 10.1073/pnas.0701509104.

Supporting Information

Files in this Data Supplement:

SI Figure 6
SI Figure 7
SI Figure 8
SI Figure 9
SI Figure 10
SI Materials and Methods




SI Figure 6

Fig. 6. Coexpression of Nkx6.1 and Ki67 in nuclei of islet b cells from P8 mice following indicated exposures to vehicle, purified Wnt3a or Wnt3a + Fz8-CRD for 8 h. Colocalization of Nkx6.1 (green) and Ki67 (blue) is indicated in nuclei by white arrowheads and the merged color (teal).





SI Figure 7

Fig. 7. RT-PCR quantification of mRNA levels for Pitx2 and CyclinD2 in human islets cultured with the indicated factors. Values are normalized to vehicle-treated (Veh) controls.





SI Figure 8

Fig. 8. Immunohistology and insulin studies of islets from control and RIP-Cre b-active mice. (A and B) Localization of b-catenin in islets from control (A) and RIP-Cre b catactive (B) mice by immunohistochemistry. b-catenin (green), DAPI (blue) and insulin (red) were detected by immunofluorescence microscopy. White arrowheads in B highlight nuclei with prominent nuclear b-catenin signal. (C-F) Pancreatic insulin levels and insulin secretion of islets from RIP-Cre bcatactive and control mice. Insulin levels were calculated on a per islet basis (C) as well as per islet DNA content (D) to normalize cell number between islets. Assessment of insulin secretion in response to step increase of arginine (E) or KCl (F) at the indicated concentrations.





SI Figure 9

Fig. 9. Phenotypes after axin induction in Pdx1-tTA/TRE-Axin mice. (A) Western immunoblot to detect Myc-labeled Axin (black arrowhead) in total protein isolated from P6 mice of the indicated genotypes. (B and C) Immunofluorescent detection of BrdU incorporation in Nkx6.1+ cells in WT (B) and Pdx1-tTA/TRE-Axin (C) E16.5 embryos. (D and E) The relative number Nkx6.1+ (D), and Nkx6.1+BrdU+ (E) cell nuclei per pancreas in E16.5 WT and Pdx1-tTA/TRE-Axin embryos or in Pdx1-tTA/TRE-Axin embryos on Doxycycline from the time of conception. Data are presented as the average ± SEM. P values are indicated in the figures. Data are from at least five mice per genotype. (Original magnification: ´100.)





SI Figure 10

Fig. 10. i.p. glucose challenge of P28 mice after a 16-h overnight fast. Black line and open circle, Pdx1-tTA/TRE-Axin mice; red line, Pdx1-tTA littermates; blue line, TRE-Axin littermates; black line and closed circle, WT mice. Indicated P values are for data from Pdx1-tTA/TRE-Axin and Pdx1-tTA mice. All data are from at least three litters, with four to eight mice per genotype. Data are presented as the average ±SEM.





SI Materials and Methods

Immunohistochemistry. All tissue was fixed in 4% paraformaldehyde (Electron Microscopy Sciences). Immuno-histochemistry was performed by using paraffin-embedded tissue and immunofluorescence studies were performed on either paraffin- or cryo-preserved tissue, depending on antibody requirements. Antigen retrieval (Vector Laboratories) was used on all tissue and horse or goat serum (Invitrogen) was used for antibody blocking. Primary antibodies included: human (mouse) anti-c-Myc AB-1 (1:40, Calbiochem), chicken anti-mouse insulin (1:500, Chemicon International), guinea pig anti-mouse glucagon (1:200, Linco Research, Inc.), rabbit anti-mouse Nkx6.1 (1:200, S. K. Kim Laboratory), rabbit anti-mouse CyclinD2 M-20 (1:100, Santa Cruz Biotechnology, Inc.), goat anti-mouse Pitx2 C-16, (1:50, Santa Cruz Biotechnology, Inc.), mouse-b-catenin (1:100, BD Transduction Labs) and mouse anti-Ki67 (1:100, Novocastra, Newcastle, United Kingdom). Guinea pig anti-mouse Nkx6.1 (1:1,000) was a generous gift from M. Sander (U.C. Irvine, CA). Alexa-Fluor antibodies 488 (1:200), 555 (1:500), and 633 (1:200) (Molecular Probes) were used for immunohistology studies. Immunoperoxidase detection for c-Myc was performed by using biotin (1:200) and Vectastain Elite ABC, Avidin/Biotin Blocking, and DAB kits (Vector Laboratories). Mouse-anti-BrdU (Amersham Pharmacia Biosciences) was used according to the manufacturer's protocol. Images were captured by using a Leica SP2 AOBS confocal microscope (provided by the Cell Sciences Imaging Facility, Stanford University Medical Center). Light images were captured by using a Zeiss Axioplan 2 microscope and Zeiss Axiovision software. Cell counting, point-counting morphometry, and b-cell quantification were performed by using standard morphometric techniques (1, 2) unless otherwise noted. For counting of insulin+ or glucagon+ cells in P4 and P28 mice, cell number was quantified based on antibody+ staining per islet. The area of insulin+ or glucagon+ cells was determined by using Volocity (Improvision) software analysis and reported as relative area. At least 30 islets per pancreas were counted and at least 4 mice were examined per genotype. For P28 pancreas analysis, total pancreatic tissue area was also quantified by using Volocity software, permitting comparison of the ratio of insulin+ cells per total pancreas area. For this analysis, whole pancreata were serially sectioned to generate 7 mm-thick tissue sections and 25 representative sections per pancreas were used. At least 4 mice were examined per genotype. For quantification of cells expressing Nkx6.1, Pitx2, Cyclin D2, or BrdU cells were point-counted; pancreas tissue was obtained from at least 4 mice per genotype. All data are presented as the average ± SEM. Two-tailed T tests were conducted to determine statistical significance.

BrdU Incorporation Studies. For BrdU studies in neonatal mice, 0.2 ml of BrdU, prepared at 1.25 mg/ml, was injected I.P. 2 h before harvest. Pancreas tissue was isolated and prepared as described above.

Glucose Tolerance Tests and Islet and Insulin Analysis. Mice were fasted for 14-16 h, and baseline blood glucose levels (dL/ml) were measured from tail-vein blood. Mice were challenged with 2 mg/kg glucose and glucose tolerance tests were conducted as previously described (2, 3). Pancreas tissue from mice was collected and homogenized in acid alcohol (4) and normalized to pancreas weight. Insulin content was determined by using the Mercodia Ultrasensitive Mouse Insulin ELISA kit (Alpco Diagnostics). Human islets were procured from NDRI (National Disease Research Interchange) with 90% islet purity, and 85% viability. Human islets were cultured on 48 well-plate with 200 islets per well in CMRL-1066 medium (modified for islet cell culture from Cellgro/Mediatech, Herndorn, VA) supplemented with 10% FBS, L-glutamine 2 mM, Penicillin(100units/ml)-streptomycin(100 mg/ml), Hepes(1 mM), Fongizone (0.25 mg/ml).

Islet insulin secretion, insulin levels and DNA levels were measured as previously described (5). Briefly, in a microplate, five islets were handpicked into each well with modified Krebs-Ringer bicarbonate buffer (KRBB) containing 3 mM glucose. After washes, islets were incubated consecutively in indicated low and high levels of glucose or arginine KRBB for 1 h. Islet total insulin was extracted with acid ethanol. Insulin level was measured with a mouse insulin ELISA kit (ALPCO Diagnostics, Windham, NH). Islet DNA was quantified with picogreen (Molecular Probes).

In vitro MIN6 Cell and Islet Proliferation Assays. MIN6 cells were plated onto 10 cm dishes (1 ´ 106 cells/dish) for cell counting or onto chamber slides (Lab-Tek; 10,000 cells/well) for BrdU analysis, rested in MIN6 media (High-glucose DMEM-Glutamax, Pennicilin/Streptomycin, Hepes (Invtirogen-GIBCO) and 15% FCS (HyClone) overnight, and then pulsed with Wnt3a (final concentration 100 ng/ml which is equal to 2.4 nM), vehicle only, or Wnt3a plus Fz8-CRD (final concentration 200 ng/ml which is equal to 3.3 nM), for 8 h. Isolated pancreatic islets were exposed to the same concentrations of Wnt or Fz8-CRD. Cells were collected at 24, 48, and 72 h for counting assays; each condition was performed in triplicate. For the BrdU incorporation assay, MIN6 cells or islets were pulsed with BrdU (final concentration of 0.6 mg/ml) at 6 h poststimulation and collected fixed with 4% PFA at 8 h. Cells were stained with anti-BrdU (as described above). For cell analysis, >15,000 cells per condition were counted based on DAPI incorporation. The percentage of BrdU+ spots per total number of DAPI+ spots per image was determined by using Volocity software. Results are the average of 10 images per experimental condition and described in terms of arbitrary area units.

ChIP Assay. ChIP assays were performed on pancreatic islets and MIN6 cells by using a kit from Upstate Biotech. Briefly, DNA was cross-linked to protein with formaldehyde. Cellular lysates were obtained by scraping followed by pulsed ultrasonication to shear cellular DNA. We performed overnight immunoprecipitations with an anti-Pitx2 antibody (10 mg/IP Santa Cruz Biotechnology). On the next day the cross-links were reversed, and bound DNA was purified by phenol:chloroform extraction. We performed PCR using primers specific for cyclin D1, cyclin D2, and cdk4 proximal promoter sequences. Primer sequences are listed below: Cyclin D2-1F:CACACCGTGAAACATTACAG, Cyclin D2-1R:CAGTTGGTTTGGTTTTGTTT, Cyclin D2-2F:TCTCTCTCAAACTTCCCAAA, Cyclin D2-2R:CACGTGGATGATATTCCTTT, Cyclin D2-3F:ATGAGTATCTGCCTTGGGTA, Cyclin D2-3R:AGGTTTTCTTTCCTCCTCTG, Cyclin D2-4F:ATGTCCAAAGGAGAAAAACA, Cyclin D2-4R:CCATTCCATTAGAAAAGCAC, Cyclin D1-1F: CCAAGAAAAATAAACCGTTG, Cyclin D1-1R: GAATAGTTCGCCTAGCTTGA, Cyclin D1-2F: GGTGGCCATTATTTCATCTA, Cyclin D1-2R: GAATAGTTCGCCTAGCTTGA, Cdk4-1F: ACCCTGTCATCTGTTTATGC, Cdk4-1R: AGGTGTTAGTGGGAGATCCT, Cdk4-2F: AAACAAAAACATCGCATACC, Cdk4-2R: GTTCTGGACACGTGATCTTC.

1. Harmon EB, Apelqvist AA, Smart NG, Gu X, Osborne DH, Kim SK. (2004) Development 131, 6163-6174.

2. Kim SK, Hebrok M, Li E, Oh SP, Schrewe H, Harmon EB, Lee JS, Melton DA. (2000) Genes Dev. 14, 1866-1871.

3. Bruning JC, Winnay J, Bonner-Weir S, Taylor SI, Accili D, Kahn CR. (1997) Cell 88, 561-572.

4. Ahlgren U, Jonsson J, Edlund H. (1996) Development 122, 1409-1416.

5. Chen H, Carlson EC, Pellet L, Moritz JT, Epstein PN. (2001) Diabetes 50, 2040-2046.

This Article

  1. PNAS April 10, 2007 vol. 104 no. 15 6247-6252
  1. OA Abstract
  2. Figures Only
  3. OA Full Text
  4. Full Text (PDF)
  5. » Supporting Information