Evolution of a fluorinated green fluorescent protein

Yoo et al. 10.1073/pnas.0701904104.

Supporting Information

Files in this Data Supplement:

SI Text
SI Figure 4
SI Figure 5
SI Table 2
SI Figure 6
SI Figure 7
SI Table 3
SI Table 4
SI Figure 8
SI Figure 9
SI Figure 10
SI Figure 11

SI Figure 4

Fig. 4. Schematic representation of the GFPm scaffold. Two mutations (S65G and S72A, red circles) were introduced into the cycle-3 GFP mutant (Q80R, F99S, M153T, and V163A, red circles) to change the spectral properties. There are 19 Leu residues (blue circles).

SI Figure 5

Fig. 5. MALDI-MS analysis of GFPm-T after trypsin digestion. A peptide fragment of sequence GEELFTGVVPILVELDGDVNGHK yields the spectrum shown. Replacement of Leu with Tfl results in a 54-amu mass increase per site.

SI Figure 6

Fig. 6. Flow cytometric analysis of cells expressing the first library in media supplemented with 1 mM Tfl and no Leu (A), 15 mM Leu (B), 30 mM Leu (C), or 45 mM Leu (D).

SI Figure 7

Fig. 7. Flow cytometric analysis of cells expressing proteins in media supplemented with 1 mM Tfl and 45 mM Leu. (A) Cells harboring the first library. (B) Cells after two rounds of sorting starting from A.

SI Figure 8

Fig. 8. Fluorescence spectra of 11.3.3-L before (black) and after (blue) acid denaturation. Purified protein was unfolded in 100 mM citrate (pH 1.9) containing 2 mM DTT at room temperature for 1 h. The denatured protein solution was diluted 100-fold into 20 mM Tris (pH 8.0)/100 mM NaCl/1 mM DTT. Incubation of GFP at pH 1.9 is known to cause some irreversible denaturation (2); however, the kinetics of refolding are independent of the extent of irreversible denaturation and the spectrum of the refolded protein is consistent with refolding to an authentic native structure.

SI Figure 9

Fig. 9. Equilibrium acid denaturation plots. The purified proteins were equilibrated with 100 mM buffer (Hepes for pH 8, 7.5, and 7; Mes for pH 6.5, 6, and 5.5; and acetate for pH 5, 4.5, 4) containing 100 mM NaCl at room temperature. Trp fluorescence was measured at 320 nm with excitation at 295 nm. GFPm-L (´), 4.2.2-L (■), 4.2.2-T (□), 8.3.3-L (▲), 8.3.3-T (Δ), 11.3.3-L (●), and 11.3.3-T (○).

SI Figure 10

Fig. 10. Effects of mutation at position 64 of 11.3.3. Position 64 was mutated into Phe or Leu, and the protein was expressed in media supplemented with the 20 canonical amino acids (black bars) or in media depleted of Leu and supplemented with Tfl (gray bars). Median cell fluorescence was measured by a cell sorter equipped with an argon ion laser emitting at 488 nm and a 530/40 bandpass filter. Relative fluorescence is defined as the median cell fluorescence compared with that of cells expressing 11.3.3 in media supplemented with Leu or with Tfl, respectively.

SI Figure 11

Fig. 11. Overlay of the normalized g(s*) plots from DcD+ analysis for GFPm-L(A), 11.3.3-L (B), and 11.3.3-T (C). Black line: 0.125 mg/ml, blue line: 0.25 mg/ml, pale green line: 0.5 mg/ml

SI Text

Preparation of GFPm

Oligonucleotides for site-directed mutagenesis All oligonucleotides were synthesized at Qiagen (Valencia, CA) on a scale of 10 nmol.

GFP-1: 5'-CATCACGGATCCATGAGTAAAGGAGAAGAACTTTTCACTGG-3'

GFP-2: 5'-CTAATTAAGCTTCTATTTGTAGAGCTCATCCATGCCATG-3'

GFP-3: 5'-CAACATTGAAGATGGTTCCGTTCAACTAGCAG-3'

GFP-4: 5'-CTGCTAGTTGAACGGAACCATCTTCAATGTTG-3'

GFP-5: 5'-CTTGTCACTACTTTCGGTTATGGTGTTCAATGC-3'

GFP-6: 5'- GCATTGAACACCATAACCGAAAGTAGTGACAAG -3'

GFP-7: 5'-GGTGTTCAATGCTTTGCGCGTTATCCGGATC-3'

GFP-8: 5'-GATCCGGATAACGCGCAAAGCATTGAACACC-3'

Addition of two restriction sites, BamHI and HindIII, and removal of the internalBamHIrestriction site. CLONTECH GFP-UV vector, containing the "cycle-3" variant was used as a template for two PCR steps by using Pfu DNA polymerase (Stratagene). The first fragment was obtained by PCR with GFP-1 and GFP-4. The second fragment was obtained by PCR with GFP-2 and GFP-3. The two fragments were purified on a 2% agarose gel (QIAquick gel extraction kit, Qiagen) and assembled by PCR. The PCR products were purified on a 2% agarose gel.

S65G mutation. The purified PCR product was used as a template to mutate amino acid residue 65 from serine to glycine. Following the same procedure as above, two fragments were generated by PCR with GFP-1 and GFP-6, or with GFP-2 and GFP-5. The fragments were purified on a 2% agarose gel and assembled by PCR. The PCR products were purified on a 2% agarose gel.

S72A mutation. A DNA fragment bearing terminal BamHI and HindIII sites and the S65G mutation, was used as a template for PCR to mutate position 72 to glycine. One fragment was generated by PCR with GFP-1 and GFP-8; the other with GFP-2 and GFP-7. The two fragments were assembled by PCR and purified on a 2% agarose gel.

Construction of the expression plasmid. The DNA fragment encoding GFPm was digested with BamHI (Roche) and HindIII (Roche) and ligated into expression plasmid pQE-80L (Qiagen) using T4 DNA ligase (New England Biolabs). The resulting plasmid was designated pQE-80L/GFPm.

Equilibrium acid denaturation (1, 2)

Tryptophan fluorescence was measured at 320 nm with excitation at 295 nm after protein samples were equilibrated in 100 mM buffer containing 100 mM NaCl at room temperature. The buffers used were Hepes (pH 8.0, 7.5, and 7.0), Mes (pH 6.5, 6.0, and 5.5), and acetate (pH 5.0, 4.5, and 4.0).

Sedimentation velocity analysis

Three protein samples (GFPm-L, 11.3.3-L, and 11.3.3-T) were equilibrated with PBS by passage through PD-10 columns. Sedimentation velocity analysis was performed at the National Analytical Ultracentrifugation Facility at the University of Connecticut by using a Beckman XL-I Analytical Ultracentrifuge at 20°C. The concentrations of protein samples were 0.125, 0.25, and 0.5 mg/ml. The rotor was accelerated to 55,000 rpm, and interference scans were acquired at 1-minute intervals for 4 h. The data were analyzed by using the program DcDt+ (3) to obtain normalized g(s*) vs. s* plots (SI Fig. 11). Analysis of the sedimentation velocity runs on GFPm-L showed it exists in a reversible monomer-dimer self-association; K_d was calculated as 23 mM by global fitting using Sedphat (4). 11.3.3-L and 11.3.3-T are present largely as dimers in the concentration range studied. The program Sedfit (version 9.3) (5) indicated small concentrations of tetramer (»8% and »3% for 11.3.3-L and 11.3.3-T, respectively).

1. Merkel JS, Regan L (2000) J Biol Chem 38:29200-29206.

2. Enoki S, Saeki K, Maki K, Kuwajima K (2004) Biochemistry 43:14238-14248.

3. Philo JS (2000) Anal Biochem 279:151-163.

4. Schuck P (2003) Anal Biochem 320:104-124.

5. Schuck P (2000) Biophys J 78:1606-1619.