Dynamic PolyConjugates for targeted in vivo delivery of siRNA to hepatocytes

Rozema et al. 10.1073/pnas.0703778104.

Supporting Information

Files in this Data Supplement:

SI Figure 7
SI Figure 8
SI Figure 9
SI Table 1
SI Materials and Methods




SI Figure 7

Fig. 7. Reversible attachment of the PEG shielding agent to the polymer is required for siRNA delivery. siRNA polyconjugate (10.6 mg of polymer, 0.66 mg of siRNA) covalently linked through a reversible bond to PEG (CDM-PEG) or an irreversible bond (NHS-PEG) was applied to primary hepatocytes. Twenty-four hours after transfection, relative apoB mRNA levels were measured versus GAPDH mRNA levels or versus the amount of input RNA in the RT-qPCR reaction, and then normalized to the values in untreated cells (cells alone). Data are shown as mean ±SD.





SI Figure 8

Fig. 8. Even distribution of Cy3-labeled dsDNA oligonucleotide in mouse liver after delivery using i.v. injection of polyconjugates. Representative confocal images of liver sections showing cells in zone 1 (A) and zone 3 (B) of the liver acinus. Livers were harvested 1 h after injection, fixed, and counterstained with ToPro-3 to visualize nuclei (blue) and Alexa 488 phalloidin to visualize cell outlines (green). Cy3-labeled 21-mer dsDNA oligonucleotide (red) is observed in all hepatocytes of each zone. Each image comprised a flattened projection of eleven optical images (0.4 mm each) to represent combined fluorescence signals from a 4-mm-thick section.





SI Figure 9

Fig. 9. Attachment of the hepatocyte targeting ligand N-acteylgalactosamine to ppara-1 siRNA polyconjugate is required for target gene knockdown. Mice were treated with ppara-1 siRNA polyconjugates (800 mg of polymer, 50 mg of siRNA) with (+) or without (-) attachment of N-acteylgalactosamine. Measurements of liver ppara mRNA levels relative to ubiquitin mRNA or total RNA were performed by using the Invader mRNA assay 2 days after injection. Shown are the data normalized to mice receiving a control siRNA. n = 5, data are shown as mean ±SD.





Table 1. Serum levels of cytokines and liver enzymes in siRNA polyconjugate-treated mice

Treatment

TNF-α, pg/ml

IL-6, pg/ml

IFN-α, pg/ml

ALT, units/liter

AST, units/liter

Saline

         

6 h

<6

<2

206 ± 51

   

48 h

<6

<2

321 ± 77

60 ± 21

149 ± 21

Control siRNA

         

6 h

7.9 ± 2.9

60.2 ± 2.4

207 ± 86

   

48 h

<6

4.0 ± 1.3

211 ± 16

97 ± 26

176 ± 62

apoB-1 siRNA

         

6 h

57.9 ± 7.2

48.6 ± 2.5

494 ± 165

   

48 h

<6

<2

257 ± 70

71 ± 30

144 ± 34

Serum was collected at the times indicated after injection of the siRNA polyconjugates containing 50 µg of siRNA, or saline. For analysis of TNF-α, IL-6, and IFN-α levels, serum samples from each individual were pooled according to groups and measured by using ELISA. Levels of ALT and AST were measured for each individual. n = 5; data are shown as mean ± SD.





SI Materials and Methods

siRNAs. The synthetic RNA oligonucleotides used in this study were obtained from Dharmacon (Lafayette CO). The sense strand RNAs contained a primary amine with a six carbon spacer at the 5' to allow conjugation to the delivery vehicle. The 2'ACE protected RNA oligonucleotides were deprotected before the annealing step according to the manufacturer's instructions. The siRNAs had the following sequences: apoB (Ensembl# ENSMUST00000037520); apoB-1 siRNA, sense 5'-NH4- GAAmUGmUGGGmUGGmCAAmCmUmUmUmA*G, antisense 5'- P-AmAAGUUGCCACCCACAUUCmA*G; apoB-2 siRNA, sense 5'-NH4- GGAmCAmUGGGmUmUCCAAAmUmUAmC*G, antisense 5'- P- UmAAUUUGGAACCCAUGUCCmC*G; ppara (GenBank no. NM_011144); ppara-1 siRNA, sense 5'-NH4- mUmCAmCGGAGmCmUmCAmCAGAAmUmUmC*U-3', antisense 5'- P-AmAUUCUGUGAGCUCCGUGAmC*U -3'; ppara-2 siRNA sense 5'-NH4- mUmCCCAAAGCmUCCmUmUmCAAAAmU*U -3', antisense 5'- P-mUmUUUGAAGGAGCUUUGGGAmA*G-3'; Control siRNA (GL-3 luciferase reporter gene), sense 5'-NH4- mCmUmUAmCGmCmUGAGmUAmCmUmUmCGAmU*U-3', antisense 5'- P-UmCGAAGUACUCAGCGUAAGmU*U. m, 2'-O-CH3 substitution; *, phosphorothioate linkage; P, PO4. Sense and antisense oligonucleotides for each target sequence were annealed by mixing equimolar amounts and heating to 94°C for 5 min, cooling to 90°C for 3 min, then decreasing the temperature in 0.3°C steps 250 times, holding at each step for 3 sec.

Determining Percent Conjugated siRNA. The percentage of conjugated siRNA on the PBAVE polymer was determined by treating 10-ml aliquots of siRNA-polymer conjugate containing ~1 mg of siRNA with 2 ml of 1 M DTT or with no additive and incubating at room temperature for 16 h. One hundred micrograms of polyacrylic acid and 300 mg of NaCl were then added to the samples to neutralize electrostatic interactions. After a 2-h incubation, the samples were electrophoresed on a 2% agarose gel and the siRNA was visualized by staining with ethidium bromide. The siRNA bands were quantified by using Kodak Molecular Imaging Software v.4.0. The amount of unconjugated siRNA was normalized to the amount released upon DTT treatment to determine percent conjugation.

Particle Size Determination. The size of the siRNA polyconjugate was measured by light scattering at 532 nm by using a Brookhaven Instruments ZetaPlus Particle Sizer, I90. Samples were analyzed in buffer containing 5 mM TAPS (pH 9.0) and at a polyconjugate concentration of 0.8 mg/ml polymer, 50 mg/ml siRNA. The sizes were determined by multimodal sample distribution (MSD), which calculates distribution based on the total number of each size particle within the sample. It was observed that >95% of particles were 10 ± 2 nm.

Primary Hepatocyte Isolation and Transfection. Primary hepatocytes were harvested from adult mice (strain C57BL/6) by using the two-step collagenase perfusion procedure as previously described (1). Hepatocyte viability was 85-90% as determined by Trypan blue exclusion. Hepatocytes were plated at a density of 1.5 ´ 105 cells per well in collagen-coated 12-well plates in 1 ml of media containing 10% FCS. Twenty-four hours after plating, cells in triplicate wells were transfected without media change with siRNA using TransIT-siQuest (Mirus Bio, Madison, WI) according to the manufacturer's protocol, or with different amounts of siRNA polyconjugate. Hepatocytes were harvested 24 h after transfection and total RNA was isolated with Tri Reagent (Molecular Research Center, Cincinnati, OH).

Mice and Injection Procedures. All animal studies were conducted at Mirus Bio Corporation with approval from Mirus's Institutional Animal Care and Use Committee. Six- to eight-week-old male mice (strain C57BL/6, 20-25g) were obtained from Harlan Sprague-Dawley (Indianapolis, IN). Mice were housed at least 10 days before injection. Feeding was performed ad libitum with Harlan Teklad Rodent Diet (Harlan, Madison, WI). Mice were injected with siRNA polyconjugate into the tail vein in a total volume of 0.4-ml injection Hepes-buffered (5 mM, pH 7.5) isotonic glucose in ~4 sec.

Serum Collection, Liver Harvest, and RNA Isolation. Mice were fasted for 4 h before serum collection by retroorbital bleed and liver harvest. Serum for use in Western blot assays was collected and added to an equal volume of Complete Protease Inhibitor Mixture containing EDTA (Roche, Indianapolis, IN) and stored at -20°C. Total RNA was isolated from liver immediately after harvest by using Tri Reagent according to the manufacturer's protocol (Molecular Research Center).

Microscopy and Analysis of Liver Sections. For analysis of hepatocyte targeting, polyconjugate containing 10 mg of Cy3-labeled, 21-mer dsDNA was formulated as described above in a total volume of 0.2 ml and delivered into male ICR mice (20-25 g; Harlan Sprague-Dawley) by i.v. injection. One hour after injection, mice were killed and liver samples were harvested. In some experiments, tissue samples from lung, kidney, spleen, brain and pancreas were also harvested. Tissue samples were fixed in 4% paraformaldehyde/PBS for 6 h and then placed into a 30% sucrose/PBS solution overnight at 4°C. Fixed tissue samples were then placed into block holders containing OCT freezing medium (Fisher Scientific, Pittsburgh, PA) and snap-frozen in liquid nitrogen. Frozen tissue sections (8-10 mm) were prepared by using a Microm HM 505N cryostat (Zeiss, Thornwood, NY) and placed onto Superfrost-Plus microscope slides (Fisher Scientific). Tissue sections were counterstained with Alexa-488 phalloidin (13 nM; Invitrogen, Carlsbad, CA) and To-Pro-3 (40 nM; Invitrogen) in PBS for 20 min. The slides were mounted in VECTASHIELD (Vector Laboratories, Burlingame, CA) and analyzed by using an LSM 510 confocal microscope (Zeiss).

For analysis of liver fat accumulation, liver samples from siRNA-polyconjugate-treated and control mice were frozen in OCT freezing medium, and frozen tissue sections (8-10 mm) were prepared as described above. Air-dried tissue sections were fixed in 4% formaldehyde/PBS for 20 min, rinsed in several changes of distilled water, and then rinsed briefly with 60% isopropanol. Oil red O stock solution was prepared by mixing 0.5 g of oil red O in 100 ml of isopropanol overnight and filtered by using Whatman #1 filter papers. Oil red O working solution was prepared by mixing 20 ml of water with 30 ml of oil red O stock solution and filtered by using a 0.2-mm Nalgene filtration unit (Fisher Scientific). The fixed sections were stained with freshly prepared oil red O working solution for 15 min, rinsed briefly with 60% isopropanol. Counterstaining of nuclei was performed by dipping the slides into Harris modified hematoxylin solution (Sigma, St. Louis, MO) seven times and rinsed in distilled water. Rinsed slides were then mounted with Gel Mount (biomedia, Foster City, CA). Stained slides were analyzed by using a Zeiss Axioplan 2 microscope equipped with a digital camera (AxioCam; Zeiss). Digital images were captured by using AxioVision software (Zeiss).

Quantitative PCR and Invader Assays. In preparation for quantitative PCR, total RNA (500 ng) was reverse transcribed by using SuperScript III (Invitrogen) and oligo-dT primers according to the manufacturer's protocol. Quantitative PCR was performed by using a Model 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA). TaqMan gene expression assays for apoB and ppara were used in biplex reactions in triplicate with GAPDH mRNA primers and probe using TaqMan Universal PCR Master Mix (Applied Biosystems). The sequence of the GAPDH primers and probe (IDT, Coralville, IA) were GAPDH-forward 5'-AAATGGTGAAGGTCGGTGTG-3'; GAPDH-reverse 5'-CATGTAGTTGAGGTCAATGAAGG-3'; and GAPDH-probe 5'-Hex/CGTGCCGCCTGGAGAAACCTGCC/BHQ-3'. Direct measurements of ppara mRNA levels were performed using a custom designed Invader mRNA assay according to the manufacturer's instructions (Third Wave Technologies, Madison, WI). Biplex reactions were performed in triplicate using the probe set for ubiquitin according to the manufacturer's instructions.

ApoB Western Blot, Cytokine Assays, and Liver Toxicity and Metabolic Panels. Separation of serum proteins (0.1 ml) was accomplished by electrophoresis on 3-8% polyacrylamide/SDS gels. The separated proteins were electrophoretically transferred to PVDF membrane followed by incubation with a 1:5,000 dilution of a rabbit polyclonal anti-ApoB antibody (BIODESIGN International, Saco, ME). The blot was then incubated with a 1:80,000 dilution of goat anti-rabbit antibody conjugated to horseradish peroxidase (Sigma), and antibody binding was detected by using an enhanced chemiluminescent detection kit (Amersham Pharmacia Biosciences, Piscataway, NJ). Serum levels of the mouse cytokines TNF-a and IL-6 were measured by sandwich ELISA with reagents according to the manufacturer's instructions (R&D Systems, Minneapolis, MN). Serum levels of mouse IFN-a were measured by using a sandwich ELISA kit according to the manufacturer's instructions (PBL Biomedical, Piscataway, NJ). Serum levels of ALT, AST, cholesterol, and triglycerides were measured by using automated systems at the Marshfield Clinic Laboratories Veterinary Diagnostic Division (Marshfield, WI).

1. Klaunig JE, Goldblatt PJ, Hinton DE, Lipsky MM, Chacko J, Trump BF (1981) In Vitro 17:913-925.

This Article

  1. PNAS August 7, 2007 vol. 104 no. 32 12982-12987
  1. AbstractFree
  2. Figures Only
  3. Full Text
  4. Full Text (PDF)
  5. » Supporting Information