Sterility and absence of histopathological defects in nonreproductive organs of a mouse ERβ-null mutant

Antal et al. 10.1073/pnas.0712029105.

Supporting Information

Files in this Data Supplement:

SI Figure 5
SI Materials and Methods
SI Figure 6
SI Table 1
SI Figure 7
SI Figure 8
SI Figure 9
SI Figure 10
SI Figure 11
SI Figure 12
SI Figure 13
SI Figure 14
SI Table 2
SI Table 3
SI Table 4




SI Figure 5

Fig. 5. Targeted disruption of mouse ERb gene. (a) Schematic strategy to generate ERb-null mutant mice (ERb_ST^L-/L-). Diagrams showing the WT ERb locus, the targeting vector, the targeted allele, the floxed allele and the deleted allele resulting after Cre-mediated recombination. Exons 2 and 3 are shown as black boxes. The location and size of P5' and P3' probes are indicated. The TK-neo cassette is depicted as an open box and lox-P sites are indicated with black arrowheads. Arrows indicate the positions of PCR primers. (b) Western blot analysis of ERb protein in WT and ERb_ST^L-/L- prostate and testis (see SI Materials and Methods). Note the lack of 61-kDa ERb immunoreactivity in ERb_ST^L-/L-. Molecular mass is indicated. (c) Detection of mERb transcripts by RT-PCR of WT (+/+), ERb_ST^+/L- and ERb_ST^L-/L- uterus total RNAs. The general organization of mERb RNA is depicted at the top. The location of the nine exons, their size give in basepairs and in amino acid length are indicated. The two sets A, A' and B, B' of primers used to amplify full-length coding cDNA of ERb are shown with black arrowheads. The experimental design of mERb transcripts by RT-PCR performed with WT (+/+), ERb_ST^+/L- (+/-) and ERb_ST^L-/L- (-/-) uterus total RNA is depicted. PCR products separated on agarose gel were obtained by using sets of primers 1 to 8. Oligonucleotide sequence of sets of primers and lengths of PCR products are reported in SI Table 4. Southern blotting of the PCRs 3, 7, and 8 are analyzed with 5' radiolabeled oligonucleotides specific for ERb exons 1 (A), 4 (B), and 6 (C) and their size is given in kilobases.

SI Figure 6

Fig. 6. Body weight, organ weights, and organ to body weight ratios in 5-month-old (Young adults) and 16- to 19-month-old (Old mice) WT and ERb_ST^L-/L- males and females. Body length (in millimetres) was measured from the tip of the snout to the base of the tail. Body mass index (BMI) corresponds to the ratio between weight (in grams) and length. BMI, body mass index; WAT, paragenital white adipose tissue. Three males and six females of each genotype were used at 5 months of age, 11 males of each genotype at 16 months of age, and seven females of each genotype at 19 months of age; results are expressed as mean ±SEM.

SI Figure 7

Fig. 7. Clinical chemistry and hematology in 16- to 19-month-old WT and ERb_ST^L-/L- males and females. Clinical chemistry explores energy metabolism (glucose, total cholesterol, triglycerides, free fatty acids, glycerol), renal function (urea and creatinine), hepatic function (albumin, ALAT), ionic balance (bicarbonate, calcium, phosphorus), non tissue-specific enzymes (LDH, ALP, ASAT), exocrine pancreas function (a-amylase). Results are expressed as millimoles per liter (mmol/liter), milliequivalents per liter (mEq/liter), grams per liter (g/liter) or International Units per liter (U/liter). Note that the statistically significant differences in bicarbonate levels (males) and ALAT values (females) fall within a range of values that are not associated to pathological outcomes in humans. Hematological parameters displayed here are red blood cells number (x10⁶/ml), haemoglobin (grams/decilitre; g/dl), hematocrite, mean corpuscular volume (MCV, femtoliters; fl), mean corpuscular haemoglobin (MCH, picograms; pg), mean corpuscular haemoglobin concentration (MCHC, grams/decilitre; g/dl), platelets number (´10⁵/ml). Note that white blood cells number and percentages of neutrophils and lymphocytes are displayed in c-e. ALAT, alanine aminotransferase; ALP, alkaline phosphatase; ASAT, aspartate aminotransferase; LDH, lactate dehydrogenase; Hb, haemoglobin; MCV, mean corpuscular volume; MCH, mean corpuscular haemoglobin; MCHC, mean corpuscular haemoglobin concentration. For each genotype, 7 males and 11 females were used for clinical chemistry, 10 males and 7 females for blood cells count, and 6 males and 6 females for differential count of white blood cells; results are expressed as mean ±SEM.

SI Figure 8

Fig. 8. Ovarian morphology in 5-month-old ERb_ST^L-/L- mice. a-f Representative hematoxylin and eosin-stained histological sections of WT (a, c, and e) and ERb_ST^L-/L- (b, d, and f) ovaries. (a and b) Low power images showing that atretic follicles (AF) and corpora lutea (CL) are equally represented in WT and ERb_ST^L-/L- ovaries. (c and d) The theca layer (T) of preantral follicles displays the same thickness in ERb_ST^L-/L- and WT ovaries. (e and f) High power view of the theca layer. Note the absence of obvious differences regarding the cellular composition and vascularisation of the theca layer in the ERb^L-/L- and WT mice. (g and h) Sirius red staining of collagen fibers. Note the absence of differences in the amount of collagen surrounding the follicles (F) and corresponding to the theca layer, but the increased collagen deposits in the stroma (S) of ERb_ST^L-/L- ovary. AF, atretic ovarian follicles; CL, corpora lutea; F, ovarian follicle; G, granulosa cells; O, oocyte; OB, ovarian bursa; S, ovarian stroma; T, theca layer. Ovaries from 11 ERb_ST^L-/L- and 8 WT females were analyzed. (Scale bar: 325 mm for a, b, g, and h; 50 mm for c and d; 20 mm for e and f.)

SI Figure 9

Fig. 9. Ovarian cycle in 5 and 8-month-old WT and ERb_ST^L-/L- mice. (a and d) During proestrus-estrus, vaginal smears of WT mice show large, non-nucleated epithelial cells (E) intermingled with smaller and nucleated epithelial cells (NE); these stages are not detectable in ERb_ST^L-/L- females, in which vaginal smears display a mixture of nucleated and non-nucleated epithelial cells, and neutrophils, aspect that does not correspond to any normal stage of the ovarian cycle. (b and e) At metestrus II vaginal smears show numerous neutrophils (PMN) together with packed nucleated epithelial cells (NE) and with some non-nucleated epithelial cells in both, WT and ERb_ST^L-/L- females. (c and f) At diestrus vaginal smears show few neutrophils (PMN) scattered amongst nucleated epithelial cells (NE) displaying various degrees of shrinkage, and some non-nucleated epithelial cells (E) in both, WT and ERb_ST^L-/L- females. E, non-nucleated epithelial cells; NE, nucleated epithelial cells; PMN, neutrophils. Four to 6 females were analyzed at each stage of the ovarian cycle. Hematoxylin and eosin stain. (Scale bar: 50 mm.)

SI Figure 10

Fig. 10. Normal ductal system of the 5 and 8-month-old ERb_ST^L-/L- female mammary gland. (a-e) Whole-mount preparations of the third pair of mammary glands from a WT at metestrus (a and b) and diestrus (c), and from an ERb_ST^L-/L- displaying no ovarian cycling activity (d and e). The diestrus mammary gland displays terminal end buds (TEB) and branching points (arrowheads). (f-i) Hematoxylin and eosin-stained sections from the fourth pair of glands at 19 months of age. No dilatation (f-i) or structural anomalies (g and i) of mammary gland ducts (D) are observed in the mutants. Four females of each genotype were analyzed by whole mount, and 10 were analysed by histology. D, duct; E, ductal epithelium; M, smooth muscle cells; TEB, terminal end buds. (Scale bar: 128 mm for a and e; 580 mm for f and h; and 20 mm for g and i.)

SI Figure 11

Fig. 11. Atypias in epithelia of the ventral (a-f and h) and dorsolateral (g) prostate lobes of 16-month-old WT (a, c, e, f, g, and h) and ERb_ST^L-/L- (b, d, g, and h) mice. (a and b) Examples of karyomegaly (arrowheads). Note that these large nuclei are detected at the same frequency on serial histological sections of WT (n = 4) and ERb_ST^L-/L- (n = 4) males (see also g and h). (c and d) Examples of cytoplasmic vacuolisation. Note that vacuoles are more frequent in WT than in ERb_ST^L-/L- males (see also g and h). (e) A single case of true epithelial hyperplasia was found in a WT males. (f) High magnification of e. (g and h) Number of atypical alveolar cross-sections in dorsolateral and ventral prostates, respectively, showing one or several of the following alterations: epithelial cells vacuolization (V), atypical nuclei in alveoli without or with functional hyperplasia (AN and ANH, respectively) and true epithelial hyperplasia (H). (i) Number of Ki67-positive cells in ventral (VP) and dorsolateral (DP) prostatic epithelia (‰). AN, atypical nuclei in alveoli without functional hyperplasia; ANH, atypical nuclei in alveoli with functional hyperplasia; E, prostatic epithelium; H, true epithelial hyperplasia; M, smooth muscle; V, epithelial cells vacuolization. In g-i, results are expressed as means ± SEM (n = 4). (Scale bar: 20 mm for a, b, and f and 80 mm for e.)

SI Figure 12

Fig. 12. Absence of differences in brain weight and neuronal density (a and b), and in lymphocyte and granulocyte number (c-g) between 16-month-old WT and ERb_ST^L-/L- mice. (a) Weight of cerebral hemispheres (in grams) of males and females. (b) Graphic representation of mean neurons number per 0.04 mm² in cortical layers II-III, IV, V and VI of males. (c-g) Total white blood cell count (e) (´10³/ml), differential count of neutrophils (d, indicated as percentage of the total white blood cells) and lymphocytes (e, indicated as percentage of the total white blood cells) in males and females. (f) Total cell number in the spleen (TCS) and bone marrow TCBM) of females (´10⁶). (g) FACS analysis of spleen and bone marrow of ERb_ST^L-/L- females; results are expressed as percentage of total cell number in these organs. Note that B-cells (i.e., BLS and BLBM) represent total B-cell population and that myeloid cells (i.e., MCS and MCBM) represent myelocyte subpopulations expressing high levels of the membrane markers Mac1 and GR1, which are hallmarks of mature granulocytes. Five males of each genotype were used for neuron counts, and seven mice of each sex and genotype for brain hemisphere weights. Ten 16-month-old males and seven 19-month-old females of each genotype were used for blood cell count, six mice of each sex and genotype for differential white blood cell count, and four 19-month-old females of each genotype for FACS analyses. Results are expressed as means ±SEM.

SI Figure 13

Fig. 13. Absence of fibrillar collagen deposits within lung alveolar walls and normal size of alveoli in 19-month-old ERb_ST^L-/L- females. (a and b) Representative sirius red-stained sections from ERb_ST^L-/L- and WT lungs, respectively visualized under normal (brightfield) and polarized (darkfield) light. (c) Brightfield and polarized light images of a histological section through the esophagus wall used as positive control of the sirius red staining procedure: polarized light allows to unambiguously distinguish collagen fibers (orange and green signals) from sirius red-positive non-collagenous structures (e.g., keratinized layer of the epithelium, K). Four females of each genotype were used in the sirius red staining assay. d, Method for alveolar surface measurement: photomicrograph of lung parenchyma and corresponding computer-generated black-and-white image: total alveolar space is in white; non-alveolar spaces including alveolar ducts (AD), terminal bronchioli (TB), blood vessels (BV) are in black. A, alveoli; AD, alveolar ducts; BV, blood vessel; E, epithelium; LP, lamina propria; K, keratinized layer of the epithelium; TB, terminal bronchiolus. (Scale bar: 20 mm for a-c and 40 mm for d.)

SI Figure 14

Fig. 14. Normal histological aspect of the colon and urinary bladder of 5-month-old ERb_ST^L-/L- females. (a-d) Normal wall structure and subepithelial cell populations in the ERb_ST^L-/L- proximal colon (transverse sections; hematoxylin and eosin). (e and f) Identical distribution of acid mucins in the WT and ERb_ST^L-/L- distal colon (transverse sections; alcian blue). (g and h) Normal wall structure and subepithelial cell populations in the ERb_ST^L-/L- urinary bladder (hematoxylin and eosin). C, colonic crypt; E, epithelium; M, tunica muscularis; MM, muscularis mucosae; SM, submucosa. Six females of each genotype were used in each assay. (Scale bar: 130 mm for a and b; 17 mm for c and d; 80 mm for e and f; and 68 mm for g and h).

Table 1. Organs subjected to systematic histological analysis in ERb_ST^L-/L- mutants and in their WT littermates

Table 2. Southern blot analysis of XbaI- and ApaI- digested DNAs

 

Digestion		L3		L2		L-
		p5'	p3'	p5'	p3'	p5'	p3'
Xba I	WT	13.0	13.0	13.0	13.0	13.0	13.0
	Mutant	8.0	8.2	4.9	8.2	4.2	8.2
Apa I	WT	-	6.3	-	6.3	-	6.3
	Mutant	-	7.2	-	5.9	-	5.2

The size of restriction fragments obtained by Southern blot analysis is given in kilobases. This analysis allows distinguishing WT and targeted alleles.

Table 3. Mouse genotyping by PCR

Genotype analysis was carried out by PCR, using primers ACG222, ACZ310, TS81, and WR20 (SI Fig. 5a indicate their positions and see SI Materials and Methods). The size of PCR products of alleles, separated on agarose gel, is given in basepairs. ND, not detectable.

Table 4. RT-PCR strategy

The sequences corresponding to the sets of primers used are reported and the sizes of the RT-PCR products are given in basepairs.

SI Materials and Methods

Targeted Disruption of the Mouse ERb Gene by Homologous Recombination. Two 5'- radiolabeled oligonucleotides 5'- ATGACATTCTACAGTCCTGCTGTGATG -3' and 5'- GAAGTGAGCATCCCTCTTGGCGCTTGG -3' of the mouse ERb A/B region (GenBank accession no. NM_207707) were used to isolate a 15-kb genomic clone containing the exons 2 and 3 of mERb gene (SI Fig. 5a) from an 129Sv embryonic stem (ES) cell library. The 6.7-kb EcoRI-NheI fragment was subcloned and the 3.2-kb SmaI fragment containing a fusion of the herpes simplex virus thymidine kinase (TK) and bacterial neomycin phosphotransferase (neo) gene driven by the phosphoglycerate promoter and flanked by loxP sites (1) was cloned with a 5' to 3' orientation into the AvrII site. A loxP site was introduced at the BstxI site by PCR-based site-directed mutagenesis using the oligonucleotide sequence: 5'- GGGCCCATAACTTCGTATAATGTATGCTATACGAAGTTATGGTACCTGCG-3', containing the sequences of ApaI-LoxPsite-KpnI-BstXI sites. The 10-kb EcoRI-NotI fragment was electroporated into 129 SvPas H1 ES cells (2) and G418 neomycin-resistant clones were expanded (3).

Targeted ES Cell Identification by Southern Blot Analysis. XbaI-, ApaI-digested ES cell genomic DNA was hybridized with 5' and 3' external probes (depicted as P5' and P3' in SI Fig. 5a) and a neo probe (KpnI-NcoI fragment from pHR56 (1)]. The sizes of bands in WT or in targeted ES cell clones are reported in SI Fig. 5 and Table 2.

Generation of ERb-Null Mutant Mice (ERb_ST^L-/L-). Targeted ES cells were injected into C57BL/6 blastocysts and returned to a pseudopregnant host of the same strain. Chimeric males were obtained that transmitted the mutation through crosses with C57BL/6 females, yielding heterozygous ERb^L3/+ mice (mice bearing a L3 allele and a WT (+) allele). ERb_ST^L3/+ mice bred with homozygous CMV-Cre transgenic mice (4) should generate ERb_ST^L-/+ mice (mice bearing one allele in wich exon 3 and the selectable marker were deleted) and ERb_ST^L2/+ mice (mice in which the selectable marker only has been deleted and therefore bearing one floxed allele in which exon 3 is flanked by loxP sites). Thus, after targeting of the WT allele, the Cre recombinase allows the excision of exon 3 and the floxed selection marker cassette, resulting from splicing of exon 2 to exon 4 in the deletion of sequences encoding amino acid residues 141 to 196 and the creation of a frame shift at the beginning of exon 4, with a stop codon at nucleotide position 599 (5), GenBank accession no. AF0674. The putative resulting truncated protein would be a 142 amino acid long peptide lacking the C to F regions of ERb. In contrast, partial Cre-mediated excision of the "floxed" selection cassette will lead to the conditional "floxed" allele L2 (SI Fig. 5a).

Animal experiments were supervised by Manuel Mark (agreements nos. 67-62), in compliance with the European legislation on care and use of laboratory animals.

Genotyping on Tail-Biopsy DNA. Standard 30 cycles PCR was performed, using the oligonucleotides: ACG222 (5'-CTTCTTAGAGGTACGGATCCCAGCCCAGCC-3'), ACZ310 (5'-AATCTCTTTGCCTTCCAGAGCTA-3'), WR20 (5'GCATAGCGCAGTTGGTAGAG-3') and TS81 (5'-TCATAGCCTGAAGAACGAGA-3'). The sizes of the amplified fragments are given in SI Table 3.

Analysis of ERb Protein by Western Blot Analysis. Protein extracts were prepared from WT and ERb_ST^L-/L- prostate and testis (6). Eighty milligrams of protein from the prostate and 20 mg of protein from the testis were separated on 10% gel by SDS/PAGE and transferred onto nitrocellulose membrane. ERb (61 kDa) was detected with a mouse polyclonal antibody raised against a peptide corresponding to residues 467-485 (5) of the ERb region F (SI Fig. 5b).

Analysis of ERb Transcripts in WT, ERb_ST^L-/+, and ERb_ST^L-/L- Mutants. Reverse transcription was carried out on 1 mg of total RNA and subsequent nested PCRs were performed to amplify the ERb cDNAs from total RNA extracted from uterus or ovaries from WT, ERb_ST^L-/+ and ERb_ST^L-/L- mice (7). To this end, two sets of primers were used in standard 30 cycles PCR: set A and A' primers (A: 5'-TCTCTGAGAGCATCATGTCC-3' and A': 5'-CAGCCTGGCCGTCACTGTGA-3') and set B and B' primers (B: 5'-TGCTCTAGACCACCATGTCCATCTGTGCCTCT-3' and B': 5'-CCGGAATTCTCACTGTGACTGGAGGTTCTG-3') (ref. 5 and GenBank accession no. AF0674). ERb PCRs (1 to 8) depicted in the experimental strategy (SI Fig. 5c) were performed by using 8 sets of primers (1a and 1b to 8a and 8b). SI Table 4 recapitulates the sequences of the primers and the expected size of the amplified products. PCR products separated on agarose gel were detected by ethidium bromide staining. The ERb PCR products 3, and 7, 8 (two deposits corresponding to two concentrations for each) were analyzed by Southern blotting with radiolabeled oligonucleotide probes specific for exon 1 (probe A: 5'-GCCATGACATTCTACAGTCC-3'), exon 4 (probe B: 5'-ACGAATCAGTGTACCATAGAC-3') and exon 6 (probe C: 5'-GTCCGCCTCTTGGAAAGCTGC-3').

In vivo fertility tests and superovulation experiments. Seven 10- to 14-week-old ERb_ST^L-/L- females or males were bred during 16 weeks with fertile males or females. The presence of vaginal plugs was assessed daily; the number of litters and number of pups per litter were scored. Superovulation experiments were performed as described by (8).

Histology. Before fixation, brains were sliced using a brain matrix (coronal incidence; Harvard Apparatus), following "RENI: Guides for Organ Sampling and Trimming recommendations" (www.item.fraunhofer.de/reni/trimming/index.php), except that section plane number 2 was replaced by section plane number 4. Proximal colon corresponded to the first 2 cm of colon distal to the caecum. Distal colon was defined as the first 2 cm of the descending large intestine. For morphometrical analyses, lungs were gently intratracheally instilled with Bouin's fluid and fixed 24 h in the same fixative. Prostates were oriented and embedded according to (9). Brains slices and whole prostates were serially sectioned at a thickness of 7 mm, and one of every three slides was stained with hematoxylin and eosin for analysis. For the quantification of the number of corpora lutea and atretic follicles, 5-mm-thick sections from the entire ovary of 5 females of each genotpe were collected and stained with hematoxylin and eosin. Three 5-mm-thick consecutive histological sections were collected from the other organs, stained with hematoxylin and eosin and examined. The complete list of organs that were systematically compared between age- and sex-matched ERb_ST^L-/L- mutants and WT mice is provided in SI Table 1. Some of the heart histological sections were stained by using a modified Mallory's trichrome procedure (www.empress.har.mrc.ac.uk). Fibrillar collagen was detected by using sirius red according to Eumorphia standard operating procedures (www.empress.har.mrc.ac.uk). Acid mucins were stained by using alcian blue: slides were deparaffinised, immersed in 3% acetic acid for 3 min, stained in 2.5% alcian blue for 30 min, washed in running water for 5 min then rinsed in demineralised water; nuclei were counterstained by nuclear fast red. All stained histological sections were dehydrated and mounted in a permanent mounting medium (Eukitt, Labonord). Blood smear staining and differential blood count was performed according to Eumorphia recommendations (www.eumorphia.org). For f-actin staining, unfixed transverse cryosections through the heart were incubated for 1 h at room temperature with FITC-conjugated phalloidin (Invitrogen) (1/200 in PBS), washed in PBS, counterstained with DAPI (Roche) at 1 mg/ml in PBS for 15 min, washed twice in PBS and mounted in Vectashield (Vector). TUNEL assays were performed according to manufacturer instructions (Chemicon).

Immunohistochemistry. Expression of the proliferation marker Ki67 was evaluated in ERb_ST^L-/L- and WT ventral and dorsolateral prostate lobes that had been fixed in formalin for 24 h and embedded in paraffin as described (www.empress.har.mrc.ac.uk). The number of Ki67-positive nuclei was evaluated in each mouse of a total number of 2500 DAPI-stained nuclei per lobe. For glial fibrillary acidic protein (GFAP) immunostaining, sections from brain slices that had been fixed in 4% buffered formaldehyde were deparaffinised, the antigen was unmasked by microwave exposure (10 min at 900 W in 0.1 M citrate buffer, pH 6) and nonspecific signals were blocked by a 30 min incubation in saturation buffer (5% normal goat serum in 0.1% Tween). The sections were then incubated overnight at 4°C with a monoclonal mouse anti-GFAP antibody (Dako), washed, incubated with a CY3-conjugated secondary antibody (Jackson ImmunoResearch), counterstained with DAPI (Roche) at 1 mg/ml in PBS for 15 min, washed 3 times (5 min each) in PBS and mounted in Vectashield (Vector).

FACS Analyses. For FACS analyses, cells from spleen and femur bone marrow were suspended in 10 ml of 0.5% BSA (BSA) in PBS. Cellularity was evaluated by using a hemocytometer. Three million cells from each organ were incubated with the following antibody mixtures: B220-FITC (Caltag) and IgM-phycoerythrine (Jackson ImmunoResearch) or Mac1-FITC and GR1-phycoerythrine (PharMingen) for 15 min at 4°C. Cells were washed in 0.5% BSA in PBS and fifty thousand stained cells for each organ and antibody mixture were counted by using FACSCalibur system. Data were analyzed by using FloJo software.

1. Metzger D, Clifford J, Chiba H, Chambon P (1995) Conditional site-specific recombination in mammalian cells using a ligand-dependent chimeric Cre-recombinase. PNAS 92:6991-6995.

2. Dierich A, Dollé P (1997) in Developmental Toxicology and Biology, eds Thiel R, Klug S (Blackwell Science), pp 111-123.

3. Lufkin T, Dierich A, LeMeur M, Mark M, Chambon P (1991) Disruption of the Hox-1.6 homeobox gene results in defects in a region corresponding to its rostral domain of expression. Cell 66:1105-1119.

4. Dupé V, et al. (1997) In vivo functional analysis of the Hoxa-1 3' retinoic acid response element (3'RARE). Development (Cambridge, U.K.) 124:399-410.

5. Tremblay GB, et al. (1997) Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor b. Mol Endocrinol 11:353-365.

6. Rochette-Egly C, et al. (1994) Detection of retinoid X receptors using specific monoclonal and polyclonal antibodies. Biochem Biophys Res Commun 204:525-536.

7. Auffray C, Rougeon F (1980) Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA Eur J Biochem 107:303-314.

8. Dupont S, et al. (2000) Effect of single and compound knockouts of estrogen receptors a (ERa) and b (ERb) on mouse reproductive phenotypes. Development (Cambridge, U.K.) 127:4277-4291.

9. Roy-Burman, et al. (2004) Genetically defined mouse models that mimic natural aspects of human prostate cancer development. Endocr Relat Cancer 11:225-254.

• Early Edition
• Archives
• Online Submission

• Feature Articles

  (Expanded research articles of exceptional breadth)

• Commentaries

  (Expert commentary on leading research)

• Letters

  (Online-only letters to the editor)

• Inaugural Articles

  (Articles by recently elected NAS members)

• PNAS Profiles

  (Biographical profiles of Academy members)

• Sustainability Science

  (Interactions of human and environmental systems)

• Collected Papers

  (Editorials, Perspectives, Reviews, Colloquia, etc.)

• Special Features

  (Solicited articles on exceptional research topics)

• Sackler Colloquia

  (Scientific reports held under NAS auspices)