Genetic, biochemical, and morphological evidence for the involvement of N-glycosylation in biosynthesis of the cell wall β1,6-glucan of Saccharomyces cerevisiae

  1. Manasi Chavan,
  2. Tadashi Suzuki*,
  3. Magdalena Rekowicz, and
  4. William Lennarz
  1. Department of Biochemistry and Cell Biology, Stony Brook University, Stony Brook, NY 11794
  1. Contributed by William Lennarz, October 10, 2003

Abstract

Recent evidence indicates that Stt3p plays a central role in the recognition and/or catalytic step in N-glycosylation (asparagine-linked glycosylation) in the lumen of the endoplasmic reticulum. It is known that stt3 mutants exhibit certain phenotypic features that are suggestive of a cell wall defect. To understand the basis of these phenotypes, we devised a genetic screen to isolate strains bearing mutations that lead to synthetic lethality in combination with the stt3–1 mutation. Using this screen, we were surprised to identify two KRE genes (KRE5 and KRE9) that are involved in the biosynthesis of the cell wall β1,6-glucan. This finding led us to propose that the N-glycosylation process is essential in the biosynthesis of cell wall β1,6-glucan. This proposal was supported by the observation that several stt3 mutants exhibited a 60–70% reduction in the content of cell wall β1,6-glucan as compared with WT cells. Transmission electron microscopy revealed that the stt3 mutant strains exhibit a diffused cell wall with loss of the outer mannoprotein layer as compared with the WT cells. Thus, we provide genetic, morphological, and biochemical evidence for the critical involvement of N-glycosylation in some step in assembly of the cell wall β1,6-glucan in Saccharomyces cerevisiae.

The oligosaccharyl transferase (OT) enzyme complex functions to catalyze asparagine-linked glycosylation (N-glycosylation) in the lumen of the endoplasmic reticulum (ER) in eukaryotic cells (for reviews on the OT complex, see refs. 13). Stt3p is an essential subunit of the OT complex (49), and the gene encoding Stt3p was first identified in a staurosporine and temperature sensitivity screen (10). Stt3p from Saccharomyces cerevisiae is a multitransmembrane protein of 718 amino acids that is predicted to have a signal sequence, a hydrophobic N-terminal domain that spans the membrane 11 times and a lumenally oriented hydrophilic C-terminal domain (4, 5) (psort.nibb.ac.jp). Recent evidence indicates that the C-terminal domain of Stt3p possesses the peptide binding and/or the catalytic site of the N-glycosylation reaction (6, 7). A central role of Stt3p in the N-glycosylation reaction has been recently shown in two other studies (8, 9).

It is known that mutations in Stt3p lead to temperature sensitivity and a glycosylation defect that can be explained by its role in the OT reaction (47, 11). However, stt3 mutants exhibit sensitivity to HM-1 toxin and certain drugs like Calcofluor white, caffeine, and hygromycin B (12), which are indicative of a cell wall defect. Several aspects of STT3, such as its genetic link with PKC1, and the sensitivity of the stt3 mutants to staurosporine, which is a specific inhibitor of Pkc1p, are intriguing (4). In the present study, we carried out a genetic screen by using the stt3-1 mutant allele, which is known to result in staurosporine and temperature sensitivity, and a severe glycosylation defect (4). As a result of the screen, we found that a mutation in either KRE5 or KRE9 genes was synthetically lethal with stt3-1 mutation. The KRE genes are known to be involved in the biosynthesis of the β1,6-glucan component of the yeast cell wall (13, 14). Results from the genetic screen in combination with the biochemical and morphological analysis of stt3 mutants led us to conclude that Stt3p through its general role in OT activity is involved in the biosynthesis of cell wall β1,6-glucan. This finding provides explanation for the previously observed cell wall-related phenotypes of stt3 mutants (12).

Materials and Methods

Yeast Strains, Media, and Materials. Standard yeast media and genetic techniques were used (1517). Sterile filtered 5-fluoroorotic acid (FOA) obtained from US Biologicals (Swampscott, MA) was added to autoclaved synthetic media and agar to a final concentration of 1 mg/ml. Endo H, T4 DNA ligase, and shrimp alkaline phosphatase were obtained from Roche (Mannheim, Germany). Restriction enzymes, primers, and ELongase were obtained from Invitrogen. Ethyl methanesulfonate was obtained from Sigma. Horseradish peroxidase-labeled anti-rabbit IgG raised in goat was obtained from Chemicon. Zymolyase 100T was purchased from ICN. Plasmids used in this study are listed in Table 1.

View this table:
Table 1. Plasmids used in this study

E. coli Techniques. E. coli strain DH5α was used for all recombinant DNA procedures except for electroporation, in which E. coli JBE181 [ΔlacX74 hsr rpsL pyrF::TN5(kan) leuB600 trpC 9830 gal E galK] cells were used. Luria–Bertani medium was used for bacterial growth. Standard recombinant DNA procedures were carried out as described by Sambrook et al. (18).

Strain Construction. MC-10 and MC-11 strains. SYT3-1RA (MATa ura3 his3 leu2 ade8 trp1 met3 stt3-1) was crossed with NH36-19-1ade2 (MATα ura3 leu2 ade2), sporulated, and dissected. Temperature-sensitive spores (at 37°C) were identified. To distinguish the spores carrying the ade2 mutation, they were patched on yeast extract/peptone/dextrose (YPD) (low adenine) plates. One of the red temperature-sensitive spores, MC-9 (MATa ura3 leu2 ade2 trp1 stt3-1), was crossed with TSY143 (MATα ura3 leu2 ade2 ade3 trp1 Δpng1: KAN), sporulated, and dissected. White colonies that were temperature- and G418-sensitive were selected. Two spores, MC-10 (MATa ura3 leu2 ade2 ade3 trp1 stt3-1) and MC-11 (MATα ura3 leu2 ade2 ade3 trp1 stt3-1), were used for screening purpose. YS3-6D (MATa ura3 his3 leu2 ade8 trp1 met3) was also subjected to mating and dissection in an identical fashion as SYT3-1RA, to generate MC-17 (MATα ura3 leu2 ade2 ade3 trp1), which was used as WT strain for MC-10 and MC-11.

MC-14 and MC-15 strains. MC-11 strain was transformed with the NsiI-linearized pRS305-KRE5 or the NcoI-linearized pRS305-KRE9, and transformants were selected on plates containing minimal media lacking leucine. The resultant strains were named MC-14 (MATα ura3 leu2 ade2 ade3 trp1 stt3-1 KRE5:LEU2) and MC-15 (MATα ura3 leu2 ade2 ade3 trp1 stt3-1 KRE9:LEU2), respectively.

Isolation of Mutants Synthetically Lethal with the stt3-1 Mutation. MC-10 strain, transformed with plasmid pRS316-STT3-ADE3 was grown to an OD600 nm of 0.6 at 25°C in SC-ura media. Approximately 2 × 107 cells, suspended in 1 ml of 0.1 M potassium phosphate buffer (pH 8.0), were incubated with ethyl methanesulphonate (30 μl/ml) at room temperature for 60 min, with intermittent shaking. Approximately 4 × 102 cells were plated on each yeast extract/peptone/dextrose (YPD) (low adenine) plate. The plates were incubated in the dark for about 5–6 days at 25°C. Nonsectoring red colonies were patched on YPD (low adenine) plates to confirm their nonsectoring character. After replica plating, they were patched on FOA plates. Those that failed to survive on FOA plates were used for further screening. Synthetic lethal candidates strains were identified by carrying out the following three tests: (i) The candidates were transformed with pRS315-STT3. Transformants were selected and further tested for FOA sensitivity. Those that survived on FOA plates were selected and used for further studies because this result showed the STT3-dependence for viability. (ii) First, candidates were crossed with MC-11, which contained the pRS315 plasmid. The diploids were selected on SC-ura-leu plates and further tested for FOA selection. Those that survived on FOA plates indicated the recessive nature of the synthetic lethal gene. Second, the diploids were sporulated, and tetrad dissection was carried out. Tetrads in which all four spores survived were analyzed. Spores from tetrads that segregated 2:2 in cell viability on SC + FOA plates indicated that synthetic lethality was a result of a single gene mutation. (iii) Finally, to exclude the possibility that UV irradiation caused lethal mutations in the chromosomal stt3-1 allele, the candidate synthetic lethal mutants were mated with QYY700-2 [MATα ura3 leu2 ade2 trp1 can1 his3 Δstt3::his5 + (Schizosaccharomyces pombe) (YEp352-STT3)] followed by patching of the diploids on SC + FOA plates. Those that survived on the FOA plates were used for further study.

Isolation of the KRE5 and KRE9 Loci. A genomic library containing partially digested chromosomal DNA ligated into vector YEp213 (digested with HindIII) was transformed into the candidates obtained as a result of the screen described above. Transformants were selected on plates containing SC-leu plates at 25°C. Transformants were replica-plated on SC-leu + FOA. Four positive clones were obtained in case of the candidate strain MC-12 [MATa ura3 leu2 ade2 ade3 trp1 stt3-1 kre5 (pRS316-STT3-ADE3)], and three were obtained in case of the candidate strain MC-13 [MATa ura3 leu2 ade2 ade3 trp1 stt3-1 kre9 (pRS316-STT3-ADE3)]. The plasmid DNA was extracted from the positive clones by using the yeast plasmid isolation kit from Bio 101 (La Jolla, CA) and electroporated into JBE181 cells. Plasmid DNA was isolated from E. coli [(pMC-12-1, -2, -3, and -4) from the original candidate MC-12 and (pMC-13-41, -42, and -43) from the original candidate MC-13], and the plasmids were transformed back in to the original candidate to confirm that these rescued the synthetic lethal nature. The insert in the plasmids was identified by sequencing (using primers 5′CATAACCAAGCCTATGCCTACAGC3′ and 5′GTCAACTCCGTTAGGCCCTTCATTG3′ from within the vector), followed by blast search by using the Saccharomyces Genome Database (genome-www.stanford.edu/Saccharomyces). Analysis of the plasmids pMC-12-1 and pMC-13-41 was carried out as described in the legend to Fig. 1. Deletion analysis of the plasmids containing the STT3 locus (pMC-12-3, pMC-12-4, pMC-13-42 and pMC-13-43) was carried out to confirm that none of the genes neighboring STT3 were involved in rescuing the synthetic lethal phenotype of the respective original candidates (data not shown).

Fig. 1.

(A) Schematic representation of deletion analysis of pMC-12-1. The inserts in pMC-12-1 and pMC-12-2 were identified as overlapping regions on chromosome XV. Plasmid pMC-12-1 was digested with SstI and religated to generate pMC-12-5. pMC-12-1 was digested with HindIII, and the 10-kb band was inserted into pRS315 digested with HindIII to generate pMC-12-6. pRS315-KRE5 was generated as described in Table 1. The vector for pMC-12-1 and pMC-12-5 was YEp213 and that for pMC-12-6 was pRS315. (B) Schematic representation of deletion analysis of pMC-13-41. The insert in pMC-13-41 was identified as a region on chromosome X. The HindIII insert from pMC-13-41 was ligated into pRS315 digested with the same enzyme to generate pMC-13-7. The BamHI, SpeI, and XhoI sites indicated in plasmid pMC-13-7 are a part of the multicloning sites in pRS315. The BamHI-BglII fragment from pMC-13-7 was ligated into pRS315, digested with BamHI to generate pMC-13-8. The BglII-XhoI fragment from pMC-13-7 was ligated into pRS315, digested with BamHI and XhoI to generate pMC-13-9. The SpeI fragment from pMC-13-7 was ligated into pRS315, digested with SpeI to generate pMC-13-10. HIII, HindIII; SI, SstI; BHI, BamHI; BII, BglII; SpI, SpeI; XI, XhoI. Gray blocks indicate the ORFs in this region of the chromosome, and the names associated with these ORFs are shown. The plasmids so generated were transformed into the respective original candidate, and the transformants were subjected to FOA selection. Plasmids able to rescue the FOA sensitivity (and therefore synthetic lethality) are indicated by + and those unable to rescue the FOA sensitivity are indicated by –.


Cell Wall β Glucan Determination. Cell wall glucans were determined as described (19) with slight modification as suggested by Shahinian et al. (20). To ensure that the zymolyase digestion was complete, the amount of pelletable undigested glucan was measured. The amount remaining was ≤10% of the total alkali-insoluble glucan in each sample.

Preparation of Samples for Electron Microscopic Analysis. The cells were grown to an OD600 nm of 0.5, washed with distilled H2O, and fixed with 3% glutaraldehyde in 0.1 M sodium cacodylate buffer, 5 mM CaCl2 (pH 7.4) for 1 h at 25°C with gentle agitation. The cells were washed four times in the same buffer followed by incubation in 1% osmium tetraoxide/1% potassium ferrocyanide in 0.1 M sodium cacodylate buffer, 5 mM CaCl2 (pH 7.4) for 30 min at room temperature with gentle agitation. The cells were washed four times in distilled water followed by incubation with 1% thiocarbohydrazide in water for 5 min. The cells were washed four times in distilled water and stained with Kellenberger's uranyl acetate for 2 h. Following staining, the cells were dehydrated through a graded series of acetone and embedded in Epon resin.

Results

A Screen for Mutations That Are Synthetically Lethal with the stt3-1 Mutation. In a genetic approach to further understanding the role of Stt3p, we screened for mutations synthetically lethal in combination with the stt3-1 mutation by using the red-white sectoring assay (21). We constructed an ade2 ade3 mutant strain that also carried the stt3-1 mutation (MC-10). In addition, we constructed a centromeric reporter URA3 plasmid containing STT3 and ADE3 genes (pRS316-STT3-ADE3), which was transformed into MC-10 cells. Because MC-10 can grow on rich media without the help of additional STT3 or ADE3 gene, the plasmid is lost at a frequency of ≈10–2 per cell division (22). For this reason, MC-10 gives rise to red and white sectored colonies, representing a mixed population of cells with and without the plasmids. However, if MC-10 cells acquire the mutation(s) that render synthetic lethality with the stt3-1 mutation, the cells require the STT3 allele on the reporter plasmid to survive and hence will not produce color-sectoring colonies.

MC-10 cells, transformed with pRS316-STT3-ADE3 were mutagenized with ethyl methanesulphonate to ≈50% lethality. Approximately 2 × 104 colonies were screened, and normally growing nonsectoring colonies were isolated. Of these, we selected eight candidate strains that met the following criteria: (i) the nonsectoring phenotype was STT3-dependent; (ii) it carried a single recessive mutation; and (iii) the chromosomal stt3-1 allele did not acquire additional lethal mutations. Complementation analysis based on FOA sensitivity at 25°C allowed us to classify the eight mutants into six complementation groups, all of which were dependent on the WT STT3 locus. Of the six complementation groups, four were represented by one strain each, and the remaining two groups by two strains each. Of these, two strains (MC-12 and MC-13), which belong to two separate complementation singly represented groups, were subjected to screening by using a genomic library constructed in YEp213 (2 μ, LEU2) vector to identify the gene responsible for the synthetic lethality. Analysis of the candidates from the other complementation groups is necessary. Plasmids isolated from library-transformed clones obtained on the SC-leu + FOA plates were analyzed as described in Materials and Methods and the legends to Figs. 1 and 2 A and B. The results clearly show that plasmids bearing KRE5 and KRE9 loci rescue the synthetic lethality of the MC-12 and MC-13 strains, respectively.

Fig. 2.

(A) Either STT3 or KRE5 rescues the synthetic lethality of MC-12. The MC-12 strain following transformation of pRS315, pRS315-STT3, YEp213-KRE5 (pMC-12-1), pHP84-KRE5, or pRS315-KRE5 was streaked on plates containing SC-leu + FOA plate. The MC-17, MC-12, and MC-10 strains were streaked as controls. (B) Either STT3 or KRE9 rescues the synthetic lethality of MC-13. The MC-13 strain was transformed with pRS315, pRS315-STT3, pRS315-BglII-XhoI fragment, YEp213-KRE9 (pMC-13-41), or pRS315-HindIII fragment (pMC-13-7). The transformants were streaked on plates containing SC + FOA plate. MC-17, MC-13, and MC-10 strains were streaked as controls. All plates were incubated at 25°C, and growth was compared after 4 days.


To determine whether the isolated KRE5 or KRE9 loci encode a high copy suppressor of the synthetic lethal or stt3-1 mutations rather than the two mutant genes per se, we marked the WT KRE5 or KRE9 loci in a stt3-1 strain (MC-11) by site-directed integration of the LEU2 gene without inactivating the KRE5 or KRE9 function. These strains were called MC-14 and MC-15, respectively. Crossing of MC-14 and MC-12, and MC-15 and MC-13 was followed by sporulation and tetrad dissection. Tetrads where all four spores survived were analyzed. The segregants were patched on SC + FOA plates. As expected, the stt3-1kre5 and stt3-1kre9 double mutants (two of the four spores in a tetrad) did not survive after loss of the URA plasmid encoding the WT allele of STT3 whereas the stt3-1KRE5:LEU2 and stt3-1KRE9:LEU2 strains (two of the four spores in a tetrad) survived on FOA plates (data not shown). In addition, both the FOA-resistant spores grew on a SC (–leu) plate (data not shown). This result demonstrated that the cloned DNAs encoded the loci that were affected in the two double mutants, MC-12 and MC-13.

β-Glucan Analysis. Because STT3 exhibits a genetic interaction with both KRE5 and KRE9, both of which have been implicated in cell wall β1,6-glucan biosynthesis (13, 14), we measured the cell wall β1,6-glucan content of stt3 mutants. This study was carried out in the stt3 deletion strain (QYY700-2) bearing either the WT STT3 or mutant allele on a centromeric plasmid. Besides strains bearing the stt3-1 or stt3-2 mutant alleles, we examined four other mutant strains each bearing a lesion in the C-terminal domain of the Stt3p. The C-terminal domain mutants used in this study are known to result in temperature sensitivity and exhibit a glycosylation defect (7). Values for β1,6-glucan content were calculated as micrograms of alkali insoluble glucan per milligram dry weight and are reported as percentages (WT = 100%). Absolute values for WT cells (Δstt3 strain bearing pRS314-STT3-HA) were in the order of 136 μg β1,6-glucan and 244 μg β1,3-glucan/mg dry weight cell wall. As shown in Fig. 3, we observed a 60–70% reduction in β1,6-glucan content and a concomitant increase in the β1,3-glucan content of stt3 mutant strains. The increase in β1,3-glucan content potentially represents a form of compensation for the β1,6-glucan loss, which has been previously observed by others (20).

Fig. 3.

Pronounced loss of β1,6-glucan in stt3 mutants. QYY700-2 was transformed with the TRP plasmid (pRS314) bearing either the respective mutant or WT allele as indicated in the figure, and the transformants were subjected to FOA selection. The FOA-selected cells were grown until stationary phase, and the alkali-insoluble β1,6-glucan and β1,3-glucan contents were determined as described in Materials and Methods. Values are reported as percentages with WT set to 100%. Each value represents the mean value of three or more experiments. The error bars indicate SD of the mean. White and gray bars represent β1,6-glucan and β1,3-glucan, respectively.


Ultrastructural Analysis of Wild-Type and stt3 Mutant Cells. stt3 mutant cells exhibit a pronounced loss of cell wall β1,6-glucan as compared with WT cells. To determine whether this cell wall defect is morphologically detectable in stt3 mutant cells, we examined the cells by transmission electron microscopy after growing them at permissive temperature of 25°C and staining them with osmium tetraoxide. We analyzed stt3 deletion strains bearing WT STT3, stt3-1 or stt3(W516A) mutant alleles (Fig. 4). The WT cells show a smooth cell wall, which in the case of the mutant strains was extremely diffuse. A pronounced loss of the outer mannoprotein layer was clearly visible in stt3 mutant strains when observed in higher magnification. Over 80% of the cell population in each respective sample exhibited the morphology shown in Fig. 4. Similar morphological cell wall defects have been previously observed in kre5Δ cells (23) and in strains bearing temperature-sensitive alleles of kre5 (24).

Fig. 4.

Electron microscopic analysis of WT and stt3 mutant cells. The strains used for transmission electron microscopy (TEM) analysis were prepared as described in the legend to Fig. 3. stt3Δ harboring WT-STT3 (A and B), stt3-1 (C and D), or stt3(W516A) (E and F) in pRS314 grown to log phase at 25°C, were fixed, stained with osmium tetraoxide, and examined by TEM. The sharp layer marking the outer component of the cell wall seen in the WT cells (Fig. 3 A and B) was very diffused in both mutants (Fig. 3 CF).


Discussion

Recent studies have emphasized the importance of N-glycosylation in various cellular processes (2527), and it has become increasingly clear that Stt3p plays a central role in the N-glycosylation process (69). However, the present state of knowledge about the function of Stt3p is insufficient to account for all of the information we have about the protein. For example, the genetic link between STT3 and PKC1 (4) is not understood, and the sensitivity of stt3 mutants to drugs like CalcoFluor white, caffeine, and HM-1 toxin (12) is unclear. To acquire more insight into the function of Stt3p, we initiated a synthetic lethal screen with the stt3-1 mutant. Eight strains carrying a mutation synthetically lethal with the stt3-1 allele, which fell in six complementation groups, were isolated. Here, we describe systematic analysis of two of these strains belonging to two separate complementation groups. Currently efforts are underway to clone the WT gene allelic to the four remaining synthetic lethal mutations.

We observed that the stt3-1 mutation leads to synthetic lethality in combination with a mutation in either the KRE5 or the KRE9 gene. KRE5 and KRE9 are among several (KRE) genes identified in the K1 killer toxin resistance screen (28), and the protein products of the KRE genes are involved in the biosynthesis of β1,6-glucan in the yeast cell wall (29). The products of the KRE genes localize along the secretory pathway, suggesting that β1,6-glucan biosynthesis is initiated in the ER, which proceeds along the secretory pathway and terminates at the cell wall (see ref. 30). Kre5p is an ER-resident N-linked glycoprotein with a C-terminal HDEL sequence (14, 24) whereas Kre9p is an O-glycosylated protein associated with the cell surface (13). It has been shown that the cell wall β1,6-glucan is covalently cross-linked to mannoproteins, β1,3-glucan, and chitin, and therefore it has been proposed that β1,6-glucan is the central cell wall building block, interconnecting the various cell wall components (see ref. 30).

Strains bearing deletion of kre genes exhibit a pronounced loss of β1,6-glucan in the cell wall (29). Δkre5 and Δkre9 cells have undetectable and 80% reduced levels of cell wall β1,6-glucan, respectively (13, 14), suggesting an important role for both these protein products in cell wall β1,6-glucan assembly. We observed a dramatic decrease (60–70%) in the levels of β1,6-glucan in several stt3 mutants, which leads us to propose that Stt3p plays an important role in the biosynthesis of cell wall β1,6-glucan. Because β1,6-glucan interconnects all of the other components of the yeast cell wall, the cell wall of strains bearing a loss of β1,6-glucan should appear morphologically distinct from the WT cells. This result was indeed observed by transmission electron microscopic examination of the stt3 mutants. The stt3 mutant cells exhibited an extremely diffuse cell wall and loss of the mannoprotein layer as compared with the WT cells. A previous study showed that kre5Δ cells exhibit morphology similar to that of the stt3 mutants (23).

Based on the role of Stt3p in N-glycosylation (69), we postulate two models to explain the involvement of Stt3p in cell wall β1,6-glucan biosynthesis. In the first model, mutation in Stt3p may lead to underglycosylation of glycoproteins and thereby loss of one (or more) enzymatic activity(ies) that is (are) critical for biosynthesis of cell-wall β1,6-glucan. An additional mutation in the Kre proteins could further impair the β1,6-glucan biosynthetic pathway, leading to cell death. Indeed, we observed a severe underglycosylation of Kre5p in stt3 mutant (data not shown) although it is unknown whether N-glycosylation is essential for the activity of Kre5p. Although the biochemical activity of Kre5p is still unclear, this protein shares limited, yet significant, sequence homology with UDP-glucose:glycoprotein glucosyl transferase (UGGT), which is a key “folding sensor” enzyme involved in the quality control system for newly synthesized glycoproteins in the ER (31). However, no detectable UGGT activity has thus far been detected in S. cerevisiae (32, 33), and genetic analysis also supports the idea that Kre5p does not possess UGGT activity (20). Nevertheless, given the limited sequence similarity with glucosyltransferase, Kre5p may serve as a novel transferase that could modify a glycoprotein in the ER that becomes a primer for synthesis of the β1,6-glucan polymer (20). Consistent with this hypothesis, S. cerevisiae has the ability to transport UDP-glucose, presumably the donor substrate for Kre5p, into the ER (34). However, it is unclear as to what molecule acts as the primer for glucan deposition.

Other workers have suggested that the N-glycan chains per se of certain secretory proteins and/or the cell wall mannoproteins may serve as the initial acceptor of glucan residues to generate β1,6-glucan chains (20). Thus, in our second model, mutation in Stt3p would lead to inadequate glucan primer availability, which, when combined with the mutation in Kre proteins, leads to cell inviability. Thus, in the former model, a mutation in Stt3p leads to under-glycosylated and therefore inactive enzyme(s) that is (are) critical for β1,6-glucan biosynthesis. In the latter model, we propose that a mutation in Stt3p leads to insufficient glycan primer synthesis to serve as a building block for β1,6-glucan biosynthesis. At present, we cannot rule out either one of these possibilities.

Other than Kre5p, several other ER resident proteins, namely glucosidase I and II, and BiP are reported to be involved in β1,6-glucan synthesis in S. cerevisiae (20, 23, 35). Although the precise mechanism, by which these ER-resident proteins function in the β1,6-glucan synthesis, remains unclear, it is interesting that ER-resident proteins that are involved in N-linked glycoprotein biosynthesis (Stt3p), folding (BiP), and quality control (glucosidase I and glucosidase II) are known to be intricately involved in biosynthesis of the cell wall β1,6-glucan. These observations clearly emphasize the importance of glycosylation in β1,6-glucan biosynthesis. The present study establishing the role of Stt3p in cell wall β1,6-glucan biosynthesis explains why STT3 was also identified in an HM1 toxin resistance screen (12). HM1 toxin is known to bind to glucan/mannan in the cell wall of S. cerevisiae (36), and mutation in Stt3p was found to lead to toxin resistance. Because mutations in Stt3p lead to a fragile cell wall, this result also explains why stt3 mutants are sensitive to drugs like Calcofluor white and caffeine (12).

Among all of the components of the yeast cell wall (β1,3-glucan, β1,6-glucan, chitin, and mannoproteins), only the link between N-glycosylation and mannoprotein biosynthesis is clear. Although an intricate connection between yeast cell wall and glycosylation has been previously suggested, direct evidence in support of this suggestion was lacking. In this study, we have illustrated an important role of N-glycosylation in cell wall β1,6-glucan biosynthesis by using genetic and biochemical means. In another recent study (37), we demonstrate that staurosporine sensitivity is a consequence of mutation in the N-terminal domain of Stt3p. This finding led us to propose the existence of a Pkc1p cascade specifically affecting Stt3p, which in turn regulates OT activity. In fact, Pkc1p is known to regulate cell wall biosynthesis in yeast (38), and previously synthetic interactions have been demonstrated between genes encoding members of Pkc1p cascade and the KRE genes (39). Whether Pkc1p regulates cell wall β1,6-glucan biosynthesis through its modulatory action on Stt3p and thereby on N-glycosylation remains to be investigated.

Acknowledgments

We thank Satoshi Yoshida (Kirin Brewery, Gunma, Japan) for SYT3-1RA, SYT32-4D, and YS3-6D strains and pSTS104 plasmid. We thank our following associates at Stony Brook University: Qi Yan for providing us pRS314-STT3-HA and stt3 mutant plasmids, Hangil Park for pHP84 plasmid, Bruce Futcher for YEp213-based genomic library, Nancy Hollingsworth for NH36-19-1ade2 strain, and Aaron Neiman for the pDK255 plasmid. We thank Aaron Neiman and Alison Coluccio for helping us with the preparation of the transmission electron microscopy samples. We thank Rolf Sternglanz, Ann Sutton, Hangil Park, and members of Lennarz laboratory for valuable discussion. This work was supported by National Institutes of Health Grant GM33185 (to W.L.).

Footnotes

  • To whom correspondence should be addressed at: Department of Biochemistry and Cell Biology, 450A Life Science Building, Stony Brook University, Stony Brook, NY 11794. E-mail: wlennarz{at}notes.cc.sunysb.edu.

  • * Present address: Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-0033, Japan.

  • Abbreviations: OT, oligosaccharyl transferase; ER, endoplasmic reticulum; FOA, 5-fluoroorotic acid; N-glycosylation, asparagine-linked glycosylation.

References

« Previous | Next Article »Table of Contents