Annexin 2–caveolin 1 complex is a target of ezetimibe and regulates intestinal cholesterol transport

  1. Eric J. Smart*,
  2. Robert A. De Rose, and
  3. Steven A. Farber,
  1. *Department of Physiology, University of Kentucky, Lexington, KY 40536; and Department of Microbiology and Immunology, Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA 19107
  1. Communicated by Donald D. Brown, Carnegie Institution of Washington, Baltimore, MD, January 20, 2004 (received for review December 23, 2003)

Abstract

Modulation of cholesterol absorption in the intestine, the primary site of dietary cholesterol uptake in humans, can have profound clinical implications. We have undertaken a reverse genetic approach by disrupting putative cholesterol processing genes in zebrafish larvae by using morpholino (MO) antisense oligonucleotides. By using targeted MO injections and immunoprecipitation (IP) experiments coupled with mass spectrometry, we determined that annexin (ANX)2 complexes with caveolin (CAV)1 in the zebrafish and mouse intestine. The complex is heat stable and unaffected by SDS or reducing conditions. MO targeting of anx2b or cav1, which are both strongly expressed in the larval and adult zebrafish intestinal epithelium, prevents formation of the protein heterocomplex. Furthermore, anx2b MO injection prevents processing of a fluorescent cholesterol reporter and results in reduced sterol mass. Pharmacological treatment of mice with ezetimibe disrupts the heterocomplex in only hypercholesterolemic animals. These data suggest that ANX2 and CAV1 are components of an intestinal sterol transport complex.

The transport of sterol is tightly regulated at the cellular and organismal level by multiple mechanisms. Although it is well established that the intestine is the primary site of dietary cholesterol absorption, the mechanisms involved in the vectorial transport of cholesterol across the intestinal epithelium are poorly understood (1). A better understanding of the mechanisms of sterol transport is likely to impact treatment strategies for addressing diet-induced obesity, diabetes, and cardiovascular disease.

A forward genetic screen with fluorescent lipid biosensors in zebrafish can identify target genes that modulate cholesterol processing (2). Similarly, a reverse genetic strategy with antisense morpholino (MO) oligonucleotides (3, 4) can be used to test the role of potential lipid modulators by reducing their expression. Caveolin (CAV)1 is a 22-kDa protein that forms the cytoplasmic coat associated with caveolae (57). CAV1 colocalizes with clathrin to the cleavage furrow of developing zebrafish embryos, suggesting that at the furrow, caveolae-mediated endocytosis occurs during cytokinesis (8). However, CAV1 is not restricted to caveolae, and the protein has been shown to be involved in the intracellular trafficking of sterol (912). CAV1 is also known to form at least two distinct chaperone complexes. One complex consists of CAV1, heat-shock protein 56, cyclophilin A, and cyclophilin 40, and this complex traffics newly synthesized cholesterol from the endoplasmic reticulum to caveolae (9). The other complex consists of CAV1, annexin (ANX)2, cyclophilin A, and cyclophilin 40, and this complex traffics exogenous cholesterol from caveolae to the endoplasmic reticulum (11). In mammalian cell culture systems the two CAV1 chaperone complexes appear to play roles in regulating both total cellular and caveolar cholesterol levels.

ANXs are a family of calcium- and phospholipid-binding proteins that have been implicated in many cellular processes, including channel formation, membrane fusion, vesicle transport, and regulation of phospholipase A2 activity (13, 14). Over the last 20 years ANXs have been identified in both plants and animals, yet their in vivo function remains elusive. We had previously identified two anx2 orthologues as part of a major effort to clone the entire zebrafish anx gene family (15). Here, we present evidence by using both zebrafish and mouse model systems that an ANX2–CAV1 heterocomplex in the intestine serves as an important mediator of cholesterol uptake and is a target of the drug ezetimibe.

Materials and Methods

Subcloning and Mapping. A single complete cav1 gene was found in the I.M.A.G.E. (Integrated Molecular Analysis of Genomes and their Expression) Consortium (clone no. 3719638), except for the first two codons, which were reconstructed from Danio genomic DNA (GenBank release no. AC087254.2). Zebrafish anx2 and cav1 were mapped by using the LN54 Radiation Hybrid Panel as described in ref. 16. Syntenic relationships between zebrafish and human genomes were determined by examining mapped zebrafish genes flanking a particular zebrafish gene. Methods for breeding and raising zebrafish were followed as described in ref. 17.

Embryo Production and in Situ Hybridization. All zebrafish work was approved by the Institutional Animal Care and Use Committee of Thomas Jefferson University. Embryos were obtained from natural matings of wild-type (AB) fish and staged according to criteria outlined in ref. 18 and by hours postfertilization (hpf). Digoxigenin-labeled RNA probes synthesized for each gene were hybridized to embryos or larvae at various developmental stages. In situ hybridization for anx2b and cav1 expression was carried out as described in ref. 19.

Production of Embryo Lysates. Embryos were lysed in 1 ml of buffer (150 mM NaCl/1.0% Nonidet P-40/0.5% deoxycholate/0.1% SDS/50 mM Tris, pH 8.0) and protein amounts determined by the Lowry method. Equal amounts of lysate (50 μg) were mixed together in the lysis buffer for 1 h at 37°C. After incubation, protein A-Sepharose beads (blocked with lysis buffer and 30 mg/ml BSA) were used to preclear the samples. Samples were then incubated for 18 h (4°C) with the appropriate antibody (2 μg per sample) before adding protein A-Sepharose beads. After 2 h, beads were collected by centrifugation and washed five times in high-salt RIPA buffer (500 mM NaCl/0.05 mM Tris·HCl, pH 7.2/1% Triton X-100/1% sodium deoxycholate/0.1% SDS). Samples were then analyzed by SDS/PAGE and immunoblot.

Morpholino and mRNA Injections. Morpholino oligonucleotides were commercially obtained (GeneTools, Philomath, OR). Sequences were as follows: cav1, TGTCCCGTCCTTGTATCCGCTA GTC; anx2b, GCCATTTTCCTTAGTTGTTGTAGAG; anx2b (4-base mismatch), GCCAATTTCGTTAGTAGTTGAAGAG; and anx2a, CTAAGAACTCAGAGACCAAAGC CAT. MO (1–3 μg/μl) were dissolved in Danieau buffer [58 mM NaCl/0.7 mM KCl/0.4 mM MgSO4/0.6 mM Ca(NO3)2/5.0 mM Hepes, pH 7.6] and pressure injected into early stage larvae (1–8 cell stage) as described in ref. 4. To allow transcription of capped mRNA, the anx2a and anx2b ORFs were subcloned into the vector pT3TS. The expression vector was linearized, and capped mRNA was transcribed by using the mMessage mMachine T3 transcription kit (Ambion, Austin, TX).

7-Nitrobenz-2-oxa-1,3-diazol-4-yl(NBD)-Cholesterol. Zebrafish larvae were labeled (2 h) with NBD-cholesterol as described (2) in embryo medium (17), anesthetized with 170 μg/ml tricaine, and placed in depression slides. Fluorescent images were captured with a Zeiss Axiocam 2 mounted on a MZ FLIII (Leica, Deerfield, IL). For statistical analysis, intestinal fluorescence was scored on a 3-point scale (weak, moderate, and bright) and analyzed (ANOVA).

Lipid Content Determination. See Supporting Methods, which is published as supporting information on the PNAS web site.

Mouse Strains and Care. C57BL/6 and low-density lipoprotein (LDL)-receptor-null mice were purchased from The Jackson Laboratory. At 6 weeks of age, the animals were put on either a normal chow (0% cholesterol, 5.7% fat; Harlan Tekland no. 2018) or a high fat (Western) diet (0.2% cholesterol, 21% fat; Harlan Tekland no. 88137) and maintained on diet for 6 weeks. At the end of 6 weeks, the animals were killed for the experiments. All work with mice was approved by the University of Kentucky Institutional Animal Care and Use Committee.

Cholesterol and Ezetimibe Determination. For cholesterol determination, cytosol isolated from enterocytes was subjected to IP as described above. Cholesterol heptadecanoate was added to samples as an internal standard, and samples were extracted with Folch reagent. The lower phase was passed through a Pasteur pipette containing anhydrous Na2SO4 and the eluent evaporated to dryness under a stream of nitrogen. The dried lipids were reacted at room temperature for 30 min with [N,O-bis(trimethylsilyl)]trifluoroacetamide containing 1% trimethylchlorosilane (Sylon BFT; Supelco) plus one part dry pyridine. The material was dried, dissolved in hexane, and used for gas chromatography analysis. Samples were injected onto a 6890 GC G2579A system (Agilent Technologies, Palo Alto, CA) equipped with an OV-22 capillary column (25 mm × 0.25 mm i.d.; Quadrex, New Haven, CT). The column temperature was programmed as follows: 40°C held for 0.5 min, then raised 50°C/min to 150°C, then raised 10°C/min to 310°C, and finally raised 2°C/min to 360°C. The carrier gas was hydrogen at a 15-psi (1 psi = 6.89 kPa) head pressure. The hydrogen flame ionization detector was maintained at 360°C. A Model 5973 mass-selective detector (Agilent Technologies) was used to identify free cholesterol (identified as silyl ether) and cholesterol esters in the samples.

For ezetimibe detection, CACO-2 cells were prepared as described in the text, and SCH 48461 (an analogue of ezetimibe provided by Merck) was added to each precipitate as an internal standard. Samples were then extracted with Folch reagent and treated like the cholesterol samples for gas chromatography-mass spectrometry; at the end, ezetimibe was detected as silyl ether.

Results

As a first step to study the in vivo function of CAV, we identified and cloned the zebrafish orthologue of mammalian cav1 by using EST sequences generated by the Zebrafish Genome Resources Project (http://zfish.wustl.edu). Zebrafish ANX2b and CAV1 (Fig. 5, which is published as supporting information on the PNAS web site) were highly conserved (72% and 82% similarity to human proteins, respectively). To confirm that these genes were orthologous to their human counterparts, the chromosomal position of zebrafish anx2b (15) and cav1 was determined. On the basis of the surrounding mapped genes, we found that these particular chromosomal regions were syntenic with the corresponding human chromosomal segments (Fig. 5), indicating that we identified the correct orthologues and not related family members.

Expression of cav1 and anx2b transcripts in zebrafish embryos were determined by whole-mount in situ hybridization (Fig. 1A). anx2b was expressed in the developing intestinal epithelium at both 48 hpf and 96 hpf, as was cav1. However, cav1 was also detected in the intersomite spaces at 48 hpf and in the heart ventricle at 96 hpf. The expression of the two genes shows significant colocalization, consistent with our hypothesis of an interaction between ANX2b and CAV1 proteins.

Fig. 1.

CAV1 and ANX2b can form a stable heterocomplex. (A) Expression of cav1 and anx2b in zebrafish larvae. Embryos were fixed in 4% paraformaldehyde and probed with digoxigenin-labeled antisense RNA as described in ref. 19. (Upper) Lateral views of embryos probed for anx2b at 48 hpf (Left) and 96 hpf (Right). Note strong expression in the intestinal epithelium. (Scale bar, 500 μm.) (Lower) Lateral views of embryos probed for cav1 at 48 hpf (Left) and 96 hpf (Right). Expression is concentrated in the intestinal epithelium, but cav1 can also be seen in the somite boundaries at 48 hpf (Left, arrowhead) and in the heart ventricle at 96 hpf (Right, arrowhead). (Scale bar, 500 μm.) (B) Identification of a CAV1–ANX2b heterocomplex. Equal amounts of protein (20 μg) isolated from adult fish or adult fish intestine were resolved by SDS/PAGE and immunoblotted with ANX2 IgG or CAV1 IgG. The data are representative of five independent experiments. (C) Equal amounts of protein (20 μg) isolated from the aorta or intestine of C57BL/6 mice were resolved by SDS/PAGE and immunoblotted with ANX2 IgG or CAV1 IgG. The data are representative of three independent experiments. (D) The ≈55-kDa band was subjected to IP from adult intestine by using CAV1 IgG as described in ref. 11 and resolved by SDS/PAGE. The 55-kDa band was recovered from the gel and digested with trypsin; the resulting fragments were resolved by SDS/PAGE and transferred to nylon membrane. Five of the fragments were sequenced by mass spectrometry. The sequence of each fragment is shown along with the region to which they correspond in CAV1 or ANX2b. The letter “X” signifies an unidentified amino acid residue.


To obtain biochemical evidence of an interaction between ANX2b and CAV1 proteins in vivo, we performed a series of immunoblots on adult whole fish and intestines (Fig. 1B) and on 48-hpf whole embryos (Fig. 2B, lane 1). Sixty percent to 80% of ANX2b (38 kDa) and CAV1 (21 kDa) proteins are present as uncomplexed monomers in adult whole fish, with the remainder visible in a higher molecular mass complex of ≈55 kDa. In adult fish intestine, essentially all of the ANX2b and CAV1 are present in the 55-kDa complex, which is consistent with the in situ hybridization data at 48 hpf (a stage where cav1 expression almost entirely overlaps with anx2b). The size of this complex agrees with the predicted molecular mass of a 1:1 heterocomplex of ANX2b and CAV1 (20.6 kDa + 38.4 kDa = 59 kDa predicted mass).

Fig. 2.

Disruption and reformation of the CAV1–ANX2b heterocomplex. (A) Effect of cav1 and anx MO on the formation of the CAV1–ANX2b heterocomplex. Embryos (1–8 cell stage) were injected with the following MO: uninjected (lane 1), cav1 (lane 2), anx2b synthesis 1 (lane 3), anx2b synthesis 2 (lane 4), anx2b mismatched (lane 5), and anx2a (lane 6). 3T3 cell lysate (20 μg) was loaded directly onto the gel as a positive control for ANX2 and CAV1 (lane 7). The embryos were then allowed to develop for 48 h. Larvae were processed to generate lysates (≈20 embryos per sample), and 50 μg of protein was used for IP with CAV1 IgG or ANX2 IgG as indicated. The precipitates were resolved by SDS/PAGE and immunoblotted with ANX2 IgG or CAV IgG as indicated. The data are representative of three to four independent experiments. (B) Reformation of the ANX2b–CAV1 complex in vitro. Embryos (1–8 cell stage) were injected with either cav1 or anx2b MO or uninjected (control) and allowed to develop for 48 h. Lysates were prepared from each class of embryo, and IP were performed as in A. For the last lane, lysates from cav1 MO-injected and anx2b MO-injected embryos were mixed together and incubated at room temperature before IP. SDS/PAGE and immunoblotting are as in A.(C) Rescue of complex formation by anx2b mRNA. Embryos (1–8 cell stage) were injected with anx2b MO (“no RNA” lane) or anx2b MO plus the indicated capped mRNA (control = uninjected). The embryos were allowed to develop for 48 h. Larvae were processed to generate lysates (≈20 embryos per sample), and 50 μg of protein was used for IP with CAV1 IgG (Upper) or ANX2 IgG (Lower). The precipitates were resolved by SDS/PAGE and immunoblotted with the same IgG used for the precipitation. (D) The CAV1–ANX2b complex in embryos is not forming in vitro. Embryos (48 hpf) were collected in a 500-ml Eppendorf tube (20 embryos total per tube), the medium was removed, and the embryos were immediately frozen on dry ice. Specimens were then thawed, lysed, subjected to SDS/PAGE and immunoblotted. For the mix sample, 10 embryos each of anx2b MO-injected and cav1 MO-injected were placed in the tube and frozen as described. No complex formed in the short time that separate ANX2b-free and CAV1-free embryo lysates were mixed together.


To confirm the identity of proteins in the 55-kDa band, peptide fragments from the band were subjected to mass spectrometry analysis (Fig. 1D). Five peptide fragments were identified, all of which corresponded to the predicted amino acid sequences of ANX2b and CAV1 proteins, confirming that these proteins form a tightly associated heterocomplex. Further experiments revealed an anomalous peptide fragment that was resistant to Edman degradation. Additional proteolytic digests of the purified anomalous fragment resolved two short peptides whose sequences matched amino acid residues 7–19 of CAV1 and 18–29 of ANX2b, respectively, suggesting their proximity to the linkage site (data not shown). We also tested whether this finding of a heterocomplex could be generalized to mammals by assaying adult mouse aorta and intestine (Fig. 1C). ANX2 and CAV1 do not form a detectable amount of heterocomplex in mouse aorta, whereas ≈50% of these proteins were detected as a heterocomplex in mouse intestine, indicating that this SDS-resistant heterocomplex is a general feature likely to be present in all vertebrates.

Next, IP and immunoblots were performed on 48-hpf zebrafish embryos (Fig. 2 A; lanes are identical in all four blots). In control embryos, the majority of both ANX2b and CAV1 were present as a heterocomplex, and significant amounts of uncomplexed monomer were also present (Fig. 2 A, lane 1). In embryos injected with MO to block transcription of cav1, CAV1 protein was not detected (Fig. 2 A, lane 2) and ANX2b was seen only as a monomer (Fig. 2 A, lane 2). Conversely, embryos injected with anx2b MO did not contain ANX2b protein (Fig. 2 A, lanes 3 and 4), and CAV1 was only detected as a monomer (Fig. 2 A, lanes 3 and 4). Embryos injected with anx2b MO containing 4 bases mismatched (Fig. 2 A, lane 5) or anx2a MO (Fig. 2 A, lane 6) contained the CAV1–ANX2b heterocomplex exactly like the uninjected embryos. In contrast, although in 3T3 cells a CAV1-ANX2 complex exists as described in ref. 9 (CAV1 IP “pulls down” ANX2; Fig. 2 A, lane 7), the heterocomplex is not stable in SDS as evidenced by the appearance of only the monomer. We conclude that the ANX2–CAV1 heterocomplex observed in adult fish intestine is already present in 48-hpf embryos and that ANX2a is not required for the formation of this complex.

We also examined the ability of the complex to reform both in vivo and in vitro. Protein extracts of 48-hpf cav1 MO-injected embryos showed only ANX2 protein monomer and no complex (Fig. 2B, lane 2); conversely, anx2b MO-injected embryos showed only CAV protein monomer (Fig. 2B, lane 3). When extracts of anx2b MO-injected embryos are incubated with extracts of cav1 MO-injected embryos for 1 h at 37°C before SDS/PAGE, the heterocomplex reforms (Fig. 2B, lane 4). In addition, we determined that coinjecting anx 2b mRNA along with anx2b MO rescues the heterocomplex (Fig. 2C, lane 3). In contrast, coinjection of anx2a mRNA with anx2b MO did not lead to the formation of detectable heterocomplex (Fig. 2C, lane 4). The ability of the ANX2b–CAV1 complex to reform in vitro after incubation led us to wonder whether the complex is merely an artifact caused by the two proteins rapidly associating when embryos are lysed. To test this possibility, live cav1 and anx2b MO-injected embryos were mixed in the same tube, lysed, and immediately subjected to IP (Fig. 2D). No heterocomplex was detected in the mixed lysates. Thus, the observed CAV1–ANX2b complex is not forming in the interval immediately after lysis but rather is normally present in native embryos.

To test the physiologic significance of this complex, embryos were injected with MO against anx2b and cav1, and larval cholesterol transport was observed as described in ref. 2. Embryos (5 d postfertilization) that were previously injected with anx2b MO did not show any obvious developmental abnormalities, yet a subset of the injected larvae failed to accumulate the fluorescent cholesterol analog NBD-cholesterol in the digestive tract (Fig. 3A). Fluorescent microscopy of live uninjected larvae revealed NBD-cholesterol in the intestine (Fig. 3A, arrow) and gallbladder (Fig. 3A, arrowhead), because by this stage these organs are fully developed and functional (20, 21). However, an analysis of gut fluorescence in anx2b MO-injected larvae from three independent experiments indicated a significant reduction in intestinal fluorescence (ANOVA; P < 0.00001). Similar experiments with cav1 MO were not possible, because injected larvae showed early developmental abnormalities, including defects in axis elongation and somite patterning (Fig. 6, which is published as supporting information on the PNAS web site), and failed to survive to a stage when NBD-cholesterol is ingested. To more closely examine the somite defects, embryos (10 somite stage and 24 hpf) were subjected to whole-mount in situ hybridization by using myoD, a known marker for somitic mesoderm, as a riboprobe. The uninjected embryos had well defined chevron-shaped somites and normal elongation of the body axis (Fig. 6 A and B), in contrast to the abnormal somites of cav1 MO-injected larvae (Fig. 6 C and D). Because these defects are seen well before 48 hpf, the earliest stage at which anx2b transcript is detected (15), and given that CAV has been reported to interact with a large number of signal transduction molecules (5), we believe that the somite defects and embryonic lethality of the cav1 knockdown are not due to loss of the CAV1-ANX2b complex but rather attributable to other signaling defects caused by loss of CAV1 protein.

Fig. 3.

Effect of reducing ANX2b protein in zebrafish larvae. Newly fertilized embryos (1–8 cell stage) were injected with anx2b MO and allowed to develop. (A) Larvae (5 d postfertilization) were fed NBD-cholesterol as described (2) then photographed. Uninjected larvae concentrate NBD-cholesterol in the gall bladder (arrowhead) and intestine (arrow). (B) IP and immunoblot to determine the persistence of anx2b MO effect. Embryos were injected with anx2b MO, collected, lysed, subjected to IP, and immunoblotted as described in the legend to Fig. 2. Uninjected control embryos are 48 hpf. For the 120-h sample, embryos were fed NBD-cholesterol and sorted into low- and high-intestinal fluorescence groups before lysis and IP. Data are representative of three to five experiments with 20–30 larvae per group. (Scale bar, 500 μm.) (C) Effect of anx2b MO on lipid composition. Embryos were injected with anx2b MO, allowed to develop for 72 h, then collected. The total lipid was then collected, and the amount of cholesterol, cholesteryl ester, and triglycerides was determined for injected (open bars) and control uninjected (closed bars) embryos. Each bar represents the mean of six measurements, 20 embryos per measurement. Differences between injected and control embryos for both cholesterol and cholesteryl ester are statistically significant (P < 0.05). (D) Rescue of cholesterol by anx2b mRNA. Uninjected, anx2b MO-injected, and anx2b MO/anx2b mRNA coinjected embryos were collected at 48 hpf, and the cholesterol per embryo was determined by mass spectrometry. Each point is the average of three separate batches of 20 embryos each. The MO-injected value shows a statistically significant difference from both the uninjected and MO plus RNA values (Tukey honestly significant difference test; P < 0.01), whereas uninjected and MO plus RNA values do not show statistically significant difference from each other. (E) Immunoblot of embryos from the same experiment as D to demonstrate that rescue of cholesterol concentration by anx2b mRNA is coincident with rescue of CAV1–ANX2b protein complex.


Additional experiments were performed to determine the duration of the effectiveness of anx2b MO in suppressing expression of its target mRNA. In embryos injected with anx2b MO, no ANX2b and thus no complex is detected at 24, 48, and 72 hpf (Fig. 3B, lanes 2–4). ANX2b is again detected at 96 hpf, with most of the protein present as heterocomplex with CAV1 (Fig. 3B, lane 5). However, when the injected embryos at 120 hpf were fed NBD-cholesterol and sorted into high and low intestinal fluorescence, two distinct populations emerged. Embryos showing poor intestinal fluorescence exhibited very low levels of ANX2b heterocomplex (Fig. 3B, lane 6), whereas embryos with normal intestinal fluorescence showed levels of ANX2b heterocomplex similar to uninjected embryos (Fig. 3B, lane 7). This experiment further confirms that the amount of ANX2b-containing complex present in the zebrafish intestine is directly related to the ability to efficiently take up exogenous fluorescently labeled cholesterol.

We also examined the effect of anx2b MO on the levels of cholesterol, cholesteryl ester, and triglycerides in 72-hpf embryos. As shown in Fig. 3C, anx2b MO-injected embryos showed significantly lower levels of cholesterol and cholesteryl ester than uninjected embryos, whereas the level of triglycerides is unaffected by anx2b MO. Similar results were also obtained in a radiolabeling experiment using labeled cholesterol (data not shown). At this stage of zebrafish embryonic development, all lipids are derived from embryonic yolk rather than exogenous food sources. Our results imply that absorption of yolk-derived cholesterol is mediated by the CAV1–ANX2 complex, which is also responsible for the uptake of dietary cholesterol in later developmental stages.

The ability of anx2b mRNA to rescue cholesterol in zebrafish was tested. Uninjected, anx2b MO-injected, and anx2b MO plus anx2b mRNA-coinjected embryos had their cholesterol measured at 48 hpf. As seen previously, anx2b MO causes disappearance of ANX2b protein and, hence, loss of the heterocomplex, whereas coinjection with anx2b mRNA rescues ANX2b protein production and heterocomplex formation (Fig. 3E, compare to Fig. 2C). The anx2b MO caused the amount of cholesterol per embryo to decrease by approximately half, whereas cholesterol was rescued to normal levels by anx2b mRNA (Fig. 3D). Our conclusion that the CAV1–ANX2b complex is required for maintenance of normal cholesterol levels is thus strengthened.

Ezetimibe has been demonstrated to block the uptake of cholesterol in the small intestines of a variety of mammals, including rats, hamsters, and monkeys (2224). A series of experiments was performed to determine whether ezetimibe might be interacting with the CAV1–ANX2 complex. Embryos soaked in 100 μM ezetimibe from 24 hpf to 48 hpf showed a complete disruption of the complex, with CAV1 and ANX2b detected only as monomers (Fig. 4A, lanes 4 and 5). Embryos at 6 d postfertilization, when soaked in ezetimibe for 2 h, fail to take up NBD-cholesterol, much like the anx2b MO-injected embryos shown in Fig. 3A (data not shown). We also looked at the effect of orally administered ezetimibe on mouse enterocytes. Ezetimibe did not affect complex stability in enterocytes from C57BL/6 mice fed a standard diet. In a LDL-receptor mutant strain (25), however, ezetimibe disrupted the CAV1–ANX2 complex. Intriguingly, when C57BL/6 mice were fed a high-fat Western diet, the CAV1–ANX2 complex in their intestinal enterocytes became sensitive to disruption by ezetimibe (Fig. 4B). Stability of the complex was not affected by diet alone, given that the complex was present at similar levels in C57BL/6 mice fed either standard or Western diet (data not shown). Serum cholesterol levels were also measured for these mice (Fig. 4C). Consistent with previous reports, ezetimibe had no significant effect on total serum cholesterol level in wild-type mice fed either a standard or Western diet (26). Although ezetimibe has been proven to inhibit intestinal uptake of cholesterol, it does not affect de novo cholesterol synthesis; so in the absence of statin treatment, total serum cholesterol can remain at an elevated level. Taken together, our data show that ezetimibe interferes with formation of the CAV1–ANX2 complex in mice with elevated cholesterol levels.

Fig. 4.

Effect of ezetimibe on CAV1–ANX2 complex. (A) Effects of ezetimibe on complex formation in zebrafish embryos. (Top) Immunoblot with CAV IgG. (Bottom) Immunoblot with ANX2 IgG. Lanes are identical in both blots. Embryos (48 hpf) were lysed and subjected to IP followed by SDS/PAGE (20 embryos per lane), and immunoblotted. Lane 1, CHO cells (control); lane 2, untreated embryos, IP with CAV IgG; lane 3, untreated embryos, IP with ANX2 IgG; lane 4, embryos soaked in 100 μM ezetimibe from 24 hpf to 48 hpf and subjected to IP with CAV IgG; lane 5, embryos soaked in ezetimibe as in lane 4 (IP with ANX2 IgG). (B) Immunoblots of mouse enterocytes. (Upper) Immunoblot with CAV IgG. (Lower) Immunoblot with ANX2 IgG. Lanes are identical in both blots. Ezetimibe-treated mice were administered the drug orally (1 mg·kg-1·d-1) for 4 weeks immediately before being killed (n = 12 mice per group). Mice that were either untreated or ezetimibe-treated were fasted for 4 h and killed; enterocytes were then isolated from the jejunum by the low-temperature method (31). Enterocytes were lysed, and the cytosol was subjected to IP followed by SDS/PAGE and immunoblotted with the same IgG used for precipitation. Lane 1, C57BL/6 mouse; lane 2, C57BL/6 mouse treated with ezetimibe; lane 3, LDL-receptor (LDLr) mutant mouse; lane 4, LDL-receptor mutant mouse plus ezetimibe; lane 5, C57BL/6 mouse on a Western diet; lane 6, C57BL/6 mouse on a Western diet plus ezetimibe. (C) Serum cholesterol measurements for the mice in B. (D) IP of CAV1 or ANX2 coprecipitates cholesterol. Enterocytes from C57BL/6 mice fasted for 4 h were isolated as in B and treated with 10 μM ezetimibe for 2 h at 37°C. The cytosol was subjected to IP, and the amount of cholesterol was determined by gas chromatography. (E) IP of CAV1 but not ANX2 or cyclophilin A coprecipitates ezetimibe. CACO-2 cells were treated as in D and subjected to IP; the amount of ezetimibe was determined by gas chromatography-mass spectrometry.


IP followed by gas chromatography-mass spectrometry were performed to determine whether cholesterol and/or ezetimibe might be interacting directly with the CAV1–ANX2 complex. IP of either CAV1 or ANX2 from C57BL/6 mouse enterocytes coprecipitates cholesterol (Fig. 4D). Treatment of the enterocytes directly with ezetimibe, however, causes loss of cholesterol coprecipitation (Fig. 4D) and is directly causing CAV1 and ANX2 to appear as monomers and not as the heterocomplex (data not shown). Cholesterol was the only lipid that was found to coprecipitate with the complex; phospholipids, triglycerides, fatty acids, and other sterols did not coprecipitate with CAV1 or ANX2 in untreated cells (data not shown). We also tested whether ezetimibe might be directly interacting with the complex by immunoprecipitating cytosol from ezetimibe-treated CACO-2 cells (Fig. 4E). Ezetimibe was found to coprecipitate with CAV1 but not with ANX2 or with cyclophilin A. Taken together, these data indicate that ezetimibe disrupts the CAV1–ANX2 complex most likely through a direct interaction with CAV1 protein and, thereby, interferes with cholesterol uptake in both zebrafish and mouse systems.

Discussion

Despite extensive study, the true in vivo functions of the ANXs have remained unclear. Although many studies performed in vitro and in cultured cells implicate ANXs in a variety of cellular processes, the physiological significance of these results is far from evident. ANX2 has been implicated in membrane fusion (27), actin-dependent “rocketing” transport of macropinocytic vesicles (28), and intracellular cholesterol traffic (11). The observation that CAV1 and ANX2b form an extremely stable 55-kDa heterocomplex is unprecedented in either the CAV or ANX literature. The resistance of the intestinal CAV1–ANX2b complex to boiling in SDS, reducing conditions, and ether extraction (data not shown) strongly imply that a covalent interaction other than disulfide crosslinking is involved.

Although previous cell culture studies have demonstrated a role for CAV1 and ANX2 in intracellular sterol trafficking (11), this study strongly implicates the complex in the regulation of intestinal sterol metabolism. The apparent embryonic lethality of cav1 disruption in zebrafish is in contrast to the mouse, where cav1 knockouts are viable (29, 30), albeit showing a number of phenotypic abnormalities that include altered serum lipid profile (30). The somite defects we observed in cav1 knockdown zebrafish embryos and the abnormal phenotypes seen in knockout mice, are most likely due to the effect of CAV1 absence on other signaling pathways rather than loss of the CAV1–ANX2 complex.

Binding of ezetimibe has been localized to the brush border of the small intestine, its likely site of action (2224). To date, however, the molecular target has not been identified. This past year, the FDA has approved ezetimibe (Zetia) alone and in conjunction with statins. Our observation that ezetimibe effectively disrupts the CAV1–ANX2 heterocomplex in vivo was entirely unexpected. C57BL/6 mice given ezetimibe orally exhibited this heterocomplex disruption only when hyperlipidemic as caused by a Western diet or by LDL-receptor mutation (Fig. 4B). These data suggests that a high-fat diet makes the intestinal enterocytes more accessible to ezetimibe, a state that is duplicated when isolated enterocytes are directly treated with the drug.

The coprecipitation of ezetimibe with CAV1 strongly suggests that this drug is directly interacting with CAV1 to disrupt the heterocomplex, thereby affecting cholesterol uptake. The interaction of CAV1 and ANX2 previously observed in nonintestinally derived cultured cells differs from the intestinal CAV–ANX heterocomplex in that it is not stable in the presence of detergents and high temperatures. Both the intestinal heterocomplex and the CAV1–ANX2 complex observed in cultured cells also associate with cyclophilin 40 and cyclophilin A (data not shown). In cultured cells, CAV1 associates with either ANX2 (during the uptake of exogenous cholesterol) or heat-shock protein 56 (during efflux of newly synthesized cholesterol) (11). It is tempting to speculate that the CAV1–ANX2 heterocomplex is tightly associated in the intestine so that cholesterol transport favors uptake and not efflux. Importantly, the same tightly associated heterocomplex exists in the intestine of both fish and mice, suggesting that this is a general mechanism of intestinal sterol uptake.

Acknowledgments

We thank S. Ho and K. Urtishak for technical assistance and M. Halpern for critical reading of the manuscript. This work was supported by National Heart, Lung, and Blood Institute Grants HL58475, HL64056, and HL62844 (to E.J.S.), National Institute of Diabetes and Digestive and Kidney Diseases Grant DK60369 (to S.A.F.), National Institute of General Medical Sciences Grant GM63904 (to S.A.F.), and a Pew Scholar Award (to S.A.F.).

Footnotes

  • To whom correspondence should be addressed. E-mail: steven.farber{at}mail.tju.edu.

  • Abbreviations: MO, morpholino; ANX, annexin; CAV, caveolin; IP, immunoprecipitation; hpf, hours postfertilization; LDL, low-density lipoprotein; NBD, 7-nitrobenz-2-oxa-1,3-diazol-4-yl.

References

« Previous | Next Article »Table of Contents