Previous Article |
Table of Contents
| Next Article
PLANT BIOLOGY
A gene cluster for secondary metabolism in oat: Implications for the evolution of metabolic diversity in plants



*Sainsbury Laboratory, John Innes Centre, Norwich NR4 7UH, United Kingdom;
Institute of Grassland and Environmental Research, Plas Gogerddan, Aberystwyth SY23 3EB, Wales, United Kingdom; and
DuPont Agricultural Products, P.O. Box 80402, Wilmington, DE 19880
Edited by Meinhart H. Zenk, University of Halle, Halle/Saale, Germany, and approved April 13, 2004 (received for review February 24, 2004)
| Abstract |
|---|
|
|
|---|
-amyrin synthase gene AsbAS1, which encodes the first committed enzyme in the avenacin biosynthetic pathway, is clearly distinct from other plant
-amyrin synthases. Here we show that AsbAS1 has arisen by duplication and divergence of a cycloartenol synthase-like gene, and that its properties have been refined since the divergence of oats and wheat. Strikingly, we have also found that AsbAS1 is clustered with other genes required for distinct steps in avenacin biosynthesis in a region of the genome that is not conserved in other cereals. Because the components of this gene cluster are required for at least four clearly distinct enzymatic processes (2,3-oxidosqualene cyclization,
-amyrin oxidation, glycosylation, and acylation), it is unlikely that the cluster has arisen as a consequence of duplication of a common ancestor. Although clusters of paralogous genes are common in plants (e.g., gene clusters for rRNA and specific disease resistance), reports of clusters of genes that do not share sequence relatedness and whose products contribute to a single selectable function are rare [Gierl, A. & Frey, M. (2001) Planta 213, 493498]. Taken together, our evidence has important implications for the generation of metabolic diversity in plants.
Triterpenoid saponins, like sterols, are synthesized from mevalonic acid via the isoprenoid pathway, the two pathways diverging after 2,3-oxidosqualene (Fig. 1) (1, 5). Synthesis of sterols in plants involves cyclization of 2,3-oxidosqualene to cycloartenol, mediated by the oxidosqualene cyclase enzyme cycloartenol synthase. For triterpenoid saponin synthesis, 2,3-oxidosqualene is cyclized to one of a number of different potential products, the most common being
-amyrin (1). The first committed step in avenacin synthesis is the cyclization of 2,3-oxidosqualene to
-amyrin, catalyzed by the oxidosqualene cyclase enzyme
-amyrin synthase (57). We have recently cloned the gene encoding oat
-amyrin synthase (AsbAS1) (7) and have shown that this corresponds to Sad1, a locus we had previously identified by mutation (4). The AsbAS1gene product is an unusual oxidosqualene cyclase that is clearly distinct from other triterpene synthases that have been characterized from plants (7).
|
-Amyrin, the precursor for synthesis of avenacins, is not antifungal. The conversion of
-amyrin into antifungal saponins will require cytochrome P450-dependent monooxygenases, acyltransferases, glycosyltransferases, and other enzymes (5, 7). Our data indicate that sad2 mutants accumulate
-amyrin and are likely to be blocked in a cytochrome P450-mediated step early in the pathway (8), and that sad3 and sad4 mutants are defective in saponin glucosylation (4). The sad7 mutant accumulates a metabolite that has the same sugar conjugate as avenacin A-1 but lacks the N-methyl anthranilate group (C.M., unpublished data) (Fig. 1). The biochemical defects in the other mutants (sad5, sad6, and sad8) are as yet unknown.
Here we show that AsbAS1, which maps to a region of the oat genome not conserved in other cereals, has arisen by duplication and divergence of a cycloartenol synthase-like gene, and that the properties of AsbAS1 have been refined since the divergence of oats and wheat. Intriguingly, five of the seven other Sad loci we have defined by mutation (4) are genetically linked to AsbAS1. Sad3 is 3.6 centimorgans (cM) from AsbAS1, whereas the four other linked loci (Sad2, 6, 7, and 8) showed complete cosegregation with AsbAS1 in our analyses. Because these loci are required for at least four clearly distinct enzymatic processes [AsbAS1 (Sad1), 2,3-oxidosqualene cyclization; Sad2,
-amyrin oxidation; Sad3, glycosylation; and Sad7, acylation], it is unlikely this gene cluster has arisen as a consequence of duplication of a common ancestor. The significance of these data for the evolution of metabolic diversity in plants and other eukaryotic organisms is discussed.
| Methods |
|---|
|
|
|---|
DNA Markers and Mapping. AsbAS1 was mapped in the A. strigosa CI3815 x A. wiestii CI1994 recombinant inbred lines (12) by using a single-nucleotide polymorphism in intron 17 that conferred presence or absence of a PacI restriction site. PCR fragments for digestion were amplified with the primer pair: tgggcaatgttggctttaattt/tgatgacatcggtaggaa. The PCR primer pairs for analysis of the Oisu441-derived sequence-tagged site marker (13) and the AsCS1 gene (7) (both of which detected insertion/deletion polymorphisms) were catgcctgtaccattctagctt/gcacactaacattttctatatcgtttca and tgttcacaattaccttgtgta/tgtaactgcctagaacggctt, respectively. Markers derived from other oat maps and from rice were obtained by sequence analysis and from databases [refs. 14 and 15; Rice Genome Research Program (2003) http://rgp.dna.affrc.go.jp]. Maps were constructed by using JOINMAP 2.0 (16), and the Kosambi map function (17) was used in the analysis.
Assessment of Sequence Divergence. Oat accessions used for comparison of sequence divergence of AsbAS1 and AsCS1 were Avena prostrata (Cc7060), Avena clauda (CAV5566/1), Avena ventricosa (CAV2835), and Avena longiglumis (Cc4719, Cc7250) (all from The Institute of Grassland and Environmental Research) and A. strigosa S75 (4) and CI3815 (12). Total RNA was isolated from 4- to 6-day-old oat roots by using TRI-REAGENT (Sigma) and products amplified from first-strand cDNA by using gene-specific primers. PCR products were gel purified (Qiagen) and sequenced by using the ABI PRISM Big-Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems). Predicted protein coding sequences were aligned by using CLUSTAL X, Version 1.8 (www-igbmc.u-strasbg.fr/bioinfo), with visual adjustments. Gaps in the alignment were not used in the analysis (complete-deletion option). Rates of synonymous and nonsynonymous nucleotide substitutions were estimated by the modified NeiGojobori method (18). MEGA2 software (19) was used for estimation of the nonsynomous (dN) to synomous (dS) ratio, sequence diversity, and Tajima's relative rate test (20).
| Results |
|---|
|
|
|---|
|
|
3.6 cM around the AsbAS1 locus. Along with our biochemical data, these results indicate that genes required for at least four distinct biochemical processes in the synthesis of saponins [cyclization of 2,3-oxidosqualene to
-amyrin (AsbAS1), cytochrome P450-mediated modification of
-amyrin (Sad2), acylation (Sad7), and glucosylation (Sad3)] are clustered within linkage group D of the diploid oat genome. Because the biochemical processes affected are quite different, it is highly unlikely that this cluster of Sad loci has arisen in situ from a common ancestor by gene duplication. The probability of five loci for saponin biosynthesis being within 3.6 cM of AsbAS1, assuming random distribution of genes, is extremely low (
1012 to 1015), based on estimates of total genetic distances for A. strigosa (12, 13).
|
-amyrin synthases (Fig. 4A). This is surprising, given the structural differences between sterols and triterpenes (23, 24). Interestingly, a multifunctional triterpene synthase from the monocot Costus speciosus that also groups with cycloartenol synthases has recently been described (25). The most similar sequence to AsbAS1 was a predicted oxidosqualene cyclase (Ta-OSC1) from Triticum aestivum (26). Although oats are the only cereals known to produce triterpenoid saponins,
-amyrin esters have been detected in the leaf tissue and surface waxes of a variety of grass species (2729). It is possible that Ta-OSC1 synthesizes
-amyrin in the leaves, although attempts to express this cDNA in yeast were unsuccessful.
|
2 = 52.74, P < 0.0001). Sequence comparisons for AsbAS1 and AsCS1 homologues from seven different oat accessions representing five different species (see Methods) revealed greater mean diversity for AsbAS1 than for AsCS1 (0.030 ± 0.003 vs. 0.017 ± 0.002, respectively). The average ratio of nonsynonymous (dN) to synonymous (dS) nucleotide substitutions per site (dN/dS) was 0.21 for AsbAS1 and 0.16 for AsCS1, indicating that both genes have been subjected to purifying selection during the evolution of oats. Collectively, these data are consistent with accelerated evolution of AsbAS1 from an ancestral cycloartenol synthase-like gene. We found general conservation of exonintron structure between AsbAS1and the cycloartenol synthase genes from A. strigosa, rice, and A. thaliana (Fig. 4B), although six of the AsbAS1 exons differed in size from their monocot cycloartenol synthase counterparts. The other predicted/confirmed genes for triterpene synthases in A. thaliana have fewer exons (between 13 and 17) (21). Overall, the structural similarities among AsbAS1and the cycloartenol genes from oat, rice, and A. thaliana suggest these genes share a common origin. AsbAS1 may have arisen directly or indirectly by duplication of AsCS1. However, the two genes are not linked, and we have mapped AsCS1 to a different linkage group (A) (12) by using the recombinant inbred lines derived from A. strigosa CI3815 x A. wiestii CI1994.
The Patterns of Expression of AsbAS1 and Ta-OSC1 Are Different. Avenacin biosynthesis is highly tissue-specific and is restricted to the epidermal cell layer of the root tips (30). In situ hybridization experiments indicate that AsbAS1 expression is also restricted to this cell layer (7). Comparison of the expression of AsbAS1 and Ta-OSC1 [the predicted oxidosqualene cyclase from wheat (Fig. 4A)] in different plant tissues by high-stringency Northern blot analysis indicates the expression patterns of these two genes are clearly different. AsbAS1 expression was detectable in the roots of oat but not in the aerial tissues [as previously reported (7)], and this probe did not give a hybridization signal with RNA from wheat roots, shoots, flowers, or leaves (Fig. 4C). In contrast, Ta-OSC1 transcripts were detectable in the aerial tissues but not the roots of wheat (Fig. 4C). The Ta-OSC1 probe also hybridized with RNA from the aerial tissues (but not the roots) of oat (Fig. 4C). These findings are compatible with our EST-based analysis of gene expression in oat roots, in which the only two predicted oxidosqualene cyclase sequences that we identified among
16,000 oat-root-derived EST sequences were AsbAS1 and AsCS1 (ref. 7 and unpublished data). The expression data for Ta-OSC1 are consistent with a potential role of the gene product in the synthesis of foliar surface waxes.
| Discussion |
|---|
|
|
|---|
-amyrin synthase AsbAS1 (7). This enzyme catalyzes the cyclization of 2,3-oxidosqualene to
-amyrin, which is the first committed step in the synthesis of avenacins. This conversion forms a branch point with the sterol biosynthetic pathway in which 2,3-oxidosqualene is converted to cycloartenol by cycloartenol synthase (Fig. 1). Strikingly, our evidence indicates that AsbAS1 is more closely related to cycloartenol synthases than to other plant triterpene synthases, and that AsbAS1 has arisen by rapid evolution from an ancestral cycloartenol synthase-like gene. The close relatedness of AsbAS1 to cycoartenol synthases is surprising because, although cycloartenol synthase and
-amyrin synthase both use 2,3-oxidosqualene as a substrate, the structures of the cyclization products they generate are quite different (5, 7, 23, 24). We have also shown that the expression patterns of AsbAS1 and that of the closest database match from cereals (Ta-OSC1) are different, and that the properties of AsbAS1 (root epidermis-specific expression and probably also kinetic properties) are likely to have been refined since the divergence of oats and wheat. Sequence analysis of AsCS1 and AsbAS1 homologues from a range of different oat accessions indicates that both genes have been subjected to purifying selection. This is consistent with the critical roles of the gene products in sterol metabolism and synthesis of defense-related secondary metabolites (7), respectively. AsbAS1 maps to a region of the oat genome not conserved in other cereals. Our genetic and biochemical analyses indicate that genes required for at least three other distinct biochemical processes in avenacin synthesis are clustered with AsbAS1 in linkage group D of the diploid oat genome. Clusters of paralogous genes of high nucleotide sequence identity are common in plants. Examples include gene clusters for rRNA and also for specific disease resistance that have arisen by gene duplication and unequal crossing over. In contrast, reports of clusters of plant genes that do not share sequence relatedness and whose products contribute to a single selectable function are rare. To our knowledge, the only other well characterized example of clustered genes for a secondary metabolic pathway in plants is that of the benzoxazinoids in maize (3133), although surveys of the A. thaliana genome hint this may be a more widespread phenomenon (34, 35). Because benzoxazinoids are produced by a range of cereals and also by some dicots, it has been postulated that the pathway may have evolved before the divergence of monocots and dicots, and that failure to produce these compounds may be due to loss of pathway components (32, 36). In contrast, within the Gramineae, the ability to synthesize triterpene saponins appears to be restricted to Avena species (1).
Mechanisms that act to disperse genes (translocation, inversion, and unequal crossing over) are well known in eukaryotes, and genes associated with common metabolic pathways [including genes for some secondary metabolic pathways such as anthocyanin biosynthesis (37)] are generally unlinked. This raises the question of how and why gene clusters of the kind that we have observed are maintained in the genome. Although gene clusters for secondary metabolism are not well documented in plants, they are common in fungi (3841). Fungal gene clusters for secondary metabolism include not only the genes for the biosynthetic components but also genes for specific pathway regulators and for autoresistance to the end product (38). Transmission of these self-contained "gene cassettes" by horizontal gene transfer has been suggested as an explanation for the persistence of clustering in fungi (38), although recent phylogenomics-based analyses indicate that the significance of vertical transmission has been underestimated (41, 42). Horizontal gene transfer cannot be the sole explanation for clustering of avenacin biosynthetic genes in oat, because our evidence indicates that the gene encoding the first committed enzyme in the pathway has arisen by gene duplication and sequence divergence. We believe there may be other explanations for the maintenance of gene clusters for secondary metabolism in plants, fungi, and other eukaryotic organisms. The oat avenacins and the maize benzoxazinoids both confer resistance to pests and pathogens (4, 7, 32), and so the ability to produce these compounds has obvious selective advantages. Clustering will facilitate the inheritance of the genes that confer these selective advantages as a functional unit. Disruption of the gene cluster may lead to failure to produce protective chemicals and could also result in the accumulation of deleterious intermediates (32). Our observation that oat mutants defective in avenacin glycosylation (sad3 and sad4 mutants) have aberrant root morphology (4) is consistent with this latter line of reasoning. Because many secondary metabolites and their pathway intermediates are potentially phytotoxic, there is likely to be a requirement for tight coordinate regulation of synthesis and for intimate coadaptation of individual pathway enzymes. Synthesis of avenacins, like many other plant secondary metabolites, is highly tissue specific and under strict developmental control. Avenacins are localized in the epidermal cells of the root tip (30), and AsbAS1 is expressed specifically in this cell layer (7). Clustering has the potential to facilitate coordinate regulation of expression of genes at the chromatin level. It may also confer other as-yet-undefined selective advantages associated with physical proximity and position effects. Intimate coadaptation of individual pathway enzymes is likely to be important as an additional mechanism for strict control and containment of secondary metabolites and their pathway intermediates during synthesis. This coadaptation may extend to physical interactions among pathway components, which would aid the channeling of metabolic intermediates within multienzyme complexes (43).
Although it is relatively easy to speculate about factors that may contribute to the maintenance of gene clusters, the issue of the origin of the clusters is rather more difficult to address. It is generally believed, at least for primary metabolism in plants, that new genes commonly arise by gene duplication and divergence (44, 45). Genes for secondary metabolism may in turn be derived from genes for primary metabolism by gene duplication and divergence or possibly also by allelic divergence (45). Domain swapping represents another mechanism for the creation of new composite genes (45, 46). Approximately one-quarter of the genes in the A. thaliana genome (
5,000 genes) are predicted to be involved in secondary metabolism, and many of these are likely to have been recruited directly or indirectly from primary metabolism (47). In maize, the enzymes BX1 and IGL, which are required for the synthesis of secondary metabolites (benzoxazinoids and volicitin, respectively), have evolved from a tryptophan synthase
-subunit required for primary metabolism (32). Similarly, the plant terpene synthases (which collectively produce a diverse class of natural products) are predicted to be derived from genes for primary metabolism by duplication and consequent divergence in structural and functional specialization (48). Other examples of the recruitment of genes from primary metabolism are also known (e.g., refs. 49 and 50). Our finding that AsbAS1 has arisen from a cycloartenol synthase-like gene by duplication and rapid sequence divergence provides further evidence that genes for secondary metabolism can be recruited from primary metabolism in this way (45). The fact that other Sad loci required for distinct biochemical processes in the avenacin biosynthetic pathway are linked to AsbAS1 raises the intriguing possibility that gene clusters for the synthesis of elaborate secondary metabolites may arise de novo within plant genomes by shuffling and accelerated evolution of existing genetic components. The evolution of complex functions can be simulated in computer-based experiments with digital organisms (51). We need a more substantial body of biochemical, genetic, and genomic information for a range of secondary metabolic pathways from diverse plant species to piece together the evolutionary events and processes underlying the generation of metabolic diversity in the plant kingdom and to establish whether clustered genes for secondary metabolism may be more common in plants than first anticipated. To quote from Trowsdale (52), "Until we understand the processes that have determined the ordering and clustering of genes in genomes, our understanding of gene regulation and evolution will be incomplete."
| Acknowledgements |
|---|
| Footnotes |
|---|
Abbreviation: cM, centimorgan.
To whom correspondence should be addressed. E-mail: annie.osbourn{at}sainsbury-laboratory.ac.uk.
| References |
|---|
|
|
|---|
This article has been cited by other articles in HighWire Press-hosted journals:
![]() |
B. Field and A. E. Osbourn Metabolic Diversification--Independent Assembly of Operon-Like Gene Clusters in Different Plants Science, April 25, 2008; 320(5875): 543 - 547. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lin, B. Shen, Z. Xu, T. G. Kollner, J. Degenhardt, and H. K. Dooner Characterization of the Monoterpene Synthase Gene tps26, the Ortholog of a Gene Induced by Insect Herbivory in Maize Plant Physiology, March 1, 2008; 146(3): 940 - 951. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Jonczyk, H. Schmidt, A. Osterrieder, A. Fiesselmann, K. Schullehner, M. Haslbeck, D. Sicker, D. Hofmann, N. Yalpani, C. Simmons, et al. Elucidation of the Final Reactions of DIMBOA-Glucoside Biosynthesis in Maize: Characterization of Bx6 and Bx7 Plant Physiology, March 1, 2008; 146(3): 1053 - 1063. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Mylona, A. Owatworakit, K. Papadopoulou, H. Jenner, B. Qin, K. Findlay, L. Hill, X. Qi, S. Bakht, R. Melton, et al. Sad3 and Sad4 Are Required for Saponin Biosynthesis and Root Development in Oat PLANT CELL, January 1, 2008; 20(1): 201 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shimada, S. Sato, T. Akashi, Y. Nakamura, S. Tabata, S.-i. Ayabe, and T. Aoki Genome-wide Analyses of the Structural Gene Families Involved in the Legume-specific 5-Deoxyisoflavonoid Biosynthesis of Lotus japonicus DNA Res, April 23, 2007; (2007) dsm004v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Qi, S. Bakht, B. Qin, M. Leggett, A. Hemmings, F. Mellon, J. Eagles, D. Werck-Reichhart, H. Schaller, A. Lesot, et al. A different function for a member of an ancient and highly conserved cytochrome P450 family: From essential sterols to plant defense PNAS, December 5, 2006; 103(49): 18848 - 18853. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Wisser, Q. Sun, S. H. Hulbert, S. Kresovich, and R. J. Nelson Identification and Characterization of Regions of the Rice Genome Associated With Broad-Spectrum, Quantitative Disease Resistance Genetics, April 1, 2005; 169(4): 2277 - 2293. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||