ChemBridge Corporation Screening Compounds Sign up for PNAS Online eTocs
Link: Info for AuthorsLink: Editorial BoardLink: AboutLink: SubscribeLink: AdvertiseLink: ContactLink: Sitemap Link: PNAS Home
Proceedings of the National Academy of Sciences
Link: Current Issue "" Link: Archives "" Link: Online Submission ""  Link: Advanced Search


PNAS | May 24, 2005 | vol. 102 | no. 21 | 7683-7688
 OPEN ACCESS ARTICLE

This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrow Supporting Tables
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My File Cabinet
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, H.
Right arrow Articles by Kurnit, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, H.
Right arrow Articles by Kurnit, D. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg  
What's this?

 Previous Article  | Table of Contents |  Next Article 

MEDICAL SCIENCES
Sensitive detection of human papillomavirus in cervical, head/neck, and schistosomiasis-associated bladder malignancies

H. Yang a, K. Yang a, A. Khafagi a, Y. Tang a, T. E. Carey b, A. W. Opipari c, R. Lieberman c, d, P. A. Oeth e, W. Lancaster f, H. P. Klinger g h, A. O. Kaseb i, A. Metwally j, H. Khaled j, and D. M. Kurnit a k, l

Departments of aPediatrics, bOtolaryngology, cObstetrics and Gynecology, and dPathology, University of Michigan Medical School, Ann Arbor, MI 48109-0652; eSequenom, Inc., 3595 John Hopkins Court, San Diego, CA 92121-1121; fCenter for Molecular Medicine and Genetics, Wayne State University School of Medicine, Detroit, MI 48201; gDepartment of Genetics, Albert Einstein College of Medicine, Bronx, NY 10461; iInternal Medicine, Henry Ford Hospital, Detroit, MI 48202; and jNational Cancer Institute, Cairo, Egypt

Edited by Charles R. Cantor, Sequenom, Inc., San Diego, CA, and approved December 9, 2004 (received for review September 17, 2004)


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
We assayed for the presence of human papilloma virus (HPV) DNA in serum and/or peripheral blood fraction (PBF) of individuals with cervical, head/neck, or bladder cancer due to schistosomiasis. Using mass spectroscopy coupled with competitive PCR, HPV DNA was detected at the individual molecule level by using "MassARRAY" assays. The resultant sensitivity was superior to real-time fluorescent PCR-based assays, while specificity was maintained. Our principal findings were: (i) Virtually all tested cervical cancers and schistosomiasis-associated bladder cancers, and a plurality of head/neck cancers, are associated with HPV DNA in the tumor. (ii) All 27 bladder cancers due to schistosomiasis were associated with the presence of HPV-16 DNA, which can be detected in tumor and serum but not in PBF. In contrast, no serum HPV-16 DNA signal was detected in seven individuals with schistosomiasis-associated bladder cancers after surgical removal of the tumor. (iii) Among the head/neck cancers we studied, anterior tumors were more often associated with HPV DNA in tumor, serum, and/or PBF than posterior tumors. (iv) In cervical cancer, where all tumors contain HPV DNA, viral DNA could be detected often in serum and/or PBF. Further, HPV-16 DNA was detected in serum and/or PBF of most patients with untreated high-grade cervical dysplasia but disappeared if the dysplasia was eliminated. The sensitive, specific, and quantitative MassARRAY technique should make it feasible to monitor cancer occurrence and treatment and recurrence of malignancies and dysplasias associated with HPV DNA.

cancer diagnosis | cancer treatment | bilharziasis

Recent studies indicate that the human papillomavirus (HPV) is associated with a significant fraction of cervical (1, 2), head/neck (3), and schistosomiasis-associated bladder cancers (4). Cervical cancers are almost uniformly associated with HPV infection (5). In a review of published reports, McKaig et al. (3) found the overall prevalence of HPV DNA in head and neck tumors to be 35%. More recently, Gillison et al. (6) used quantitative PCR (QPCR) to confirm these findings in a large study of 253 tumor samples. They detected HPV DNA in 25% of specimens. Khaled et al. (4) found that nearly 50% of schistosomiasis-caused bladder cancers had HPV DNA by in situ hybridization. This body of work argues that HPV could be a useful tag for tracking a considerable fraction of cervical, head/neck, and schistosomiasis-associated bladder cancers.

HPV types 16 and 18 are among the "high-risk" viral types, because their presence is associated with preneoplastic lesions and carcinomas. In contrast, the "low-risk" types, most commonly types 6 and 11, are typically associated with benign lesions. The oncogenic potential of HPV is principally due to two viral oncoproteins, E6 and E7. Differences in oncogenic potential among HPV types have been attributed to type-specific differences in the E6 and E7 proteins (7). The E6 protein of oncogenic HPV strains has been shown to interact with the p53 protein and promote its degradation via a ubiquitin-dependent pathway (7). The E7 oncoprotein, similarly, can complex with the retinoblastoma (Rb) protein and inactivate it (8). Both p53 and Rb are important tumor suppressor genes whose products regulate the cell cycle, orchestrate DNA repair processes, and are involved with programmed cell death or apoptosis. Disruption of these tumor suppressor proteins by HPV leads to propagation of mutational changes and cell immortalization.

Since the work of Anker, Sidransky, and coworkers (9–11) established that abnormal genomic DNA can be detected in serum of cancer patients, the technique of examining serum DNA for abnormal genomes of cancer cells has been studied as a potential molecular test for cancer. This strategy is particularly suited to screen for an exogenous sequence such as a virus that is not homologous to any host DNA sequence, but that is found in tumors. Lo and coworkers (12–16) were successful in using this strategy to screen for the presence of Epstein–Barr virus (EBV) associated with nasopharyngeal carcinoma. Sidransky and coworkers (6, 17–21) found that the TaqMan QPCR method could detect HPV DNA in serum from some patients with head/neck and cervical cancers but, unlike the case for EBV in nasopharyngeal cancer, HPV DNA was not detectable in serum in sufficient amounts to be useful in most subjects as a clinical tool. Thus, it has been difficult to adapt the EBV paradigm for the detection of HPV, because the amount of HPV DNA present in serum or peripheral blood fraction (PBF) is less than for EBV DNA. We show that a more sensitive MassARRAY technology increases the sensitivity of detection of HPV DNA and provides evidence for a more frequent association of serum and/or peripheral-blood HPV-DNA with several tumor types. This knowledge may permit screening of PBF and serum for HPV DNA as a marker of residual tumor or dysplasia in patients associated with HPV.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 Conclusion
 References
 
Isolation of Samples for QPCR. Tumor, serum, PBF, and urine sediment samples were isolated at the time of tumor biopsy from individuals with cancer. Serum and/or PBF were isolated from normal pediatric controls not exposed to HPV, from individuals with schistosomiasis (with or without known bladder cancer), with schistosomiasis-associated bladder cancer after surgical removal of the tumor, with head/neck cancer, and with cervical cancer or cervical dysplasia. Urine sediment was isolated from subjects with schistosomiasis-associated bladder cancer and from control subjects without bladder tumors. Urine sediment was the pellet isolated after centrifugation of urine for 10 min at 8,000 rpm in a Beckman–Spinco J2–21M centrifuge. Placentas were obtained after normal births. Tissue, PBF, and urine sediment DNA were isolated by using the ZR Genomic DNA I kit (Zymo, Orange, CA). DNA was isolated from 0.3 ml of serum by using Zymo's original kit for isolation of DNA from serum. Zymo recently developed a new ZR Serum DNA Isolation kit that enabled us to isolate DNA from 5 ml of serum and elute the DNA in 10–20 µl of low salt elution buffer without requiring precipitation. We used this kit for the cervical cancer serum DNA preparations.

Construction of a Degenerate TaqMan HPV DNA Probe. A degenerate HPV DNA PCR probe was constructed in the L1 region of the virus (22). The GP5+ and GP6+ primers were from de Roda Husman et al. (23). The MY18 and MY1019 primers were from Nelson et al. (24). To construct a degenerate TaqMan (25) set, we combined the sequences to yield a TaqMan set with the two outside primers (based on GP5+ and GP6+) and a probe (based on MY18 and MY1019). Melting temperatures (Tm) were derived by using the oligo calculator of Qiagen, Chatsworth, CA (www.operon.com/oligos/toolkit.php?).

The GP5+ analogue (primer 1) was constructed by combining an equal amount of each of four primers: 5'-GCACAGGGACATAATAAT-3' (Tm = 53.8°C), 5'-GCACAGGGTCATAATAAT-3' (Tm = 53.8°C), 5'-GCCCAGGGACATAAT-3' (Tm = 53.8°C), 5'-GCCCAGGGTCATAAT-3' (Tm = 53.8°C). Primer 2 (GP6+ analogue) was 5'-GAATATGATTTACAGTTTATTTTTC-3' (Tm = 53.1°C).

The MY1019 final probe was constructed by mixing an equal volume of MY1019 analogues 1 and 2. The final probe was constructed from an equal amount of the MY18 analogue [5'-CTGTTGTTGATACTACACGCAGTAC (Tm = 62.8°C)] and the MY1019 final analogue [constructed from a 1:1 mixture of MY1019 analogue 1: (5'-GTGGTAGATACCACACGCAGTA-3') (Tm = 63.4°C) and MY1019 analogue 2 (5'-GTGGTAGATACCACTCGCAGTA-3') (Tm = 63.4°C)].

The primers and probes were synthesized by Biosearch. The probe was labeled with the fluor 6-carboxyfluorescein at the 5'-end and Black Hole Quencher 1 at the 3'-end. We tested the degenerate primer-probe collection on plasmids carrying either HPV-16 or -18 sequences (American Type Culture Collection), respectively. Using the degenerate probe, we obtained equivalent amplification with either plasmid.

PCR Amplification of Degenerate TaqMan Probe. Because all normal sera contain small amounts of normal genomic DNA (11), we verified that serum DNA was prepared from all samples with a TaqMan erbB-2 genomic DNA probe (25). In a similar manner, we confirmed that DNA was isolated from all other samples used. After denaturation at 95°C for 5 min, a two-step program of denaturation at 95°C for 15 sec, and annealing at 60°C for 30 sec was used to amplify erbB-2 for 40 cycles. After denaturation at 95°C for 5 min, the conditions we used for QPCR amplification for HPV DNA on a PerkinElmer model 7700 after optimization were a two-step program of 52°C for 60 sec (for annealing and extension) and denaturation at 95°C for 15 sec for 40 cycles. We also performed this process for 55 cycles for a number of samples to match the 55 cycles used in the last amplification step of the MassARRAY method (see below). The lower-than-normal annealing and extension temperature of 52°C reflected our use of a degenerate probe. For the TaqMan reaction with the degenerate HPV DNA probe, each value was repeated in quadruplicate. Samples were analyzed by the TaqMan method (25) on a PerkinElmer model 7700 machine. DNA sequencing was done by the University of Michigan Core sequencing facility.

Quantitative MassARRAY Method. The MassARRAY technology involves a three-step process composed of real-time competitive PCR, primer extension, and MALDI-TOF MS separation of products on a matrix-loaded silicon chip ARRAY to detect as few as several initial molecules (26). In brief, a competitive template (50–100 bp) is synthesized to match the target sequence for PCR except for a single base mutation, which is introduced during the synthesis. The single base change can then be discriminated from the target allele using a primer extension reaction with product resolution by mass (in daltons) on the MALDI-TOF MS, as is done for SNP genotyping (27). The competitive template is added to the PCR reaction at known quantities and can therefore be titrated to create a standard curve for the determination of target DNA quantities. When the peak areas of the target allele and competitive template allele are equal, the concentrations of the two molecules are at a 1:1 ratio, representing the amount of target DNA in the reaction. MassARRAY analysis is very specific, because a given primer extension product was discerned down to a resolution of 40 daltons, well above the lower limits for peak resolution in this mass range for current MALDI-TOF MS. Any contaminant products would therefore have to be this specific size to create a false-positive signal. The presence of the internal standard (competitive template) also serves to confirm that the enzymes required for PCR were working, and that the sample was purified free of inhibitors of PCR.

Sensitivity of MassARRAY Analysis. To test the sensitivity of the MassARRAY system, we constructed internal competitor oligonucleotides (with one nucleotide changed from the HPV DNA sequences) and spiked in different amounts of HPV-16 DNA and HPV-18 DNA (American Type Culture Collection) corresponding to 10,000 copies, 1,000 copies, 100 copies, 10 copies, and 1 copy of HPV DNA (with the latter done several times to minimize Poissonian variation). The primers used were as follows.

HPV-16: Internal competitor, CTGTAAATCATATTCCTCCCCATGTCGTACGTACTCCTTAAAGTTAGTATTTTTATATGTAGT T TCTGA AGTAGATATGGCAGCACA; HPV16-forward, ACGTTGGATGTGTGCTGCCATATCTACTTC; HPV-16-reverse, ACGTTGGATGCTGTAAATCATATTCCTCCCC; and HPV-16-mass extend, TTCCTCCCCATGTCGTA.

HPV-18: Internal competitor, GAGGGAGAATACACACAGCTGCCACGTGA AGCAGGCATACCTGTGCCT TTA ATATATA AGGAT TGAGGCACAGTGTCACCCATAGTA; HPV-18-forward, ACGTTGGATGTACTATGGGTGACACTGTGC; HPV-18-reverse, ACGTTGGATGGAGAGGGAGAATACACACAG; and HPV-18-mass extend: GAATACACACAGCTGCCA.

The attomolar (aM) (1 aM = 10–18 M) concentration of HPV DNA for a tumor sample observed on a Sequenom MassARRAY mass spectrometer was derived from a series of 10 wells; 2 wells each had successive internal competitor concentrations of 0, 1, 10, and 100 aM and 1 femtomolar (fM) (1 fM = 10–15 M). For the serum, PBF, and urine sediment, where there was a lower concentration of HPV DNA than in tumor, we used eight wells with no internal competitor in four wells and 1 aM internal competitor in four wells. A concentration of 1 aM of competitive template in 5-µl PCR reaction corresponds to approximately three molecules of HPV DNA.

Because MassARRAY is not a homogeneous assay, great attention has to be paid to setting up the reaction. Although this was done manually herein with multiple replicates per assay point, in the future, this will be done robotically to minimize contamination. The finding that normal samples were negative confirmed that manual techniques to prevent contamination were cumbersome but effective. All values reported herein represent the analysis of at least 12 independent data points.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 Conclusion
 References
 
Control Samples. We examined a series of controls for tissue, serum, PBF, and urine sediment. The tissue controls were DNA samples from normal placentas. The serum and PBF controls were DNA samples we isolated from sera and PBF of anonymous minors not known to be exposed to HPV (gift of D. Giacherio, University of Michigan). The urine sediment controls were DNA samples from normal volunteers. In all patients reported herein, reaction with an erbB-2 control probe was positive, confirming that DNA of QPCR quality was present. The control samples were usually negative for the degenerate HPV DNA probe in all four wells and rarely were positive in one of four wells. Thus, we conservatively took only samples that reacted in three or four of four wells to be positive.

Using the definition above on samples analyzed on the PerkinElmer model 7700, the degenerate HPV DNA probe reacted with 0/40 normal urine sediments, 0/27 normal serum samples, 0/20 normal PBF samples, and 0/9 placentas (control for normal tissue samples). Further, an even more sensitive analysis with the MassARRAY system also showed that no HPV DNA was present in any of these normal samples. This control is essential to our interpretation that detection of HPV DNA by the MassARRAY system is a specific and meaningful finding.

Using the highly conserved reverse primer (primer 2) as the initiating primer for DNA sequencing, we were then able to determine the HPV DNA type by dideoxy sequencing. We observed the following:

  1. The degenerate probe was appropriately negative in all control tissues.
  2. We saw evidence of HPV DNA in schistosomiasis-associated bladder cancers (Table 1 and Table 5, which is published as supporting information on the PNAS web site), head/neck cancers (Table 2 and Table 6, which is published as supporting information on the PNAS web site), and cervical cancers (Table 3 and Table 7, which is published as supporting information on the PNAS web site). This is in agreement with a large body of literature that indicates such involvement. However, the TaqMan method was not fully sensitive, because there were multiple samples where the serum was positive but the tumor was negative (Table 5).
  3. DNA sequencing of the PCR-generated product using primer 2 to initiate the sequencing reaction showed HPV-16 DNA in 70 and HPV-18 DNA in 3 of the samples (two cervical cancers and one head/neck cancer).


View this table:
[in this window]
[in a new window]
  		Table 1. Detection of HPV-16 in schistosomiasis-associated bladder cancers by MassARRAY

 


View this table:
[in this window]
[in a new window]
  		Table 2. MassARRAY analysis of HPV-16 DNA in head/neck tumors, blood, and serum

 


View this table:
[in this window]
[in a new window]
  		Table 3. MassARRAY analysis of HPV-16 DNA in cervical cancer

 
MassARRAY: Schistosomiasis-Associated Bladder Cancers. Using the MassARRAY system, we detected HPV-16 DNA in all 24 schistosomiasis-associated bladder tumors from which we prepared DNA (right side of Table 1). In all but one of these samples, the matching sera were also positive. In an additional three patients for which we did not have tumor DNA, the sera were positive for HPV-16 DNA. These data strongly implicate HPV-16 infection in schistosomiasis-associated bladder cancers. Real-time TaqMan QPCR was not as sensitive (left side of Table 5) as MassARRAY analysis (right side of Table 5). HPV-16 DNA was detected in urine sediment from most but not all schistosomiasis-associated bladder cancer patients (Tables 1 and 5). PBF (buffy coat) from these patients was uniformly negative by both real-time QPCR and MassARRAY (data not shown).

Comparison of MassARRAY results (right side of Table 5) with older in situ hybridization data (4) and TaqMan data for a standard 40 cycles (left side of Table 5) show that MassARRAY is more sensitive than either in situ hybridization or TaqMan QPCR. The lack of reproducibility of the data on the left side of Table 5 (data not shown) indicates that the TaqMan technique is operating at the limits of its sensitivity and is not accurate. Further, the TaqMan technique does not distinguish quantitatively between tumors, serum, and urine sediment. We then attempted to perform TaqMan RT-QPCR for 55 cycles to mirror the MassARRAY method. No improvement between signal and noise was observed, underscoring the limitations of the TaqMan technique. In contrast, the values on the right side of Table 5 that are derived from the MassARRAY analysis are consistent with the expected finding that tumors are more positive than serum and/or urine sediment.

Fortunately, both specificity and sensitivity were maintained in the MassARRAY analysis. Using MassARRAY, HPV-16 DNA was detected in all schistosomiasis-associated bladder tumors we examined (24/24), in nearly all (26/27) sera from these patients, and in a majority (15/24) of urine sediments from these patients. PBF from these patients did not contain detectable HPV DNA (data not shown).

The Presence of HPV DNA Is Not Simply Due to Schistosomiasis. We examined 10 patients where schistosomiasis existed, and there was some question of bladder cancer that could not be proven clinically. In eight of the patients, there was no HPV DNA found in the serum; in two of the patients, HPV-16 DNA was found. Further longitudinal studies will be required to determine the ultimate clinical status of these two patients. This work demonstrates that HPV DNA is not associated with schistosomiasis per se but rather with tumor development in schistosomiasis patients with bladder cancer.

Serum HPV DNA Disappears Rapidly After Tumor Removal. We examined the sera of seven subjects with schistosomiasis within 2 weeks of surgical removal of a cancerous bladder. In all seven patients, there was no HPV DNA detected in serum. Although sera before surgery were not observed, the uniform positive nature of the tumors for HPV-16 (Table 1) indicates that HPV was likely present and then eradicated by surgery.

MassARRAY: Head/Neck Cancers. We investigated whether HPV DNA was present in matched tumor, PBF, and serum samples obtained at the time of diagnosis of head/neck cancer. For each sample, the site of the primary tumor is given. We attempted analysis with fluorescent QPCR but did not detect HPV DNA in PBF and serum, in agreement with the finding by Sidransky's group (17, 21) that this technique is not sufficiently sensitive to be clinically useful. In contrast, MassARRAY analysis yielded the data summarized in Tables 2 and 6. Readings documenting the presence of HPV-16 DNA are bolded.

There was a strong bias for tumors in the anterior parts of the head/neck tract (e.g., oropharynx, tongue, tonsils) to be positive for HPV and for tumors in the posterior parts (e.g., larynx, supraglottic region) to be negative. This is consistent with previous reports (3, 6, 28–33). From the samples where the tumor was positive, and both blood and serum could be analyzed, there were patients where the tumor was positive for HPV DNA in which HPV DNA was discerned in the serum only, blood only, or in both the serum and blood.

MassARRAY: Cervical Cancers. Cervical cancer is almost uniformly associated with HPV (30, 34). We tested for HPV-16 DNA and HPV-18 DNA in DNA samples from cervical tumors and in matched DNA samples of PBF and serum (Tables 3 and 7). HPV-16 DNA was detected in 18/21 tumors. We did not detect HPV-18 DNA in this series, although we did detect two tumors with HPV-18 DNA in another series of tumor DNAs that underwent DNA sequencing (see above). Samples containing HPV-16 DNA are bolded in Table 7. In 17 of 18 patients where the tumor had detectable HPV-16 DNA, we found that the serum and/or PBF also had detectable HPV-16 DNA. Neither HPV-16 DNA nor HPV-18 DNA was detected in the serum and/or PBF in any of the three patients where the tumor was negative for HPV-16 DNA and HPV-18 DNA. As we had observed in head/neck cancers, PBF and serum results differed in many of the cervical cancer patients. Of the 18 samples that were positive in the tumor, 8 were positive in both serum and PBF, 5 were positive in serum but not PBF, 4 were positive in PBF but not serum, and 1 was negative in both serum and PBF.

Cervical Dysplasia. We examined serum and PBF samples from women with cervical dysplasia. None of these women had detectable HPV-16 DNA in their serum or PBF by TaqMan analyses with the degenerate probe. In contrast, MassARRAY analysis detected small amounts of HPV-16 DNA in serum and/or PBF from a subset of individuals with high-grade dysplasia. Four of five patients with high-grade cervical dysplasia were positive for HPV-16 DNA. We also detected HPV-16 DNA in serum from one individual with atypical squamous cells of uncertain significance and another subject with a diagnosis of vulvar intraepithelial neoplasia grade I and low grade cervical dysplasia. We did not observe HPV DNA in serum or blood of individuals who did not have active lesions. Further, the MassARRAY tests for HPV DNA in serum or PBF were always negative after successful removal of the previous high-grade dysplasia or cancer in situ (patients 4–6, 15–17, 22, 24, 27, and 44). Samples were not available before removal of the dysplasia in these patients. The one subject (case 1) who had high-grade cervical dysplasia without HPV DNA in serum or PBF may have had an HPV type other than the HPV-16 or -18 used in our current HPV DNA probe.


   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
Conclusion
 References
 
We showed that MassARRAY technology has high sensitivity for HPV DNA detection, providing the possibility to test serum and/or PBF for HPV DNA. If positive, the MassARRAY methodology can then be used to evaluate the results of clinical management of HPV-associated anomalies. TaqMan analyses of serum have not shown this high degree of resolution, as exemplified both by our TaqMan results (using a degenerate HPV sequence that was skewed to resemble HPV-16 and -18 most closely; Table 5) and previous attempts with TaqMan technology [using probes for individual HPV sequences (17, 19)] to detect HPV in serum of individuals with head/neck and cervical malignancies. In contrast, using the MassARRAY methodology, we found that:

  1. All 27 schistosomiasis-associated bladder cancers were associated with HPV-16 DNA, whereas a less-sensitive in situ hybridization technique detected only one-half of these associations (4). All samples reacted with the HPV-16 DNA probe and not the HPV-18 DNA probe. HPV-16 DNA was seen almost uniformly in serum, often in urine sediment, and not in PBF. The potential to screen for occurrence of schistosomiasis-associated bladder cancer by analysis of serum now becomes feasible, especially because our preliminary studies indicate that schistosomiasis per se does not result in detection of HPV DNA in serum. The potential to monitor therapy by determination of whether HPV DNA has been ablated by therapy that destroys cancer cells is supported by the lack of detectable HPV DNA in sera taken from seven subjects {approx}2 weeks after surgery.
  2. There is a strong trend for anterior but not posterior head/neck tumors to be associated with HPV infection (Tables 2 and 6; ref. 6). The oral tumors that were negative for HPV-16 DNA and HPV-18 DNA could represent either tumors that are not associated with HPV and/or tumors associated with types of HPV other than HPV-16 or -18. Thus, we must construct probes for additional types of HPV known to be associated with carcinogenesis (35). Larger sample sizes will then be indicated with a more thorough sampling of different types of HPV DNA to delineate more completely the association of HPV DNA-positive tumors with anatomic localization.
  3. Both head/neck and cervical tumors result in liberation of HPV DNA into the serum and/or PBF, affording the possibility of monitoring the occurrence and treatment of these tumors by testing serum and/or PBF. Unlike schistosomiasis-associated bladder cancers in which HPV-16 DNA detected all 27 patients, these tumors are known to be associated with a diverse assortment of HPV subtypes (35).
  4. Unlike schistosomiasis-associated bladder cancers in which only serum HPV DNA is seen, HPV DNA in both serum and/or PBF may be detected in head/neck and cervical tumors. There may be clinical correlates of finding HPV DNA in serum or PBF, respectively. We note that all three combinations (serum+, blood+; serum+, blood–; and serum–, blood+) were seen, demonstrating that the occurrence of a cancer cell genome in serum and PBF can occur distinctly. This argues for the necessity of screening both serum and PBF for head/neck and cervical tumors.

Our findings suggest that cervical dysplasia can liberate detectable HPV genomes into the serum and/or PBF. Successful treatment of the dysplasia appears to result in elimination of the HPV genome from the serum and/or PBF. This association between dysplasia and the presence of HPV DNA in serum and/or PBF was not detectable previously due to insensitivity of the detection methods used. Indeed, we did not detect any abnormalities by fluorescent QPCR. The technical sensitivity of the current standard of care, Digene's Hybrid Capture 2 HPV DNA test, extends only down to {approx}5,000 copies (35). Thus, while maintaining specificity, the MassARRAY technique is 103-fold more sensitive than the current standard of care. This increase in sensitivity conferred by the MassARRAY technique explains why it was possible to detect the small amounts of HPV DNA in serum and/or PBF associated with dysplasia, as seen in Table 4. The determination of how best to use these findings will require the use of a more complete representation of HPV genomes for screening of serum and/or PBF. We noted the disappearance of HPV DNA in serum and/or PBF after treatment of high-grade cervical dysplasia. These findings underscore the potential usefulness of elaborating a blood test to determine treatment success before a protracted period of followup monitoring that is currently the approach used to rule out the persistence of these disorders. Specific studies will be required to determine the relative meaningfulness of presence of HPV DNA in the serum and/or PBF.


View this table:
[in this window]
[in a new window]
  		Table 4. MassARRAY analysis of HPV-16 DNA in cervical dysplasia

 
Vaccination Against HPV-16. This screening detects only transcripts from HPV and therefore will not interfere with vaccination directed against HPV-16 (36). Our DNA sequencing results demonstrate that the vast majority of HPV associated with different malignancies is due to HPV-16. This underscores the potential of vaccination against HPV-16 (36) to decrease the incidence of these malignancies in populations at risk. Fortunately, this screen would still be useful in subjects vaccinated with HPV-16 who would be expected to contain antibodies against HPV-16, but would not contain HPV-16 DNA, in serum and PBL.

Rationale for Use of the MassARRAY Methodology. We observed both increased sensitivity and specificity using the MassARRAY methodology. We used 45 cycles for PCR amplification followed by 55 cycles for the postPCR primer extension reactions. This high cycle combination may enhance sensitivity of low copy target detection. In particular, the MassARRAY-based real-time competitive PCR process is cycle-independent for the postPCR primer extension reaction (26), allowing us to use a high number of cycles. Regardless of the theoretical basis, in practice, the sensitivity of the MassARRAY method extends down to individual molecules based on our studies.

The specificity of the MassARRAY method likely devolves from the requirement that backgrounds have the same molecular weight as the target sequence. This stringent requirement ensues from the analysis of primer-extension products by MALDI-TOF MS. As a result, the specificity of the analysis is increased, which minimizes false-positive signals. Methods that rely on fluorescent changes do not achieve this level of specificity as total fluorescent background is detected rather than limiting background to a specific molecular weight. Thus, the application of the sensitive and specific MassARRAY technology should have significant applicability to the facile detection of HPV-associated tumors.

The breakdown of the TaqMan assay at the lower limits of HPV detection is illustrated by comparison of the same samples done by both the TaqMan and MassARRAY methods in Tables 1 and 5. The difficulties for the TaqMan method are illustrated by multiple examples where the TaqMan analysis was falsely negative for tumor but positive for serum (Table 5). In contrast, the MassARRAY method was always positive for tumors when the serum was positive.


   Conclusion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Conclusion
References
 
The use of the sensitive MassARRAY technology yields the following advances: (i) Schistosomiasis-associated bladder cancers are uniformly associated with HPV. Clinical surveillance of serum and/or urine sediment is indicated both to analyze subjects at significant risk of developing schistosomiasis-associated bladder cancers and to monitor treatment of this disorder. (ii) A significant fraction of head/neck tumors, cervical malignancies, and cervical dysplasias can yield HPV in serum and PBF, providing a clinical tool to detect and monitor treatment of these disorders. (iii) In all of these neoplasia types, analysis of HPV will be useful both to study the pathogenesis of these disorders and as a potential prognostic factor. The use of a more sensitive mode of analysis now makes it feasible to ask questions about the uses of HPV to understand and monitor these disorders.


   Acknowledgements
 
We thank Dr. S. King (University of Michigan) for providing his PerkinElmer model 7700. This work was supported by Michigan Life Sciences Corridor Grant (MEDC-410); the Michigan Tri-Technology Corridor (no. 239); National Institutes of Health Head/Neck Cancer Specialized Programs of Research Excellence Grant 1 P50 CA97248; National Institutes of Health Grants R21 DK69877, R21 DK070237, CA104830, and CA94328; and Michigan Diabetes and Research Training Cell and Molecular Biology Core Grant DK20572.


   Footnotes
 
Author contribution: D.M.K. designed research; H.Y., K.Y., A.K., Y.T., P.A.O., A.O.K., and A.M. performed research; D.M.K. analyzed data; and A.W.O. and D.M.K. wrote the paper.

This paper was submitted directly (Track II) to the PNAS office.

Freely available online through the PNAS open access option.

Abbreviations: HPV, human papillomavirus; QPCR, quantitative PCR; PBF, peripheral blood fraction.

h Deceased September 28, 2004. Back

k D.M.K., cofounder of SensiGen, jointly holds a patent with the University of Michigan on the technology described in this article. Back

l To whom correspondence should be addressed. E-mail: sesame{at}umich.edu.

© 2005 by The National Academy of Sciences of the USA


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 

  1. Kedzia, H., Gozdzicka-Jozefiak, A., Wolna, M. & Tomczak, E. (1992) Eur. J. Gynaecol. Oncol. 13, 522–526.[Medline]
  2. Kedzia, W. M., Gozdzicka-Jozefiak, A. & Hedzia, H. (1993) Eur. J. Gynaecol. Oncol. 14, 408–411.[Medline]
  3. McKaig, R. G., Baric, R. S. & Olshan, A. F. (1998) Head Neck 20, 250–265.[CrossRef][ISI][Medline]
  4. Khaled, H. M., Raafat, A., Mokhtar, N., Zekri, A. R. & Gaballah, H. (2001) Tumori 87, 256–261.[Medline]
  5. Marx, J. L. (1986) Science 231, 920.[Free Full Text]
  6. Gillison, M. L., Koch, W. M., Capone, R. B., Spafford, M., Westra, W. H., Wu, L., Zahurak, M. L., Daniel, R. W., Viglione, M., Symer, D. E., et al. (2000) J. Natl. Cancer Inst. 92, 709–720.[Abstract/Free Full Text]
  7. Scheffner, M., Werness, B. A., Huibregtse, J. M., Levine, A. J. & Howley, P. M. (1990) Cell 63, 1129–1136.[CrossRef][ISI][Medline]
  8. Dyson, N., Howley, P. M., Munger, K. & Harlow, E. (1989) Science 243, 934–937.[Abstract/Free Full Text]
  9. Anker, P., Mulcahy, H., Chen, X. Q. & Stroun, M. (1999) Cancer Metastasis Rev. 18, 65–73.[CrossRef][ISI][Medline]
  10. Nawroz, H., Koch, W., Anker, P., Stroun, M. & Sidransky, D. (1996) Nat. Med. 2, 1035–1037.[CrossRef][ISI][Medline]
  11. Stroun, M., Anker, P., Lyautey, J., Lederrey, C. & Maurice, P. A. (1987) Eur. J. Cancer Clin. Oncol. 23, 707–712.[CrossRef][ISI][Medline]
  12. Lo, Y. M., Chan, L. Y., Lo, K. W., Leung, S. F., Zhang, J., Chan, A. T., Lee, J. C., Hjelm, N. M., Johnson, P. J. & Huang, D. P. (1999) Cancer Res. 59, 1188–1191.[Abstract/Free Full Text]
  13. Lo, Y. M., Leung, S. F., Chan, L. Y., Chan, A. T., Lo, K. W., Johnson, P. J. & Huang, D. P. (2000) Cancer Res. 60, 2351–2355.[Abstract/Free Full Text]
  14. Lo, Y. M., Chan, A. T., Chan, L. Y., Leung, S. F., Lam, C. W., Huang, D. P. & Johnson, P. J. (2000) Cancer Res. 60, 6878–6881.[Abstract/Free Full Text]
  15. Lo, Y. M. (2001) Biomed. Pharmacother. 55, 362–365.[CrossRef][Medline]
  16. Chan, A. T., Lo, Y. M., Zee, B., Chan, L. Y., Ma, B. B., Leung, S. F., Mo, F., Lai, M., Ho, S., Huang, D. P., et al. (2002) J. Natl. Cancer Inst. 94, 1614–1619.[Abstract/Free Full Text]
  17. Capone, R. B., Pai, S. I., Koch, W. M., Gillison, M. L., Danish, H. N., Westra, W. H., Daniel, R., Shah, K. V. & Sidransky, D. (2000) Clin. Cancer Res. 6, 4171–4175.[Abstract/Free Full Text]
  18. Forastiere, A., Koch, W., Trotti, A. & Sidransky, D. (2001) N. Engl. J. Med. 345, 1890–1900.[Free Full Text]
  19. Dong, S. M., Pai, S. I., Rha, S. H., Hildesheim, A., Kurman, R. J., Schwartz, P. E., Mortel, R., McGowan, L., Greenberg, M. D., Barnes, W. A., et al. (2002) Cancer Epidemiol. Biomarkers Prev. 11, 3–6.[Abstract/Free Full Text]
  20. Usadel, H., Brabender, J., Danenberg, K. D., Jeronimo, C., Harden, S., Engles, J., Danenberg, P. V., Yang, S. & Sidransky, D. (2002) Cancer Res. 62, 371–375.[Abstract/Free Full Text]
  21. Ha, P. K., Pai, S. I., Westra, W. H., Gillison, M. L., Tong, B. C., Sidransky, D. & Califano, J. A. (2002) Clin. Cancer Res. 8, 1203–1209.[Abstract/Free Full Text]
  22. Thompson, G. H. & Roman, A. (1987) Gene 56, 289–295.[CrossRef][Medline]
  23. de Roda Husman, A. M., Walboomers, J. M., van den Brule, A. J., Meijer, C. J. & Snijders, P. J. (1995) J. Gen. Virol. 76, 1057–1062.[Abstract/Free Full Text]
  24. Nelson, J. H., Hawkins, G. A., Edlund, K., Evander, M., Kjellberg, L., Wadell, G., Dillner, J., Gerasimova, T., Coker, A. L., Pirisi, L., et al. (2000) J. Clin. Microbiol. 38, 688–695.[Abstract/Free Full Text]
  25. Heid, C. A., Stevens, J., Livak, K. J. & Williams, P. M. (1996) Genome Res., 6, 986–994.[Abstract/Free Full Text]
  26. Ding, C. & Cantor, C. R. (2003) Proc. Natl. Acad. Sci. USA 100, 3059–3064.[Abstract/Free Full Text]
  27. Tang, K., Oeth, P., Kammerer, S., Denissenko, M. F., Ekblom, J., Jurinke, C., van den Boom, D., Braun, A. & Cantor, C. R. (2004) J. Proteome Res. 3, 218–227.[CrossRef][ISI][Medline]
  28. Chang, J. Y., Lin, M. C. & Chiang, C. P. (2003) Am. J. Clin. Pathol. 120, 909–916.[Medline]
  29. Neville, B. W. & Day, T. A. (2002) CA Cancer J. Clin. 52, 195–215.[Abstract/Free Full Text]
  30. Herrero, R., Castellsague, X., Pawlita, M., Lissowska, J., Kee, F., Balaram, P., Rajkumar, T., Sridhar, H., Rose, B., Pintos, J., et al. (2003) J. Natl. Cancer Inst. 95, 1772–1783.[Abstract/Free Full Text]
  31. Schwartz, S. R., Yueh, B., McDougall, J. K., Daling, J. R. & Schwartz, S. M. (2001) Otolaryngol. Head Neck Surg. 125, 1–9.[CrossRef][ISI][Medline]
  32. Koch, W. M., Lango, M., Sewell, D., Zahurak, M. & Sidransky, D. (1999) Laryngoscope 109, 1544–1551.[CrossRef][ISI][Medline]
  33. Schwartz, S. M., Daling, J. R., Doody, D. R., Wipf, G. C., Carter, J. J., Madeleine, M. M., Mao, E. J., Fitzgibbons, E. D., Huang, S., Beckmann, A. M., et al. (1998) J. Natl. Cancer Inst. 90, 1626–1636.[Abstract/Free Full Text]
  34. Burd, E. M. (2003) Clin. Microbiol. Rev. 16, 1–17.[Abstract/Free Full Text]
  35. Poljak, M., Marin, I. J., Seme, K. & Vince, A. (2002) J. Clin. Virol. 25, S89–S97.
  36. Koutsky, L. A., Ault, K. A., Wheeler, C. M., Brown, D. R., Barr, E., Alvarez, F. B., Chiacchierini, L. M. & Jansen, K. U. (2002) N. Engl. J. Med. 347, 1645–1651.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg    What's this?


This article has been cited by other articles in HighWire Press-hosted journals:


Home page
 J. Clin. Microbiol.Home page
M. I. L. Sjoholm, J. Dillner, and J. Carlson
Multiplex Detection of Human Herpesviruses from Archival Specimens by Using Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry
J. Clin. Microbiol., February 1, 2008; 46(2): 540 - 545.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
S. Begum, M. L. Gillison, T. L. Nicol, and W. H. Westra
Detection of Human Papillomavirus-16 in Fine-Needle Aspirates to Determine Tumor Origin in Patients with Metastatic Squamous Cell Carcinoma of the Head and Neck
Clin. Cancer Res., February 15, 2007; 13(4): 1186 - 1191.
[Abstract] [Full Text] [PDF]

Home page
 Ann. N. Y. Acad. Sci.Home page
C. DING and Y. M. D. LO
MALDI-TOF Mass Spectrometry for Quantitative, Specific, and Sensitive Analysis of DNA and RNA.
Ann. N.Y. Acad. Sci., September 1, 2006; 1075: 282 - 287.
[Abstract] [Full Text] [PDF]

This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrow Supporting Tables
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My File Cabinet
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, H.
Right arrow Articles by Kurnit, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, H.
Right arrow Articles by Kurnit, D. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg  
What's this?