Identification of STAT3 as a substrate of receptor protein tyrosine phosphatase T

  1. Xiaodong Zhang*,
  2. Ailan Guo,
  3. Jianshi Yu*,
  4. Anthony Possemato,
  5. Yueting Chen*,
  6. Weiping Zheng,
  7. Roberto D. Polakiewicz,
  8. Kenneth W. Kinzler§,
  9. Bert Vogelstein§,,
  10. Victor E. Velculescu§, and
  11. Zhenghe John Wang*,,
  1. *Department of Genetics and Case Comprehensive Cancer Center, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106;
  2. Cell Signaling Technology Inc., 3 Trask Lane, Danvers, MA 01923;
  3. Department of Chemistry, University of Akron, 190 East Buchtel Commons, Akron, OH 44325;
  4. §Ludwig Center for Cancer Genetics and Therapeutics, The Johns Hopkins Kimmel Cancer Center and Howard Hughes Medical Institute, 1650 Orleans Street, Baltimore, MD 21231; and
  5. Genomic Medicine Institute, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195
  1. Contributed by Bert Vogelstein, December 29, 2006 (received for review November 15, 2006)

Abstract

Protein tyrosine phosphatase (PTP) receptor T (PTPRT) is the most frequently mutated PTP in human cancers. However, the cell signaling pathways regulated by PTPRT have not yet been elucidated. Here, we report identification of signal transducer and activator of transcription 3 (STAT3) as a substrate of PTPRT. Phosphorylation of a tyrosine at amino acid Y705 is essential for the function of STAT3, and PTPRT specifically dephosphorylated STAT3 at this position. Accordingly, overexpression of normal PTPRT in colorectal cancer cells reduced the expression of STAT3 target genes. These studies illuminate a mechanism regulating the STAT3 pathway and suggest that this signaling pathway plays an important role in colorectal tumorigenesis.

Tyrosine phosphorylation is coordinately controlled by protein tyrosine kinases and protein tyrosine phosphatases (PTPs) and is a central feature of many signaling pathways involved in tumor development (1). While activating mutations in protein tyrosine kinases have been shown to play vital roles in tumorigenesis, the role of PTPs is less well defined. We recently identified PTP receptor T (PTPRT), also known as PTPρ, as the most frequently mutated PTP gene in colorectal cancers (CRCs) (2). PTPRT was also mutationally altered in lung and gastric cancers (2). The spectrum of mutations, which included nonsense mutations and frameshift changes, suggested that these alterations were inactivating. Biochemical analyses demonstrated that missense mutations in the catalytic domains of PTPRT diminished its phosphatase activity and overexpression of PTPRT inhibited CRC cell growth (2). Taken together, these studies strongly support the notion that PTPRT normally acts as a tumor suppressor gene. This conclusion was buttressed by a transposon-based somatic mutagenesis screen in mice, wherein PTPRT was isolated as a target gene from two different mouse transgenic sarcomas (3). In light of these data, it is important to understand the mechanisms through which PTPRT is involved in the neoplastic process. Identifying substrates of PTPRT is an important step to elucidating the signal transduction pathways regulated by this phosphatase. Here, we report identification of signal transducer and activator of transcription 3 (STAT3) as a substrate of PTPRT.

STAT3 has been shown to play an important role in leukemias, and persistent STAT3 activation has been detected in a variety of hematopoietic malignancies and solid tumors (46), including CRCs (7, 8). In general, latent cytoplasmic STAT3 becomes activated through phosphorylation of amino acid residue Y705 by cytokine receptor-associated kinase (Jak) or growth factor receptor-associated tyrosine kinase (Src) (6). Phosphorylated STAT3 dimerizes through reciprocal Src homology 2–phosphotyrosine interaction and accumulates in the nucleus (6). STAT3 then activates the transcription of a wide array of genes, including Bcl-XL and SOCS3 (4). In the current study, we demonstrate that PTPRT specifically dephosphorylates Y705 residue of STAT3 and regulates its target gene expression and its cellular localization in CRC cells.

Results and Discussion

STAT3 Is a Substrate of PTPRT.

To identify potential substrates of PPTRT, we generated two ecdysone-inducible HEK293T cell lines: one expressing the intracellular part containing the two phosphatase domains of PTPRT and the other expressing the extracellular portion of the protein. We used the proteomic approach developed by Rush et al. (9) to globally profile tyrosine phosphopeptides in the two cell lines and parental HEK293T cells (see Materials and Methods). Phosphopeptides derived from five different proteins were present in parental HEK293T cells and cells expressing the extracellular portion of PTPRT but not in cells expressing the intracellular portion. We chose STAT3 of the five candidate substrates for further study, because STAT3 was known to be involved in tumorigenesis.

Importantly, the phosphorylation site identified in our proteomic profiling was Y705, the residue known to be critical for activation of STAT3 signal transduction. To confirm that PTPRT regulates phosphorylation of Y705, lysates from the inducible cell lines were probed with antibodies specific for the phosphorlyated form of Y705. As shown in Fig. 1 A, STAT3 phosphorylation was reduced ≈5-fold by induction of the phosphatase domain PTPRT but was unaffected by induction of the extracellular domain. Expression of full-length PTPRT also led to STAT3 dephosphorylation of Y705 in HEK293T cells (Fig. 1 B). To test whether PTPRT regulates STAT3 phosphorylation under physiological conditions, we knocked down PTPRT expression by ≈80% in MCF-7 cells by using siRNA specifically against PTPRT. As shown in Fig. 1 C, STAT3 phosphorylation increased ≈3-fold in cells transfected with PTPRT siRNA compared with cells transfected with a scrambled siRNA control.

Fig. 1.

STAT3 is a substrate of PTPRT. (A) Cell lysates from inducible cell lines expressing either the intracellular (Intra) or extracellular fragment (Extra) of PTPRT were probed with antibodies specific for pY705 of STAT3. The same membrane was stripped and probed with anti-STAT3 antibodies or anti-FLAG tag antibodies to detect PTPRT protein fragments. I and U indicate cells with and without induction of PTPRT, respectively. (B) HEK293T cells were infected with adenoviruses expressing either full-length PTPRT or GFP (control) for 24 h. Cell lysates were probed with antibodies to pSTAT3 or STAT3. (C) MCF-7 cells were transfected with siRNA against PTPRT or control siRNA. Expression of PTPRT GAPDH was determined by RT-PCR. STAT3 and pSTAT3 protein levels were determined by Western blots. (D) HCT116 cells were infected with adenoviruses expressing PTPRT or GFP and starved for 24 h and then stimulated with IL-6 for the indicated time. (E) Western blots were performed with the same cell lysates using antibodies to pSTAT5 or STAT5. (F–I) The indicated CRC cell lines were starved for 24 h then stimulated with IL-6 for various time periods. Western blot was performed with pSTAT3 and STAT3 antibodies.


Although the initiators of STAT3 signal transduction in some cell types, particularly of hematopoietic lineage, are well known, STAT3 transduction has not been studied in depth in colorectal epithelial cells. In particular, ligands that trigger STAT3 activation in such cells were not known. To address this issue, we used the CRC cell line HCT116 to assess the effects of cytokines and growth factors that were known to induce STAT3 activation in other cell types (see Materials and Methods). Among the factors examined, the only one that activated STAT3 was IL-6. Because IL-6 plays a direct role in promoting the growth of CRC cells (10, 11), it was important to determine whether PTPRT regulates STAT3 activation in CRC cells stimulated with IL-6. As shown in Fig. 1 D, expression of PTPRT reduced STAT3 activation by ≈3-, 8-, and 10-fold that of GFP controls after 60, 120, and 180 min of IL-6 stimulation, respectively. Note that only the phosphorylation status of STAT3, not its total levels, was affected by PTPRT, thereby excluding protein degradation as a cause of these effects. Other controls were provided by STAT1 and STAT5. No STAT1 protein could be detected in these cells, with or without exposure to IL-6, and STAT5 phosphorylation was not altered by IL-6 or PTPRT (Fig. 1 E). The activation of STAT3 by IL-6 was not confined to HCT116, as three additional CRC cell lines each showed dramatic induction of phosphorlyated STAT3 by IL-6 without any change in the level of total STAT3 proteins (Fig. 1 F–I).

STAT3 Is a Direct Substrate of PTPRT.

We have demonstrated unambiguously that PTPRT regulates STAT3 phosphorylation, but did not prove that the dephosphorylation was directly mediated by PTPRT rather than through another phosphatase downstream of PTRPT. To address this point, we used a substrate-trapping assay modified from that described for investigation of an unrelated phosphatase (PTP1B) (12). Three GST fusion proteins were constructed for this purpose. All contained both phosphatase domains of PTPRT, but two of them (TRAP-1 and TRAP-2) contained mutations predicted to result in substrate trapping (D1074A in TRAP-1 and C1106S and D1074A in TRAP-2). The recombinant GST fusion proteins were expressed in Escherichia coli, and equal amounts of each were attached to beads (Fig. 2 A). The beads were then incubated with cell lysates from SW480 CRC cells. The phosphorylated form of STAT3 was specifically bound by the two substrate trapping mutants but not by the WT or control GST proteins. In contrast, STAT5 was not bound by the substrate trapping mutants (Fig. 2 B). Similar results were also observed with cell lysates from HEK293T cells and HT29 CRC cells (Fig. 2 C). Furthermore, to test whether PTPRT directly dephosphorylates pSTAT3 in vitro, we incubated pSTAT3 that immunoprecipitated from HEK293T cells as phosphatase substrates with equal amounts of WT, TRAP-2 mutant, or GST proteins with or without phosphatase inhibitor Na3VO4. STAT3 was dephosphorylated by WT but not the phosphatase dead mutant (TRAP-2) or GST alone (Fig. 2 D). This activity was also inhibited by Na3VO4, indicating that it was phosphatase dependent (Fig. 2 D).

Fig. 2.

STAT3 is a direct substrate of PTPRT. (A) Coomassie-stained gels of GST fusion proteins eluted from the indicated beads before their incubation with cell lysates. The arrow indicates the fusion proteins. (B) SW480 cell lysates were incubated with beads bound to the indicated GST-fusion proteins. Proteins bound to the beads were resolved by 10% SDS/PAGE, and Western blots were performed with the indicated antibodies. (C) Lysates from the indicated lines were incubated with beads as in B. (D) pSTAT3 proteins were immunoprecipitated from lysate of HEK293 cells pretreated with 50 μM pervanadate. The immunocomplexes were incubated with 1 μg of the indicated recombinant proteins with or without Na3VO4. Western blots were performed to quantitate pSTAT3.


PTPRT Regulates STAT3 Activity.

Phosphorylated STAT3 is thought to translocate to the nucleus and activate transcription of its target genes, including Bcl-XL and SOCS3 (4). To determine whether dephosphorylation of STAT3 by PTPRT affects expression of such target genes, CRC cells were exposed to IL-6 and then treated with the PTPRT adenovirus. As shown in Fig. 3 A, Bcl-XL and SOCS3 protein expression was induced by IL-6 in HCT116 CRC cells, as predicted. Moreover, their expression levels were down-regulated >4-fold by PTPRT.

Fig. 3.

Regulation of STAT3 activity by PTPRT. (A) HCT116 cells were infected with adenoviruses expressing PTPRT or GFP, starved for 24 h, and then stimulated with IL-6. Lysates were used in Western blots to assess the levels of the indicated proteins. (B) Schematic diagram of PTPRT deletion constructs. (C and D) HCT116 cells were infected with the indicated adenoviruses, starved for 24 h, and then stimulated with IL-6. Western blots were performed to detect the indicated proteins.


PTPRT consists of an extracelluar domain, a juxtamembrane region, and two phosphatase domains called D1 and D2 (Fig. 3 B). To determine which of the phosphatase domains is required for STAT3 dephosphorylation, adenoviruses expressing PTPRT devoid of the second domain (Del D2) or devoid of both domains (Del D1D2) were generated (Fig. 3 B). Each of these PTPRT proteins contained a V5 epitope tag at its C terminus to allow comparison of PTPRT expression levels after infection of HCT116 CRC cells. Expression of the WT PTPRT led to a substantial reduction of phosphoryation of pSTAT3 (Fig. 3 C) and an equivalent reduction of expression of the STAT3 targets Bcl-XL and SOCS3 (Fig. 3 D). It is generally believed that the second phosphatase domains (D2) of receptor PTPs do not have functionally significant phosphatase activity (13). However, the results in Fig. 3 C and D show that deletion of D2 was associated with a decrease of PTPRT activity compared with WT. This reduction could result from either the loss of an intrinsic enzymatic activity of D2, the disruption of the functional communication between D2 and D1 (14, 15), or a perturbation of the structure of the PTPRT protein upon deletion of its D2 domain.

PTPRT Regulates STAT3 Cellular Localization.

Phosphosphorylated STAT3 is known to dimerize and translocate from the cytoplasm to the nucleus before binding to the promoter of its target genes. To examine the effect of PTPRT on the subcellular localization of STAT3, we examined the cells described in the above experiment with immunofluorescence. Note that the adenoviruses used for these experiments were constructed with the AdEasy system (16), so each coexpressed GFP, allowing distinction between infected and noninfected cells. STAT3 proteins translocated into nuclei after IL-6 stimulation in cells infected with the control GFP virus (Fig. 4). However, STAT3 staining remained diffuse, throughout the cytoplasm, after expression of WT PTPRT, whether or not the cells were treated with IL-6. In contrast, there was no effect on STAT3 translocation after IL-6 stimulation in cells expressing the PTPRT devoid of both its phosphatase domains (Fig. 4).

Fig. 4.

PTPRT regulates STAT3 cellular localization. HCT116 cells were infected with adenoviruses expressing GFP or the indicated forms of PTPRT. Virus-infected cells were starved for 24 h and then stimulated with or without IL-6 for 30 min. Immunofluorescent staining was performed to detect STAT3 protein. DAPI was used to stain nuclei, and GFP served as a marker of adenovirus-infected cells.


Regulation of Y705 phosphorylation is critical for STAT3 activation (6). Although the kinases that phosphorylate Y705 of STAT3 have been studied extensively, the phosphatases that dephosphorylate this critical residue have not been clearly defined. It has been reported that the T cell PTP (TC-PTP) can regulate STAT3 phosphorylation (17), but it was not clear whether TC-PTP specifically dephosphorylates the pY705 residue. Most recently, the low molecular weight-dual specificity phosphatase (LMW-DSP2) has been shown to regulate Y705 phosphorylation of STAT3 (18). However, no evidence indicates that STAT3 is a direct substrate of LMW-DSP2. Furthermore, neither of the two previously studied phosphatases plays a role in epithelial cell growth. From the results of the current study, it is clear not only that STAT3 is a direct substrate of PTPRT but also that PTPRT specifically regulates Y705 phosphorylation of STAT3, the ability of STAT3 to transcriptionally activate its target genes and the subcellular localization of STAT3.

How a membrane-localized PTPRT gains access and dephosphorylates STAT3 is an interesting question raised by this study. We propose that PTPRT dephosphorylates pSTAT3 through three possible mechanisms. One is that dephosphorylation of pSTAT3 by PTPRT occurs at the time when STAT3 is activated by receptor-associated kinases, such as Jaks and SRC. The second is that PTPRT dephosphorylates the pSTAT3 pool by taking advantage of the STAT3 shuttling mechanism. A recent study has indicated that STAT3 constitutively shuttles between the cytoplasm and nucleus (19). Finally, PTPRT, like the notch proteins (20), could be cleaved by a protease after activation and the intracellular portion containing the phosphatase domains could translocate into nucleus and dephosphorylate STAT3. Further study is needed to define the mechanism through which PTPRT gains access to pSTAT3.

In summary, our data suggest that the STAT3 pathway may play an important role in the growth of CRC cells. Moreover, our results have obvious therapeutic implications, as one could imagine inhibiting CRC growth through inhibition of STAT3 tyrosine phosphorylation. Finally, the proteomic approach described in this study may be applicable to the identification of substrates of other PTPs.

Materials and Methods

Cell Lines.

HCT116, SW480, HT29, DLD1, MCF-7, and HEK 293T cells were obtained from the American Type Culture Collection (Manassas, VA). CRC cells were maintained in McCoy 5A media plus 10% FBS. HEK293T and MCF-7 cells were maintained in DMEM media plus 10% FBS.

Establishment of Cell Lines Stably Expressing PTPRT Fragments.

The DNA sequences encoding the extracellular or intracellular fragment of PTPRT (see Results) were cloned into the mammalian expression vector pMZI such that each polypeptide carried a tandem tag consisting of a calmodulin binding peptide and three consecutive FLAG tags at its C terminus (21). The pMZI plasmid was a kind gift of J. Greenblatt (University of Toronto, Toronto, ON, Canada). The pVgRXR plasmid was used to express the ecdysone receptor. HEK 93T cells were cotransfected with pVgRxR and pMZI plasmid at a 1:1 ratio and selected in the presence of 0.4 mg/ml of geneticin and 0.2 mg/ml of zeocin. To induce expression of PTPRT, the cell lines were treated with 3 μM ponasterone A for 15 h and PTPRT expression was assessed via Western blotting using an anti-FLAG antibody. Individual clones expressing equivalent amounts of PTPRT polypeptides were chosen for further analysis (Fig. 1 A).

Profiling pY Peptides.

Cell lines were treated with 3 μM ponasterone A for 15 h and lysates were prepared under denaturing conditions in the presence of phosphatase inhibitors [20 mM Hepes (pH 8.0), 9 M urea, 1 mM sodium vanadate]. After trypic digestion, peptides were concentrated and partitioned into three fractions by reversed-phase solid-phase extraction. The phosphopeptides from each fraction were bound to agarose beads conjugated with the phosphotyrosine-specific antibody pTyr-100. After thorough washing, peptides were eluted from the immobilized antibody with dilute acid and analyzed by nanoflow liquid chromatography–tandem MS with an ion trap mass spectrometer. Lists of credible phosphopeptide sequence assignments were assembled. Peptides from five proteins were found to be present in parental HEK293T cells expressing the extracellular part of PTPRT but not in cells expressing the intracellular, enzymatically active part. The five proteins and corresponding peptides were: STAT3 (YCRPESQEHPEADPGAAPyLK), Claspin (ESALNLPyHMPENK), Paxillin (FIHQQPQSSSPVyGSSAK), Vimentin (SLyASSPGGVYATR), and LOC439965 (HNVyIHVESK).

Adenoviruses.

Viruses expressing WT or deleted forms of PTPRT were constructed by using the AdEasy system (16). In brief, a fragment containing a human PTPRT cDNA was fused in-frame with a C-terminal V5 tag in the pcDNA3.1/V5-His vector. After recombination with the pAdEasy-1 vector, high-titer viruses were generated in 293 T cells. Viruses were purified by CsCl2 gradient centrifugation at 32,000 rpm (SW41 rotor; Thermo Scientific, Waltham, MA), and titers were assayed through measurement of the number of GFP-positive cells after infection of HEK293 cells.

Stimulation of CRC Cells with Growth Factors and Cytokines.

HCT116 cells were starved for 15 h and stimulated with either IL-6 (10 ng/ml), EGF (200 ng/ml), VEGF (10 ng/ml), and PDGF (10 ng/ml) for 10, 30, or 60 min. Western blots were performed to detect pSTAT3.

Western Blot Analysis.

Cells were lysed in RIPA buffer with complete protease inhibitor mixture and phosphatase inhibitors (50 mM Tris·HCl, pH 8.0/0.5% Triton X-100/0.25% sodium deoxycholate/150 mM sodium chloride/1 mM EDTA/1 mM sodium orthovnadate/50 mM NaF/80 μM β-glyerophosphate/20 mM sodium pyrophosphate). Western blots were performed essentially as described (22). Antibodies used included anti-FLAG antibody (M2; Sigma, St. Louis, MO); anti-pY705 STAT3 antibody, anti-STAT3 antibody, anti-pSTAT5 antibody and anti-STAT5 antibody (Cell Signaling Technology, Danvers, MA); anti-BCL-XL antibody and anti-SOCS3 antibody (Santa Cruz Biotechnology, Santa Cruz, CA).

Knockdown of PTPRT Expression by siRNA.

MCF-7 cells were transfected with 40 nM of siRNA against PTPRT (sense GGAGGAGCGACUUCAGAAGUCACGG and antisense CCGUGACUUCUGAAGUCGCUCCUCCUU) by using the Lipofectamine RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA). Knockdown of PTPRT expression was examined by RT-PCR with primers 5′-TCCGGTACATGGCCCACAGAACGTG-3′ and 5′-GCCTTGTAGTTGATCTCGTAGAGCGTG-3′. The transfected cells were serum-starved overnight 24 h posttransfection and then treated with IL-6 for 2 h. Cell lysates were made as described above.

Construction, Expression, and Purification of GST Recombinant Proteins.

The DNA fragment coding for the two phosphatase domains of PTPRT was cloned in-frame with GST into pGEX6p-1 plasmid. Substrate trapping mutants, D1074A or C1106S and D1074A doubt mutant, were made by site-directed mutagenesis as described (2). The WT and substrate trap mutants of PTPRT were expressed in E. coli BL21(DE3) cells. Cells were grown to an A 600 = 0.7 and induced with 1 mM isopropyl 1-thio-β-d-galactopyranoside at 37°C for 1 h. The harvested cell pellet was lysed in resuspension buffer (0.1 M NaCl/10 mM Tris·HCl, pH 8.0/1 mM EDTA/1% Triton X-100/1 mM PMSF/1 mM DTT/1× Complete protease inhibitor mixture) and sonicated. GST fusion proteins were isolated from the cleared supernatant by using glutathione Sepharose 4B beads.

Phosphatase Substrate Trapping Assay.

Substrate trapping was performed as described (12) and modified as follows. Ten million cells were treated with 100 μM pervanadate for 30 min and collected by centrifugation. The cell pellet was lysed with 1 ml of lysis buffer (25 mM Hepes, pH 7.4/150 mM NaCl/1% Nonidet P-40/1× Complete protease inhibitor mixture/1 mM EDTA/1 mM Benzmidine), treated with 5 mM iodoacetic acid on ice for 5 min, neutralized by addition of 10 mM DTT for 15 min, and subjected to centrifugation at 16,000 × g for 30 min to remove debris. GST-PTPRT bound beads were incubated with this lysate at 4°C for 1 h. The beads were pelleted and washed three times for 5 min with lysis buffer supplemented with 1 mM DTT. The beads were then boiled and aliquots analyzed by SDS/PAGE and Western blotting.

In Vitro Phosphatase Assay.

HEK293T cells overexpressing FLAG-tagged STAT3 proteins were treated with 50 μM pervanadate for 30 min and lysed in RIPA buffer. STAT3 proteins were immunoprecipitated with anti-FLAG antibody-conjugated agarose beads. The immune complexes were washed twice in wash buffer (150 mM NaCl/50 mM Tris·HCl pH 7.4/5 mM EDTA/1% Nonidet P-40) with the phosphatase inhibitors (10 mM NaF and 2 mM Na3VO4), twice in the same buffer without the phosphatase inhibitors, once in ST buffer (150 mM NaCl/50 mM Tris·HCl pH 7.4) and once in phosphatase assay buffer (150 mM NaCl/50 mM Tris·HCl/5 mM DTT). STAT3 immunocomplexes were then incubated with equal amounts of either GST alone, GST-PTPRT, or the TRAP-2 mutant in the absence or presence of 10 mM Na3VO4 at 37°C for 45 min. Western blots were performed to quantitate pSTAT3.

Immunofluorescent Staining.

HCT116 cells were seeded on glass coverslips and grown to 50% confluence. Cells were then infected with virus for 6 h and serum-starved for 18 h. A subset of virus-infected cells was treated with 10 ng/ml of IL-6 for 30 min following fixation with 4% paraformaldehyde for 30 min at room temperature. The fixed cells were permeabilized with 0.2% Triton X-100 at room temperature for 5 min and then blocked with Image-iT FX signal enhancer (Invitrogen) at room temperature for 30 min. Immunofluorescent staining was performed with anti-STAT3 antibody (Santa Cruz Biotechnology) and the Alexa 594-conjugated anti-rabbit secondary antibody (Invitrogen). Nuclei were stained with DAPI (1 μg/ml) at room temperature for 20 min. Images were captured with a Nikon (Tokyo, Japan) fluorescence microscope.

Acknowledgments

We thank Drs. Sanford Markowitz, David Sedwick, Susann Brady-Kalnay, and George Stark for helpful discussions; David Sedwick for critical reading of the manuscript; and Jack Greenblatt for generous gifts of reagents. This work was supported by American Cancer Society Grant IRG-91-022 (to Z.J.W.), The Concern Foundation (Z.J.W.), The V Foundation (Z.J.W.), the Virginia and D.K. Ludwig Fund for Cancer Research, The Pew Charitable Trusts, and National Institutes of Health Grants CA121113, CA057345, and CA043460.

Footnotes

  • To whom correspondence may be addressed. E-mail: vogelbe{at}welch.jhu.edu or zhenghe.wang{at}case.edu
  • Author contributions: X.Z., R.D.P., K.W.K., B.V., V.E.V., and Z.J.W. designed research; X.Z., A.G., J.Y., A.P., Y.C., W.Z., and Z.J.W. performed research; and B.V., V.E.V., and Z.J.W. wrote the paper.

  • The authors declare no conflict of interest.

  • Abbreviations:
    PTP,
    protein tyrosine phosphatase;
    PTPRT,
    PTP receptor T;
    STAT3,
    signal transducer and activator of transcription 3;
    CRC,
    colorectal cancer.
  • Freely available online through the PNAS open access option.

References

« Previous | Next Article »Table of Contents
OPEN ACCESS ARTICLE