INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Many group I introns encode site-specific endonucleases that catalyze their efficient spread from intron-containing to intronless alleles of the same gene in genetic crosses (1-3). This process, termed intron "homing," has been observed for introns located in a variety of mitochondrial (mt) and chloroplast genes (4-7), in nuclear rRNA genes of the slime mold Physarum (8), and in protein genes of T-even phage (9). Homing is initiated by the intron-encoded endonuclease, which makes a staggered double-strand break at its target site within a recipient intronless allele, and is thought to then proceed by the double-strand-break repair pathway (10).

The evolutionary importance of intron homing to the spread of group I introns across species barriers has been unclear, as relatively few cases of the horizontal transfer of group I introns between identical genomic sites of nonmating organisms are documented (11-17). Most of these cases involve the same genome and species belonging to the same phylum, usually fungi (11-13). Two notable exceptions are the transfer of two group I introns between identical sites of rRNA genes located in the chloroplast of a Chlamydomonas-type green alga and the mitochondrion of an Acanthamoeba-like ameboid (15).

The only group I intron known from vascular plant mt genomes (which contain many group II introns) is also thought to have been acquired by homing-mediated horizontal transfer from a distantly related organism. This intron is present in the cox1 (cytochrome oxidase subunit 1) gene of the angiosperm Peperomia (16, 17) at the same location as related introns in the nonvascular plant Marchantia, the green alga Prototheca, the slime mold Dictyostelium, and several diverse fungi (see ref. 18 and references therein). This cox1 intron is thought to have been recently acquired by Peperomia, most likely from a fungal donor, based on (i) its singular presence in Peperomia among 25 genera of vascular plants examined, (ii) its closer phylogenetic relationship to fungal introns than to those of the green "plants" Marchantia and Prototheca, and (iii) the presence of exonic signatures of homing-mediated coconversion immediately downstream of the Peperomia intron (16, 17).

We now show that Peperomia is only the tip of a large iceberg: there has been an explosive and recent wave of horizontal transfers of this intron into cox1 genes of many different lineages of flowering plants. We surveyed over 300 diverse land plants and infer that, based on phylogenetic and molecular criteria, 32 separate transfers account for the intron's presence in 48 disparate genera of angiosperms. From this sampling, we estimate that the intron has been separately acquired over 1,000 times during angiosperm evolution.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Latin names and voucher information for the 341 species of land plants examined in this study are available at http://www.bio.indiana.edu/~palmerlab. Total cellular DNA was extracted by using a modified cetyltrimethylammonium bromide procedure (19) and further purified by banding in a CsCl/ethidium bromide gradient. Southern transfers used Immobilon nylon membranes (Millipore). Probes were prepared by random-priming using ³²P. Hybridizations were carried out at 60°C for 18 hr in 5× SSC, 50 mM Tris (pH 8.0), 0.1% SDS, 10 mM EDTA, and 2× Denhardt's solution. Filters were twice washed for 30 min at 60°C in 2× SSC/0.1% SDS.

All but the first 165 bp and the last 77 bp of the 1,590-bp cox1 coding sequence and the entirety of the gene's single, 953-1,008-bp intron were amplified from intron-containing taxa by using three pairs of primers: cox42F (GGATCTTCTCCACTAACCACAAA) and cox657R (GCGGGATCAGAAAAGGTTGTA), IP53 (GGAGGAGTTGATTTAGC) and IP56 (GAGCAATGTCTAGCCC), and INT1.2KF (AGCATGGCTAGCTTTCCTAGA) and cox1.6KR (AAGGCTGGAGGGCTTTGTAC). These primers amplified a 600-bp region of the 5' exon, a 1,650-bp region containing the entire intron and flanking exonic sequences, and a 950-bp region containing part of the intron and part of the 3' exon, respectively. For intron-lacking species, primer pairs cox42F/cox657R (600-bp product) and IP53/cox1.6KR (1,000-bp product) were used to amplify the same aggregate length of coding region as above. Annealing reactions were performed at 50-55°C by using 20-50 ng of total cellular DNA in a 10-µl reaction with 1 mM MgCl2 and 5% acetamide for 40 cycles with a 1-min extension time. Products were purified from agarose gels and cloned by using a TA cloning kit (Invitrogen). Nucleotide sequences were determined for both strands of (usually) a single clone of each species by using LiCor automated DNA sequencers.

Nucleotide sequences were initially aligned by using the program PILEUP (Genetics Computer Group, Madison, WI); alignments were then adjusted by eye and are available on request from J.D.P. Gaps were excluded from all phylogenetic analyses, as was the 3' exonic coconversion region. The global intron phylogenetic analyses were carried out by using PAUP*d56 (from D. L. Swofford, Smithsonian Institution, Washington, DC) on an 1,153-character alignment of the cox1 and related introns. Maximum-likelihood analysis used the HKY85 model with empirical base frequencies and an empirical transition/transversion ratio of 0.46. Seven random-addition heuristic searches yielded nine trees of equally low log likelihood, one of which is shown (these trees differ only within angiosperms). Bootstrapping involved 100 replicates, each with 1 random addition sequence. Parsimony analysis used all characters unordered and unweighted, steepest descent, tree bisection and resection, and 200 bootstrap replicates, each of one heuristic search with random taxon addition. Neighbor-joining analysis used Kimura two-parameter distances and 100 bootstrap replicates.

Angiosperm intron and organismal maximum-likelihood analyses were performed by using the F84 model in PHYLIP version 3.5 (from J. Felsenstein, University of Washington, Seattle) and FASTDNAML version 1.06 (20). Four different transition/transversion ratios (1.0, 1.5, 2.0, 2.5), empirical base frequencies, and two addition sequences under global swapping conditions were used during preliminary analyses. The ratio that produced the lowest log-likelihood tree for each data set was selected for further analyses by using multiple randomized addition sequences and global swapping of up to 28 branches at each step. Bootstrapping was performed with FASTDNAML using 100 random data sets, generated by SEQBOOT using the same swapping and sequence-addition conditions as described above.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Intron Distribution. Of 25 genera of vascular plants previously examined (16, 17), this intron was known to be present in the mt cox1 gene only in Peperomia. We were therefore surprised to encounter, in a comparative sequencing study of mutation-rate variation in plant mtDNA, an intron of highly similar length (966 vs. 953 bp) and sequence (92% identity) located at the same position within cox1 in the distantly related angiosperm Veronica. The highly disjunct distribution of these two introns suggested that they might have arisen by separate insertions and caused us to ask how frequently and how recently this intron had been acquired during plant evolution.

View larger version (93K): [in this window] [in a new window]   Fig. 1.   Southern-blot hybridizations showing presence or absence of two mt introns among 51 of the 341 land plants examined in this study. BamHI-cut DNAs were arranged according to presumptive phylogenetic relationship and hybridized with probes internal to the cox1 coding sequence from Beta vulgaris (Top), the single cox1 group I intron from Veronica ugrestis (Middle), and the single cox2 group II intron from Zea mays (Bottom). * indicates weak, non-cox1 hybridization in Brasenia schreberi (see text).

View larger version (29K): [in this window] [in a new window]   Fig. 2.   Sporadic distribution of the cox1 intron among 281 examined species of angiosperms. The cladogram is rooted on gymnosperms and is from a parsimony analysis (Y.-L.Q., unpublished results) of a 1,428-bp region of the chloroplast rbcL gene. The 48 taxa that hybridized strongly to the cox1 intron probe are shaded in color; the colors designate nine major groups of angiosperms (cf. Fig. 3C). Heavy branches mark the 30 monophyletic intron-containing clades (numbered 1-30) under an all-gain/no-loss model of intron evolution.  marks the 18 intron-hybridizing taxa whose cox1 genes were not sequenced (cf. Fig. 3). Names of the 19 taxa for which phylogenetic substitutes were used in the rbcL analyses are italicized (cf. Fig. 3C). * marks the 25 taxa for which rbcL sequences are not available and which were positioned based on other evidence. Mag, Magnoliales; Nym, Nymphaeales; Lau, Laurales; Pip, Piperales.

Discordant Intron and Organismal Phylogenies. To assess the relative contributions of horizontal and vertical genetic transmission to the intron's phylogenetic history, we sequenced the cox1 intron and coding region from 29 of the 48 hybridizing angiosperms, and compared phylogenies of the intron with those of the organisms in which it resides. These 29 introns, plus the Peperomia intron (16), are highly similar in length (953-1,008 bp) and sequence (92% identity) and are located at the same position within the cox1 gene. All 30 introns contain a 270-bp core region typical of group I introns (1-3) interrupted by and partially overlapping with a 834-bp ORF. The inferred protein from this ORF is about 52% identical over 229 residues with the yeast cox1 aI4 intronic protein, which encodes site-specific DNA endonuclease and RNA maturase activities (4, 5, 24).

View larger version (43K): [in this window] [in a new window]   Fig. 3.   Phylogenetic history of the cox1 intron. (A) Maximum-likelihood tree of the cox1 and all related introns. Bootstrap values for each node are shown in a column above and below the corresponding branch and are, from top to bottom, from neighbor-joining, parsimony, and likelihood analyses, respectively. Introns located at the same cox1 position as in this study are unmarked; introns at two other positions in cox1 are marked "x2" or "x3"; and an intron in the cob gene is marked with a "b." (B) Maximum-likelihood tree of 30 angiosperm cox1 introns. Numbers on the tree are bootstrap values. The four synapomorphic intron gaps (which were not used to build this tree) are marked by "I" or "D" (for insertion or deletion relative to the Peperomia intron) followed by the gap's length in bp. + signs on the tree mark 25 inferred gains of the intron among these 30 taxa. Color-coding is as in Fig. 3C. Numbers at right indicate number of 3'-flanking nucleotides changed by coconversion (see Fig. 4B). Bold branches mark four small clades of introns thought to have originated from the same intron gain event. (C) Organismal tree from a maximum-likelihood analysis of a combined data set of chloroplast rbcL and mt cox1 coding sequences, excluding the coconversion region (see Fig. 4). Numbers are bootstrap values. Color-coding is as described in the text. C, caryophyllids; Mono, monocots; Mag, Magnoliales; P, Piperales.

Coconversion-Tract Evidence for Multiple Intron Gains. Additional evidence, of two kinds, for many separate acquisitions of this intron comes from analysis of an exonic coconversion tract (Fig. 4). Group I intron homing is known in genetic crosses to lead to coconversion of recipient exonic sequences flanking the acquired intron by donor exonic sequences (1-3). An 18-bp region 3' to the intron is virtually unchanged in the 24 diverse intronless vascular plants whose sequences are shown in Fig. 4A, whereas 29 of the 30 intron-containing angiosperms show one or more variations in this region and 28 show three or more variations (Fig. 4B). Moreover, the variations all are identical at a given site and extend in a 3' gradient away from the intron insertion site. It thus appears that a short 3' tract of at least 3-18 bp has been coconverted in all but one of the intron-containing plants. Because the mutation rate in plant mtDNA is generally extremely low (ref. 21 and 22; Fig. 4A), because there is no apparent selective pressure for back-mutation (all six sites changed by coconversion are silent sites), and because there is no evidence for back-mutation (which would abolish the 3' coconversion gradient seen), the incidence of back-mutation at sites changed by coconversion must be very low. We therefore conclude that taxa such as Xanthosoma and Philodendron, whose coconversion tracts differ in length, most likely acquired their introns separately, despite the fact that their relationships in the intron (Fig. 3B) and organismal (Fig. 3C) trees are not significantly incongruent. By the same logic, the four different coconversion tract lengths observed among the six Rosidae I taxa imply at least four separate acquisition events within this group (Figs. 3B and 4B).

View larger version (56K): [in this window] [in a new window]   Fig. 4.   Coconversion of cox1 exonic sequences immediately 3' (boxed region) to the intron insertion site (marked "INT"). Dots indicate identity to the Zea reference sequence. Taxa are arranged in phylogenetic order, with the intron-containing angiosperms first grouped according to length of coconversion tract. Shaded columns indicate positions of C-to-U RNA editing (A. Shirk and J.D.P., unpublished results); editing sites are known to evolve rapidly (28). (A) Angiosperms lacking the intron. (B) Angiosperms containing the intron.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

We infer fully 25 separate intron gains to account for the presence of this intron among the 30 angiosperms whose cox1 introns have been sequenced. This inference rests on four lines of evidence: (i) many incongruencies between intron and organismal phylogenies (Fig. 3 B and C), (ii) the highly disjunct distribution of intron-containing plants in the rbcL phylogeny shown in Fig. 2, (iii) different lengths of coconversion among otherwise related introns (Figs. 3B and 4), and (iv) the existence of ancestrally intron-lacking taxa within families containing the intron. Furthermore, by criterion ii, we infer 7 additional gains among the 18 intron-containing taxa whose introns were not sequenced (Fig. 2). Remarkably, this total of 32 inferred intron gains actually exceeds the 30 gains postulated under an all-gain model based solely on the intron's distribution across the angiosperm phylogeny of Fig. 2. This discrepancy reflects the two pairs of intron-containing sister taxa in Fig. 2 which by either incongruence (Maranta and Hedychium; Fig. 3) or coconversion (Philodendron and Xanthosoma; Fig. 4) evidence acquired their introns separately.

Extrapolating from these 32 separate cases of inferred intron acquisition among the 278 genera and 281 species of angiosperms examined by Southern blots in this study, we estimate that this intron has invaded the cox1 gene over 1,000 times among the >13,500 genera and >300,000 species of extant angiosperms. Moreover, all of these events seem to be recent; many, possibly all, of the characterized gains have occurred within the evolution of a particular family of flowering plants. Consistent with these conclusions, more intensive study of a single family of flowering plants indicates 5 separate intron gains among the 6 taxa (of only 14 examined) found to contain the intron (30). Among mobile genetic elements of any type, this rampancy of lateral transfer seems to be approached only by the mariner transposable elements of insects and other animals (31-33), whereas such recently emergent and massive promiscuity seems without precedent.

The close relationships (Fig. 3A) of members of this family of extraordinarily invasive introns, together with their identical (in sequence, irrespective of length) tracts of 3' coconversion (Fig. 4B), suggest two opposing models for the history of horizontal transmission of the intron. Many or all of the donors of the intron might have been a nonplant (perhaps a fungus; Fig. 5A), in which case the donors themselves must all be closely related. Alternatively, a single or a few fungal donations might have been followed by hundreds or thousands of recent plant-to-plant lateral transfers (Fig. 5C).

View larger version (30K): [in this window] [in a new window]   Fig. 5.   Two extreme models for the pathway of cox1 intron transfer in plants and nonplants. (A) An all nonplant-to-plant transfer model. Left cladogram shows six donor organisms, all nonplants (F1-6). Arrows show donor-recipient relationships for six separate intron transfers to plants (P1-10 in Right cladogram). (B) Intron phylogeny based on the transfers diagrammed in A, showing phylogenetic interspersion of donor (F) and recipient (P) sequences. (C) An all-plant-to-plant transfer model. A single initiating transfer from the nonplant F3 lineage to plants is shown, followed by five successive plant-to-plant transfers. (D) Intron phylogeny based on C, showing a clade of 10 plant introns whose phylogeny is incongruent with that of the same plants in C. Branch lengths in these cladograms are not proportional to time.

These two models make testably distinct phylogenetic predictions on further sampling of the intron in plants and nonplants. The all-nonplant-to-plant model (Fig. 5A) predicts the existence of a clade of closely related intron-containing nonplants, various members of which are sister taxa in intron phylogenetic analyses to each clade of plants that has separately acquired the intron. That is, the plant introns would be phylogenetically interspersed with the donor introns (Fig. 5B). By contrast, the extreme form of the plant-to-plant model (one nonplant transfer, the rest all plant-to-plant; Fig. 5C) predicts a phylogenetic hierarchy of plant cox1 introns in which only one clade of plant introns (P6 in Fig. 5D) derives directly from nonplant-to-plant transfer, with all subsequent recipient introns nested within it (Fig. 5D), regardless of the true phylogeny of the host plants (Fig. 5C). Each subsequent plant-to-plant transfer will thus appear as a further nested hierarchy of paraphyletic donor introns from which emerges an organismally unrelated group of recipient introns (e.g., note nesting of P8 within the P1-P4 intron clade in Fig. 5D). Unfortunately, correct deciphering of donor-recipient identities for even a single case of horizontal transfer will in essence require working out the phylogeny of this intron across the >1,000 lineages of angiosperms estimated to have separately acquired it, or else otherwise potential bridging taxa will be missed. This makes determining the timing of transfer and any biogeographic, ecological, or phylogenetic determinants of donor-recipient relationships a daunting task. Nonetheless, an answer to the basic question of whether there are few or many plant-to-plant transfers should emerge with relatively modest but judicious further sampling of angiosperms.

The intron phylogeny in Fig. 3B reveals one case of apparent plant-to-plant transfer; however, this collapses under closer scrutiny. This case involves a strongly supported (100% bootstrap support) clade of five introns (from Clerodendron through Vinca) whose members all have the same coconversion tract length. The two basal members of this cladeVinca and Neriumboth belong to the Apocynaceae. Their introns have precisely the paraphyletic relationship with respect to the other three introns in this clade (each of which belongs to a different other family of plants) that is expected if the Apocynaceae had first acquired its intron by a single ancestral gain and then donated its cox1 intron to each of the other three families. This scenario collapses because Carissa, an apocynaceous genus that is more closely related to Nerium than either is to Vinca (Fig. 2), both lacks the intron and, based on the absence of any coconconversion signatures (Fig. 4A), never possessed it. For this reason, Nerium and Vinca are inferred to have acquired their introns by separate events (Fig. 3B).

If transmission has been largely plant-to-plant, then exchange of genes between disparate plants may, at least on an evolutionary time scale, be more prevalent than is generally recognized. However, whether these exchanges occur so frequently as to be relevant to present concerns over the likelihood of genetically engineered crop genes spreading laterally to wild plants is unclear and will require extensive survey at lower taxonomic levels than studied herein. In any event, the exquisitely powerful homing mechanism of group I introns (see Introduction and refs. 1-9), together with their protection from genomic deletional forces (as opposed to cDNA- or RNA-mediated forces) by being sheltered within genes, makes them in many ways the perfect molecular parasites and thus perhaps the most sensitive monitors of gene flow across breeding barriers.

Regardless of the historical pathways of intron transfers, vectoring agents are probably involved (e.g., viruses, bacteria, aphids, mycorrhizal fungi, etc.). These could ferry this intron either as transiently ingested DNA or in a genetically integrated form. It is thought that a semiparasitic mite may act as a vector for P-element transposons across species boundaries of drosophilid flies (34).

The recency of this massive wave of intron gains is striking. Does it reflect the recent emergence of a widely promiscuous donor or vectoring agent, the former fortuitously containing the intron in its mt cox1 gene? Or perhaps key is some recently evolved special property of a particular clade of introns? Such properties could include an extremely active homing endonuclease, splicing that is either unusually independent of host factors or else dependent on ones that are highly conserved and ubiquitious (in either case, enabling the intron to spread readily without regard to host), or perhaps unusually short coconversion, yielding intron insertions that are silent with respect to COX1 function. This last possibility is attractive given that the coconversion tracts observed here are in fact much shorter than those typically observed in group I intron homing (refs. 35 and 36, and references therein).