Previous Article |
Table of Contents
| Next Article 
Vol. 96, Issue 14, 7803-7808, July 6, 1999
Department of Microbiology, North Carolina State University,
Raleigh, NC 27695
Communicated by Norman R. Pace, University of California, Berkeley,
CA, May 21, 1999 (received for review January 23, 1999)
The RNA subunits of RNase Ps of Archaea and eukaryotes have been
thought to depend fundamentally on protein for activity, unlike those
of Bacteria that are capable of efficient catalysis in the absence of
protein. Although the eukaryotic RNase P RNAs are quite different than
those of Bacteria in both sequence and structure, the archaeal RNAs
generally contain the sequences and structures of the bacterial,
phylogenetically conserved catalytic core. A spectrum of archaeal RNase
P RNAs were therefore tested for activity in a wide range of
conditions. Many remain inactive in ionically extreme conditions, but
catalytic activity could be detected from those of the methanobacteria,
thermococci, and halobacteria. Chimeric holoenzymes, reconstituted from
the Methanobacterium RNase P RNA and the Bacillus
subtilis RNase P protein subunits, were functional at low ionic
strength. The properties of the archaeal RNase P RNAs (high
ionic-strength requirement, low affinity for substrate, and catalytic
reconstitution by bacterial RNase P protein) are similar to synthetic
RNase P RNAs that contain all of the catalytic core of the bacterial
RNA but lack phylogenetically variable, stabilizing elements.
RNase P is an endoribonuclease best known for its role in tRNA
biosynthesis, in which it is the enzyme responsible for the removal of
5' leader sequences from transfer RNA precursors (for reviews see refs.
1 and 2). In Bacteria, RNase P consists of two subunits: a large
( RNase P enzymes have been characterized from only two archaeal species:
the thermoacidophilic crenarchaeote Sulfolobus
acidocaldarius (7) and the extremely halophilic euryarchaeote
Haloferax volcanii (8). The S. acidocaldarius
RNase P is resistant to micrococcal nuclease treatment and contains a
315-nt RNA that persists after nuclease treatment (9). The enzyme is
large ( We recently developed a well defined secondary structure model of RNase
P RNAs from Archaea by using comparative sequence analysis (Fig.
1; ref. 11 and J.K.H., E.S.H.,
and J.W.B., unpublished data). Nearly all of the conserved sequences
and secondary structures in the catalytically active bacterial RNAs
(12) are also present in the archaeal RNAs. The structural distinctions
between the bacterial and archaeal RNAs have largely disappeared as our
understanding of their structures has improved; thus, the dramatic
difference in their ability to catalyze pre-tRNA 5' processing was
puzzling. A phylogenetic spectrum of archaeal RNase P RNAs were
therefore tested for pre-tRNA processing activity in a wide variety of
conditions, including ionic conditions outside the range usually
considered. We show here that RNase P RNAs from the methanobacteria,
thermococci, and extreme halophiles are, like their bacterial homologs,
able to process pre-tRNAs in the absence of protein at very
high ionic strength. The biochemical properties of the archaeal RNAs
are similar to those of synthetic minimal bacterial RNase P RNAs (RNAs that contain only the phylogenetically conserved "core" elements of the bacterial RNAs; refs. 13 and 14), suggesting that the archaeal
RNAs contain all of the elements required for substrate recognition and
catalysis but are structurally defective in the absence of protein.
Biochemistry
RNase P RNAs from some Archaea are catalytically active
, and
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
140-kDa, 400-nt) RNA and a small (14-kDa, 120-amino acid)
protein. Both RNA and protein are required in vivo and for
optimal activity in vitro in reactions at low ionic strength
(3, 4). The RNA is the catalytic subunit of the bacterial enzyme; at
elevated ionic strength in vitro, it is by itself capable of
processing pre-tRNAs catalytically; i.e., it is a ribozyme (5). The
protein component of the bacterial enzyme alters substrate recognition
by directly contacting the leader region of the pre-tRNA (6). The RNase
P enzymes of Archaea (formerly archaebacteria) and Eukarya (the
nuclear/cytoplasmic portion of the eukaryotic cell) also contain RNA
subunits, but these RNAs have not been shown to be catalytically
active. Although it seems likely that the catalytic function of the
archaeal and eukaryal enzymes resides in the RNA, the expression of
this activity apparently requires the presence of the protein subunits.
400 kDa apparent molecular mass) and has a low density in
Cs2SO4 (1.27 g/cm3), similar to the densities of the
eukaryotic nuclear enzyme and implying a high protein:RNA content. The
H. volcanii RNase P, on the other hand, resembles the
bacterial enzyme in density in Cs2SO4 (1.61 g/cm3; ref. 10) and nuclease sensitivity. The
H. volcanii enzyme contains a 435-nt RNA (8). Neither
proteins associated with the archaeal enzymes nor sequences encoding
polypeptides with recognizable similarity to eukaryal, mitochondrial,
or bacterial RNase P proteins have been identified in archaeal genomes.
The RNase P RNAs from S. acidocaldarius and H. volcanii are similar in size and, to some extent, sequence to
those of Bacteria, but these RNAs by themselves could not be shown to
be catalytically active after deproteinization or when synthesized
in vitro (8, 9). This finding and the observation in
subsequent tests that the RNase P RNAs from Methanosarcina
barkeri (11) and Methanococcus jannaschii (E.S.H.,
J.K.H., and J.W.B., unpublished results) also lack activity led to the
conclusion that archaeal RNase P RNAs in general, like those of
eukaryotes, are not by themselves catalytically active.
View larger version (28K):
[in a new window]
Fig. 1.
Secondary structures of the M.
thermoautotrophicum strain 
H, M. jannaschii,
and Escherichia coli RNase P RNAs (refs. 11 and 12, and
J.K.H., E.S.H., and J.W.B., unpublished data). Helices are numbered
P1-P18 as described (24). Helices P4 and P6 are shown with lines and
brackets. The 5' and 3' ends of the native archaeal RNAs were
determined by primer extension and nuclease S1 protection. Additional
RNase P RNA sequences and structures are available on the Ribonuclease
P database at www.mbio.ncsu.edu/RNaseP/home.html (25).
| |
MATERIALS AND METHODS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
|
|---|
RNase P Activity Assays. RNase P RNA assays contained 1.5 nM 32P-labeled Bacillus subtilis or Methanobacterium thermoautotrophicum pre-tRNAAsp, 50 mM Tris (pH 8), 25-300 mM MgCl2, 0.1-5 M ammonium acetate, 0.1% SDS, and 0.05% Nonidet P-40. Incubations ranged from 2 to 16 h at 30-75°C (typically 45°C). Optimal pH was evaluated in activity assays that used Hepes in place of Tris. Reaction products were separated by electrophoresis on 8 or 12% polyacrylamide/7.5 M urea/TBE buffer (90 mM Tris/64.6 mM boric acid/2.5 mM EDTA, pH 8.3) gels (SequaGel, National Diagnostics) and visualized by phosphorimagery (15).
For assays of synthetic RNAs, RNase P RNAs were synthesized from cloned genes by using T7 or T3 RNA polymerase, as described by the manufacturer (Promega). For assays of activity in total cellular nucleic acid, proteins were removed from archaeal cell lysates (prepared by using a French press and cells resuspended in 50 mM Tris·Cl, pH 8/25 mM MgCl2/0.1 M ammonium acetate/0.05% Nonidet P-40 as described in ref. 15) by repeated phenol extraction, followed by a phenol:chloroform extraction. Nucleic acids were precipitated with ethanol and resuspended in 10 mM Tris, pH 8/1 mM EDTA/0.1% SDS. Assays contained 10-40 µg/ml cellular nucleic acid.Determination of Native 5' and 3' Ends.
Identification of the
native 5' and 3' ends of the M. thermoautotrophicum H
RNase P RNA was performed as described (8). The location of the 5' end
was determined by primer extension by using oligonucleotide Mfo145R
(CGTGTCGTTTCTGCTCC). The location of the 3' end was determined by S1
nuclease mapping by using a probe DNA fragment that overlapped the 3'
end of the RNase P RNA, produced by PCR amplification from genomic DNA
by using oligonucleotide primers H138F (GATAATGAAGCTTCACCCTCAAG) and
H908RXba (GCTCTAGAGCTCCATCGCGCCTGCG). The downstream priming-site
sequence was taken from the complete genome sequence (16).
RNase P RNA-Encoding Genes.
RNase P RNA-encoding genes were
cloned after PCR amplification from genomic DNAs by using previously
described methods (11). The oligonucleotide primers used were H5'Bam
(CGGGATCCACCGGGCAAGCCGAAGGGC) and H3'Xba (GCTCTAGACCGGGCATGCCGAGAG)
for obtaining genes from Methanobacterium spp., Pyro5'Xba
(GCTCTAGATAGGCGAGGGGGCTGGGG) and Pyro3'Bam (CGGGATCCTAGGCGAGGGGGCTATAG)
for obtaining genes from Pyrococcus and
Thermococcus spp., Mja5'Xba (GCTCTAGAGGGTAAGGGGGCTGGTG) and
Mja3'Bam (CGGGATCCGGTATGGGGGCTATAGC) for obtaining genes from Methanococcus spp., and Sac5'Bam (CGGGATCCTAGGGGAGCCTAACAGG)
and Sac3'Xba (GCTCTAGAGGGGAGCCTAACAATAACC) for obtaining the gene from
Metallosphaera sedula. Primer sequences are based on
data from the complete genome sequences of M. thermoautotrophicum H (16), Pyrococcus furiosus
(Utah Genome Center; www.genome.utah.edu), and M. jannaschii
(17), respectively. The Sac primers were designed based on the
published gene sequence of S. acidocaldarius RNase P RNA
(9).
RNase H Depletions. Reactions (10 µl) containing 100 mM KCl, 10 mM MgCl2, 20 mM Hepes·KOH (pH 7.4), 1 mM DTT, 0.2 µg of RNase P RNA, and 2 µg of oligonucleotide Mfo145R or Eco145R (GCGGTTTGCTCTCTGTTGC) were heated to 80°C for 3 min and cooled to 30°C over 30 min; RNase H (2 units; Life Technologies, Grand Island, NY) was added and incubated for 1 h at 30°C. The remaining RNase P activity was assessed as described above.
Unimolecular Enzyme:Substrate RNAs.
Unimolecular
enzyme:substrate RNAs were constructed by using RNase P RNA sequences
from Methanobacterium formicicum and M. barkeri
and the B. subtilis tRNAAsp.
Full-length RNase P RNA-encoding sequences were amplified from cloned
genes by PCR by using primers H5'Bam and H3'Xba for M. formicicum or Msb5'Bam (CGGGATCCATGCGAGAGAGGCTGG) and Msb3'RBam (CGGGATCCATGCGAGTGAGGCACG) for M. barkeri; this DNA was
phosphorylated with ATP and T4 polynucleotide kinase and treated with
T4 DNA ligase to generate circular genes. Secondary amplifications from these DNAs with primers Mfo261FBglIITP
(GAAGATCTAGGTAACTCGCATAGATG) and Mfo260RHindTP
(CCCAAGCTTCTGCCTCATACAGGATTC) for M. formicicum or
MsbTP2505' (CGTCTAGAAACGCATAGCCGAATG) and MsbTP2503'
(AACTGCAGAACAACCGGGAGAGTCCG) for M. barkeri
generated circularly permuted RNase P RNA genes. Circularly permuted
DNAs were cloned immediately downstream of the
tRNAAsp from B. subtilis in pDW128
(18). Radiolabeled enzyme:substrate RNAs were generated from linearized
plasmids by using T7 RNA polymerase and
[
-32P]GTP.
Reconstitution of Chimeric Holoenzymes. RNase P reconstitution assays were conducted in 50 mM Tris·Cl (pH 8), 100 mM ammonium acetate, 25 mM MgCl2, 1.5 nM B. subtilis pre-tRNAAsp, 20-200 µg/ml RNase P RNA, 18 µg/ml nonsense transcript of the M. thermoautotrophicum RNase P RNA gene (included as a "decoy" for traces of nuclease activity in the RNase P protein preparation), and 0-10 µg/ml B. subtilis RNase P protein (a gift from C. Fierke, Duke University, Durham, NC). Reactions containing archaeal RNase P RNA and negative controls containing no RNase P RNA were incubated at 37°C for 16 h. Reactions containing E. coli RNase P RNA were incubated at 37°C for 5 min. Cleavage products were separated by electrophoresis in denaturing 8% acrylamide gels followed by phosphorimagery.
| |
RESULTS AND DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
|
|---|
In preliminary experiments, lysates from a variety of archaeal cultures were capable of 5' processing either the B. subtilis or M. thermoautotrophicum pre-tRNAAsp (15). Removal of protein from these lysates in many cases eliminated catalytic activity, but those of the methanobacteria and the thermococci (P. furiosus and Thermococcus celer) retained RNase P activity (data not shown). This activity was resistant to exhaustive phenol extraction and the inclusion of SDS (1%) in the reaction buffer, supporting the belief that catalysis was independent of protein. RNAs from the extreme halophiles H. volcanii and Natronobacterium gregoryi purified by organic extraction failed to process pre-tRNA, but the activity present in cell lysates was resistant to the inclusion of SDS in the reaction buffer, suggesting that the RNA was responsible for this activity.
The convincing proof that ribozymes, including bacterial RNase P RNA, are catalytically proficient in the absence of associated proteins came from experiments with RNAs transcribed in vitro (19). Synthetic RNAs, transcribed from cloned RNase P RNA-encoding genes, from a wide phylogenetic range of archaeal species were therefore tested for pre-tRNA 5'-processing activity; those of the methanobacteria, the extreme halophiles, and thermococci, but not other Archaea, were found to contain RNase P activity (Fig. 2). The catalytic proficiency of these synthetic RNAs indicates that they do not depend on protein for activity, nor are posttranscriptional modifications such as pseudouridylation or 2'-O-methylation essential for activity.
|
The extent of activity for all of the active archaeal RNase P RNAs was
quite low; initial assays included large molar excesses (in the range
of 100:1) of RNase P RNA over substrate and incubation for several
hours, but often resulted in only partial processing of the substrate.
The potential for contamination by catalytically active bacterial RNase
P RNAs was therefore a significant concern. Previous descriptions of
catalytic activity by the H. volcanii RNA (8) and
reconstitution of chimeric RNase P holoenzymes from archaeal and
bacterial components (8, 10) were previously discounted as the result
of contamination, because the amount of activity recovered was very
small and the results could not be reproduced (9). Three observations
argued against the possibility that the catalytic activity reported
here might result from contamination by bacterial RNase P RNA rather
than from the archaeal RNA: (i) correlation of the presence
or absence of activity from RNA extracted from cells and RNAs
synthesized in vitro from genes cloned from the same species
(data not shown), (ii) the unusual biochemical properties of
the activity (see below), and (iii) the precise electrophoretic comigration of activity with the archaeal RNA (data not
shown). The direct experimental evidence that the observed activity
resides in the archaeal RNase P RNA comes from oligonucleotide-directed RNase H depletion experiments (Fig.
3) and intramolecular cleavage of
unimolecular enzyme:substrate RNAs (Fig.
4). In the first instance, pretreatment of the M. thermoautotrophicum H RNase P RNA
with RNase H in the presence of an M. thermoautotrophicum-specific oligonucleotide, but not an E. coli-specific oligonucleotide, reduces RNase P activity. However,
the E. coli-specific oligonucleotide and RNase H reduced the
activity of the E. coli, but not M. thermoautotrophicum, RNase P RNA. In the second case, cleavage of
the tethered M. formicicum RNase P RNA:B.
subtilis pre-tRNAAsp was independent of
concentration, indicating cleavage was in cis. The M. formicicum RNase P RNA:B. subtilis
pre-tRNAAsp required conditions similar to the
native M. thermoautotrophicum RNA (see below) for optimal
activity. The analogous enzyme:substrate RNA based on the M. barkeri RNase P RNA, an RNase P RNA that is not catalytically
active, does not self-cleave (data not shown).
|
|
The reaction conditions required by the archaeal RNase P RNA activity are unusual. Both the native and synthetic M. thermoautotrophicum RNase P RNAs were found to require 300 mM MgCl2 and 3 M ammonium acetate for maximal activity (Fig. 5A), well above the requirements of any characterized bacterial RNase P RNA. Mn2+ could efficiently replace Mg2+ and was effective at lower concentrations (100 mM) but at the expense of a dramatic increase in nonspecific hydrolysis of substrate, product, and presumably enzyme. Ca2+, Zn2+, and Cu2+ were unable to promote cleavage. The Mg2+ requirement was not reduced by increases in ammonium acetate concentration nor visa versa. The high ionic strength may be required for stabilization of the RNA structure, and the high Mg2+ may be required for further specific stabilization and/or to overcome poor binding of catalytically involved Mg2+. The RNase P RNA synthetic transcript from H. volcanii also required very high ionic strength for activity (4 M ammonium acetate and 300 mM MgCl2) for maximal activity. The optimal temperatures and pH for these RNase P RNAs was 45-50°C and 8.0, respectively. However, the upper bounds of these assays are limited by the extent of nonspecific hydrolysis in these reactions at elevated temperatures and pH, although high temperature or pH alone did not allow optimal catalysis at lower ionic strength or Mg2+ concentrations.
|
Poor catalysis by the archaeal RNase P RNAs, even in optimal
conditions, seems to result at least in part from poor affinity for
substrate. Substrate cleavage rates increase linearly with substrate
concentration up to at least 10 µM (Fig. 5B),
implying that the Km of the reaction
is in excess of 40 µM. This result may occur in part
because of the extreme conditions required to obtain activity; the
Km of the E. coli RNase P
RNA-catalyzed reaction is also quite high under these far-from-optimal
conditions (2.2 µM, as opposed to 74 nM in reactions
containing 1 M ammonium acetate and 25 mM MgCl2).
The Vmax of the reaction catalyzed by
the archaeal RNA could not be determined, but given the high
Km and respectable catalytic rate at
high substrate concentrations, there is no evidence for a defect in
Vmax or kcat.
At the highest substrate concentrations, each mole of archaeal RNase P
RNA processed more than 100 mol of substrate during the 2.5-h reaction
(2.2 min
1).
The protein component or components of the archaeal RNase P have yet to
be identified despite the availability of several complete archaeal
genome sequences and RNase P protein sequences from a wide variety of
Bacteria and the yeast nucleus and mitochondrion (as well as some of
the human sequences; refs. 20-23). Because of the similarity of the
archaeal and bacterial RNase P RNAs, we attempted to reconstitute
chimeric holoenzymes from archaeal RNase P RNA and bacterial RNase P
protein (Fig. 6). Catalytic activity by the Methanobacterium RNase P RNAs was
reconstituted at low ionic strength and Mg2+
concentration by using the B. subtilis RNase P protein,
indicating the functional interaction of these heterologous subunits.
It seems likely, therefore, that the structure and function of the bacterial and archaeal protein components are, at least in part, similar in the archaeal and bacterial enzymes. RNase P activity at
moderate ionic strength absolutely depended on the presence of the
protein, unlike the E. coli or B. subtilis RNase
P RNAs, which can process this substrate at rates of 20% of that of
the reconstituted enzymes in these conditions. We did not detect
enhanced activity of the M. sedula, H. volcanii,
M. barkeri, or M. vannielii RNAs in the presence
of the bacterial protein under these conditions, although analogous
reconstitution of H. volcanii RNA and B. subtilis protein has been reported (8).
|
The catalytic proficiency of archaeal RNase P RNAs is much lower than their bacterial homologs, but their ability to process pre-tRNA at any rate implies that they contain all of the sequences and structures necessary for substrate recognition and catalysis. The catalytic competence of the archaeal RNAs is consistent with our understanding of the conserved features of the archaeal and bacterial RNase P RNAs; these RNAs are remarkably similar in both sequence and structure, and the invariably present sequences and structures of the catalytically active bacterial RNAs are present in the archaeal RNAs as well (except those of Methanococcus and Archaeoglobus). Synthetic RNase P RNAs that contain only these core bacterial sequences and structures are catalytically active; however, these RNAs are structurally deficient, with biochemical properties similar to those of the active archaeal RNAs (13, 14). The archaeal RNAs apparently depend on the protein component(s) of the holoenzyme for structural integrity but not for essential catalytic function. The exception to this generality is the RNase P RNAs of Methanococcus and Archaeoglobus, both of which lack core structural features (P8 and L15) that are directly involved in substrate recognition in Bacteria. These RNAs are not catalytically active, even in the presence of the bacterial protein. How the holoenzymes compensate for the lack of core RNA structures is not known.
| |
ACKNOWLEDGEMENTS |
|---|
We thank J. Reeve for cultures of M. thermoautotrophicum; W. Whitman for cultures of Methanococcus spp.; C. Fierke for the gift of B. subtilis RNase P protein; R. Kelley for cultures of various Crenarchaea and thermococci; A. Andrews for assistance with biochemical assays and construction of the unimolecular enzyme:substrate RNAs; J. Perez, L. Rudd, and B. Vucson for their work in the cloning and DNA sequence determination of RNase P RNA encoding genes; and N. Pace and C. Daniels for valuable discussions on this work. This work was supported by National Institutes of Health Grant GM52894.
| |
FOOTNOTES |
|---|
* Present address: M888, Life Sciences Division, Los Alamos National Laboratory, Los Alamos, NM 87545.
Present address: Department of Plant and Microbial Biology,
Koshland Hall 111, University of California, Berkeley, CA 94720.
To whom reprint requests should be addressed. e-mail:
jwbrown{at}mbio.mbio.ncsu.edu.
Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession nos. U42985, AF121773, and AF121774).
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
|
|---|
| 1. |
Pace, N. R. & Brown, J. W.
(1995)
J. Bacteriol.
177,
1919-1928
|
| 2. | Karwan, R., Pluk, H. & van Venrooij, W. J., eds. (1996) Molecular Biology Reports Special Issue: RNase MRP/RNase P Systems (Kluwer, Nijmegen), Vol. 22. |
| 3. |
Reich, C., Olsen, G. J., Pace, B. & Pace, N. R.
(1988)
Science
239,
178-181
|
| 4. | Kurz, J. C., Niranjanakumari, S. & Fierke, C. A. (1998) Biochemistry 37, 2393-2400 [CrossRef][Medline] . |
| 5. | Guerrier-Takada, C., Gardner, K., Marsh, T., Pace, N. R. & Altman, S. (1983) Cell 35, 849-857 [CrossRef][ISI][Medline] . |
| 6. |
Niranjanakumari, S., Stams, T., Crary, S. M., Christianson, D. W. & Fierke, C. A.
(1998)
Proc. Natl. Acad. Sci. USA
95,
15212-15217
|
| 7. |
Darr, S. C., Pace, B. & Pace, N. R.
(1990)
J. Biol. Chem.
265,
12927-12932
|
| 8. |
Nieuwlandt, D. T., Haas, E. S. & Daniels, C. J.
(1991)
J. Biol. Chem.
266,
5689-5695
|
| 9. |
LaGrandeur, T. E., Darr, S. C., Haas, E. S. & Pace, N. R.
(1993)
J. Bacteriol.
175,
5043-5048
|
| 10. | Lawrence, N., Wesolowski, D., Gold, H., Bartkiewicz, M., Guerrier-Takada, C., McCain, W. H. & Altman, S. (1987) Cold Spring Harbor Symp. Quant. Biol. 52, 233-238 [ISI][Medline] . |
| 11. |
Haas, E. S., Armbruster, D. W., Vucson, B. M., Daniels, C. J. & Brown, J. W.
(1996)
Nucleic Acids Res.
24,
1252-1259
|
| 12. |
Haas, E. S. & Brown, J. W.
(1998)
Nucleic Acids Res.
26,
4093-4099
|
| 13. |
Waugh, D. S., Green, C. J. & Pace, N. R.
(1989)
Science
244,
1569-1570
|
| 14. | Siegel, R. W., Banta, A. B., Haas, E. S., Brown, J. W. & Pace, N. R. (1996) RNA 2, 452-462 [Abstract]. |
| 15. | Pannucci, J. A., Haas, E. S. & Brown, J. W. (1997) Nucleic Acids Symp. Series 36, 90-92 . |
| 16. |
Smith, D. R., Doucette-Stamm, L. A., Deloughery, C., Lee, H., Dubois, J., Aldredge, T., Bashirzadeh, R., Blakely, D., Cook, R., Gilbert, K., et al.
(1997)
J. Bacteriol.
179,
7135-7155
|
| 17. | Bult, C. J., White, O., Olsen, G. J., Zhou, L., Fleischmann, R. D., Sutton, G. G., Blake, J. A., FitzGerald, L. M., Clayton, R. A., Gocayne, J. D., et al. (1996) Science 273, 1058-1073 [Abstract]. |
| 18. | Waugh, D. S. (1989) Ph.D. thesis (Indiana University, Bloomington, IN). |
| 19. |
Guerrier-Takada, C. & Altman, S.
(1984)
Science
223,
285-286
|
| 20. |
Chamberlain, J. R., Lee, Y., Lane, W. S. & Engelke, D. R.
(1998)
Genes Dev.
12,
1678-1690
|
| 21. |
Eder, P., Kekuda, R., Stolc, V. & Altman, S.
(1997)
Proc. Natl. Acad. Sci. USA
94,
1101-1106
|
| 22. |
Stolc, V. & Altman, S.
(1997)
Genes Dev.
11,
2414-2425
|
| 23. |
Morales, M. J., Dang, Y. L., Lou, Y. C., Sulo, P. & Martin, N. C.
(1992)
Proc. Natl. Acad. Sci. USA
89,
9875-9879
|
| 24. |
Haas, E. S., Brown, J. W., Pitulle, C. & Pace, N. R.
(1994)
Proc. Natl. Acad. Sci. USA
91,
2527-2531
|
| 25. |
Brown, J. W.
(1999)
Nucleic Acids Res.
27,
314
|
| 26. |
Maidak, B. L., Olsen, G. J., Larsen, N., Overbeek, R., McCaughey, M. J. & Woese, C. R.
(1997)
Nucleic Acids Res.
25,
109-111
|
Copyright © 1999 by The National Academy of Sciences 0027-8424/99/967803-6$2.00/0
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg What's this?
This article has been cited by other articles in HighWire Press-hosted journals:
|
|
 |
|
  T. V. Aspinall, J. M.B. Gordon, H. J. Bennett, P. Karahalios, J.-P. Bukowski, S. C. Walker, D. R. Engelke, and J. M. Avis Interactions between subunits of Saccharomyces cerevisiae RNase MRP support a conserved eukaryotic RNase P/MRP architecture Nucleic Acids Res., October 8, 2007; 35(19): 6439 - 6450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Hundt, A. Zaigler, C. Lange, J. Soppa, and G. Klug Global Analysis of mRNA Decay in Halobacterium salinarum NRC-1 at Single-Gene Resolution Using DNA Microarrays J. Bacteriol., October 1, 2007; 189(19): 6936 - 6944. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Jarrous and R. Reiner Human RNase P: a tRNA-processing enzyme and transcription factor Nucleic Acids Res., June 28, 2007; 35(11): 3519 - 3524. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zhu, D. K. Pulukkunat, and Y. Li Deciphering RNA structural diversity and systematic phylogeny from microbial metagenomes Nucleic Acids Res., April 1, 2007; 35(7): 2283 - 2294. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Kikovska, S. G. Svard, and L. A. Kirsebom From the Cover: Eukaryotic RNase P RNA mediates cleavage in the absence of protein PNAS, February 13, 2007; 104(7): 2062 - 2067. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Gopalan Uniformity amid diversity in RNase P PNAS, February 13, 2007; 104(7): 2031 - 2032. [Full Text] [PDF]
|
|
|
|
|
|
H.-Y. Tsai, D. K. Pulukkunat, W. K. Woznick, and V. Gopalan Functional reconstitution and characterization of Pyrococcus furiosus RNase P PNAS, October 31, 2006; 103(44): 16147 - 16152. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Rosenblad, M. D. Lopez, P. Piccinelli, and T. Samuelsson Inventory and analysis of the protein subunits of the ribonucleases P and MRP provides further evidence of homology between the yeast and human enzymes Nucleic Acids Res., October 6, 2006; 34(18): 5145 - 5156. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Seif, A. Cadieux, and B. F. Lang Hybrid E. coli--Mitochondrial ribonuclease P RNAs are catalytically active RNA, September 1, 2006; 12(9): 1661 - 1670. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. C. Wilson, C. J. Bohlen, M. P. Foster, and C. E. Bell Structure of Pfu Pop5, an archaeal RNase P protein PNAS, January 24, 2006; 103(4): 873 - 878. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Sharin, A. Schein, H. Mann, Y. Ben-Asouli, and N. Jarrous RNase P: role of distinct protein cofactors in tRNA substrate recognition and RNA-based catalysis Nucleic Acids Res., September 9, 2005; 33(16): 5120 - 5132. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-J. Rubin, M. Thollesson, L. A. Kirsebom, and B. Herrmann Phylogenetic relationships and species differentiation of 39 Legionella species by sequence determination of the RNase P RNA gene rnpB Int J Syst Evol Microbiol, September 1, 2005; 55(5): 2039 - 2049. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. KACHOURI, V. STRIBINSKIS, Y. ZHU, K. S. RAMOS, E. WESTHOF, and Y. LI A surprisingly large RNase P RNA in Candida glabrata RNA, July 1, 2005; 11(7): 1064 - 1072. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. MARQUEZ, J. K. HARRIS, S. T. KELLEY, J. W. BROWN, S. C. DAWSON, E. C. ROBERTS, and N. R. PACE Structural implications of novel diversity in eucaryal RNase P RNA RNA, May 1, 2005; 11(5): 739 - 751. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. DLAKIC 3D models of yeast RNase P/MRP proteins Rpp1p and Pop3p RNA, February 1, 2005; 11(2): 123 - 127. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. LI and S. ALTMAN In search of RNase P RNA from microbial genomes RNA, October 20, 2004; 10(10): 1533 - 1540. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. DAY-STORMS, S. NIRANJANAKUMARI, and C. A. FIERKE Ionic interactions between PRNA and P protein in Bacillus subtilis RNase P characterized using a magnetocapture-based assay RNA, October 20, 2004; 10(10): 1595 - 1608. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. NUMATA, I. ISHIMATSU, Y. KAKUTA, I. TANAKA, and M. KIMURA Crystal structure of archaeal ribonuclease P protein Ph1771p from Pyrococcus horikoshii OT3: An archaeal homolog of eukaryotic ribonuclease P protein Rpp29 RNA, September 1, 2004; 10(9): 1423 - 1432. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Li, S. Zaman, Y. Langdon, J. M. Zengel, and L. Lindahl Identification of a functional core in the RNA component of RNase MRP of budding yeasts Nucleic Acids Res., July 14, 2004; 32(12): 3703 - 3711. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. P. Boomershine, C. A. McElroy, H.-Y. Tsai, R. C. Wilson, V. Gopalan, and M. P. Foster Structure of Mth11/Mth Rpp29, an essential protein subunit of archaeal and eukaryotic RNase P PNAS, December 23, 2003; 100(26): 15398 - 15403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Tapp, M. Thollesson, and B. Herrmann Phylogenetic relationships and genotyping of the genus Streptococcus by sequence determination of the RNase P RNA gene, rnpB Int J Syst Evol Microbiol, November 1, 2003; 53(6): 1861 - 1871. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. R. SEIF, L. FORGET, N. C. MARTIN, and B. F. LANG Mitochondrial RNase P RNAs in ascomycete fungi: Lineage-specific variations in RNA secondary structure RNA, September 1, 2003; 9(9): 1073 - 1083. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ando, T. Tanaka, and Y. Kikuchi Substrate Shape Specificity of E. coli RNase P Ribozyme Is Dependent on the Concentration of Magnesium Ion J. Biochem., April 1, 2003; 133(4): 445 - 451. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Jager, R. Samorski, F. Pfeifer, and G. Klug Individual gvp transcript segments in Haloferax mediterranei exhibit varying half-lives, which are differentially affected by salt concentration and growth phase Nucleic Acids Res., December 15, 2002; 30(24): 5436 - 5443. |
