Previous Article |
Table of Contents
| Next Article 
* Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue
North, Seattle, WA 98109; Contributed by Gary Felsenfeld, November 3, 2000
By sequencing regions flanking the Olfactory receptors are a
family of seven-transmembrane G protein-coupled receptors expressed in
sensory neurons of nasal epithelium, where they bind to odorant
epitopes and transduce this primary signal into membrane potential
(1-3). These molecules are encoded by a family of up to 1,000 genes in
mouse and human, which are grouped into discrete clusters at different
chromosomal locations (4-7). Production of a given olfactory receptor
is restricted to one of four spatially defined domains within the olfactory epithelium (8, 9). Despite the large size of this gene
family, each olfactory neuron appears to express only a single olfactory receptor gene (ORG) (10, 11) in an allele-specific manner
(12). The mechanisms that underlie any of these regulatory decisions The characterization of DNA sequences required for proper gene
expression, such as promoters and enhancers, represents a basic approach to such questions. Functional studies of putative ORG regulatory elements, however, are hindered by the lack of a viable cell
culture model for olfactory neurons. Although analysis of transgenes in
mice provides a suitable model system, the production of mouse lines is
time-consuming and expensive. Thus, genomic approaches are particularly
relevant to the identification of ORG regulatory sequences, in part to
guide the selection of regions to be examined by functional studies in
transgenic mice. Candidates for such regions can be recognized as
noncoding sequences that are conserved between species (18).
Previously, we reported that ORGs surround the complex of We have sequenced additional DNA on both sides of the Subclones, Sequencing, and Annotations.
Sequences reported herein have been deposited in the GenBank sequence
database. Mouse 5' and 3' sequences were obtained from a P1 clone
(Genome Systems, St. Louis) and a bacterial artificial chromosome (BAC)
clone (a gift from T. Ley, St. Louis). Human 5' and 3' sequences were
obtained from several BAC clones (Research Genetics, Huntsville, AL),
from published clones PAC148O22, BAC233K18, BAC141J14, and BAC44E16
(27), and from GenBank accession no. AC026083. Smaller inserts used for
sequencing were obtained by restriction enzyme digestion and subcloning
into pBluescript KSII (+) or SKII (+). Sequencing was performed by
using Big Dye terminators and universal or custom-synthesized primers
on an Applied Biosystems model 377XL automated sequencer; both strands of all regions were sequenced at least once.
Genetics
Comparative structural and functional analysis of the olfactory
receptor genes flanking the human and mouse 
-globin gene clusters
,
,,,¶, and
University of Washington School
of Medicine, Seattle, WA 98195; Howard Hughes
Medical Institute, College of Physicians and Surgeons, Columbia
University, New York, NY 10032; § National Institute of
Diabetes and Digestive and Kidney Diseases, National Institutes of
Health, Bethesda, MD 20892; and Department of
Biochemistry and Molecular Biology, Pennsylvania State University,
University Park, PA 16802
Abstract
Top
Abstract
Introduction
Methods
Results
Discussion
References
-globin gene complex in mouse
(Hbbc) and human (HBBC), we have shown
that the -globin gene cluster is surrounded by a larger cluster of
olfactory receptor genes (ORGs). To facilitate sequence comparisons and
to investigate the regulation of ORG expression, we have mapped 5'
sequences of mRNA from olfactory epithelium encoding
-globin-proximal ORGs. We have found that several of these genes
contain multiple noncoding exons that can be alternatively spliced.
Surprisingly, the only common motifs found in the promoters of these
genes are a "TATA" box and a purine-rich motif. Sequence
comparisons between human and mouse reveal that most of the conserved
regions are confined to the coding regions and transcription units of
the genes themselves, but a few blocks of conserved sequence also are
found outside of ORG transcription units. The possible influence of
-globin regulatory sequences on ORG expression in olfactory
epithelium was tested in mice containing a deletion of the
endogenous -globin locus control region, but no change
in expression of the neighboring ORGs was detected. We evaluate the
implications of these results for possible mechanisms of regulation of
ORG transcription.
Introduction
Top
Abstract
Introduction
Methods
Results
Discussion
References
expression in olfactory neurons, zonal specificity, one
receptor per neuron, or allelic exclusionare undefined. In addition,
expression of some ORGs has been documented in nonolfactory tissues
(13-17), but the significance of such expression is also unknown.
-like
globin genes of humans (HBBC) and mice (Hbbc)
(19). (We use the abbreviation HBBC to refer to the complex
of genes containing HBE1, HBG2, HBG1,
HBD, and HBB at 11p15.5 in humans, and
Hbbc for the complex of genes containing Hbb-y,
Hbb-bh1, Hbb-b1, and Hbb-b2 on
chromosome 7 in mice.) The major enhancer of the -globin locus,
termed the locus control region (LCR), is a 20-kb segment of DNA
containing several DNase-hypersensitive sites, located to the 5' side
of the genes (20-22). In contrast to the view that the LCR controls
chromatin "opening" of the globin locus (23), deletion of the LCR
from the endogenous Hbb locus leaves the globin genes in a DNase-sensitive domain in erythroid cells, albeit with much
lower levels of expression (24-26). These results suggest that other
DNA sequences may be involved in opening a chromatin domain and that
these sequences might be found within the adjacent ORG clusters. The
conserved juxtaposition of these two distinct gene clusters also poses
the question of whether the -globin LCR plays a functional role in
ORG expression or whether sequence elements exist to segregate
erythroid and neuronal-specific regulatory inputs.
-like globin
genes in both mouse and human, analyzed the aligned sequences, and
studied the expression of the ORGs in olfactory tissue. Our results
show significant mouse/human sequence matches within and adjacent to
the transcription units of orthologous pairs of mouse and human ORGs.
Surprisingly, the ORG promoters that we have mapped exhibit no
significant similarities other than the presence of a TATA box and a
purine-rich motif. Many of the ORGs contain multiple noncoding exons,
some of which are alternatively spliced in vivo. We also
show that expression of the globin-proximal ORGs in olfactory epithelium appears normal in mice containing a deletion of the entire
-globin LCR. These results provide a more complete context for
studies of ORG regulation in nasal epithelium, the extent of the open
chromatin domain containing the globin genes in erythroid cells, and
the distribution of sequences regulating these two gene clusters.
Methods
Top
Abstract
Introduction
Methods
Results
Discussion
References
Sequence Alignments.
Pairwise alignments of the human and mouse DNA sequences through the
ORG and HBBC regions were computed and viewed by using the
PIPMAKER package
(http://bio.cse.psu.edu/pipmaker/). The multiple alignment of
the ORG promoters was generated in several steps. First, the regions
around the 5' ends of the genes were examined in pairwise comparisons
(HOR5'7 vs. MOR5'4,
HOR5'6 vs. MOR5'3, HOR5'1 vs. MOR5'1,
and HOR3'2 vs.
MOR3'1; where HOR stands for human olfactory
receptor and MOR stands for mouse olfactory receptor); the four pairs
of orthologous sequences were truncated to begin 100 bp before the
start site and aligned by CLUSTAL W (http://www.ebi.ac.uk/clustalw/). This alignment then was fixed on the A+T-rich region, rearranging the gaps to show the A+T-rich region and the purine-rich region.
5' Rapid Amplification of cDNA Ends (RACE) and ORG Expression. The cDNA for 5' RACE, containing a SMARTII oligonucleotide (CLONTECH) at the 5' end of the mRNA, was generated from mouse olfactory epithelium poly(A)-selected RNA by using the SMART RACE cDNA amplification kit from CLONTECH. The 5' ends of the genes were determined by amplifying the 5' RACE cDNA template, by using one primer from the coding region of each ORG plus the SMARTII oligonucleotide and the Advantage 2 polymerase mix from CLONTECH. These products were sequenced directly or sequenced after purification from agarose gels.
Gene-specific primer pairs were synthesized, with forward primers from the first exon and reverse primers from the coding exon; a nested PCR strategy was used for each gene except MOR3'1. The
primers used were as follows (5' 
3'):
GCCATTCTGGTCTACAGTACAAAC, GGCCAGCAAGGAAAGTAGATAG,
ACAAACTGCTCTGACTTCATGGGT, GCAGACGAGGGCTGGTCTTAAT (MOR5'4); ATCCTTCTCAAAGCTGAATATCTG,
CCCTTGATGATGCTACTTGC, ATCTGAAGTTTCTAACAATGTCCC, GGTCCTGCTTTCCAATAACAAT
(MOR5'3); TGAGGGCATATGTAAAATCACA,
AAGTAAGCAGTACTCTTCCTACCG, AGGGCATATGTAAAATCACAAAG,
GTTCATGTTCTTATGCATCATTTC (MOR5'1); GAATCTCCTTGCTTTTACTC, CTGCGTTCAGTCACTATCAG (MOR3'1); ACCACAAAGATCCTATTCATGAGC,
AGCCATTGAACTTGATCATGC, CTGTGTACATCTCACTAAATGGC,
GCTGCTTCAACTTCTGTTCTATAC (MOR3'3);
TTCATCCTTTATAGAGGGAACAAC, GGAAGTAATACATGGGCTCG,
TTCATCCTTTATAGAGGGAACAAC, CCTGTGAGGTAGAATGTAGAGGAC (MOR3'4); and ATAGATGTGCAGATTATTAACAGG,
CGCTCAACTTTGATGACAAC, TGCTGATTTTTCTCAGTCTAGAAG,
CCTCAGCCTGTAGACATATGG (MOR3'6). PCRs were carried
out on cDNA made from total RNA from mouse olfactory tissue, generated
by using random hexanucleotides for the first-strand synthesis.
Products were amplified with the Advantage 2 polymerase mix as follows:
For MOR3'1, a single amplification was performed with a
60°C annealing temperature for 35 cycles. For the remaining genes, an
initial round of amplification was performed with the outer primer
pairs for 25 cycles at an annealing temperature of 55°C (50°C for
MOR5'4). After a 1:1,000 dilution of these reactions, a
second round of amplification was performed with the inner primers at
an annealing temperature of 60°C for 25 cycles, in the presence of
5% dimethyl sulfoxide. Trace amounts of
[
-32P]dCTP were included in the PCRs.
Products were separated on 5% polyacrylamide gels in 0.5× TBE (1× = 90 mM Tris/64.6 mM boric acid/2.5 mM EDTA, pH 8.3), and visualized
by autoradiography.
In situ hybridization was performed as described (19).
| |
Results |
|---|
|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
DNA Sequence of HBBC and Surrounding ORGs.
Our initial sequencing of regions flanking the HBBC locus in
human and Hbbc in mouse demonstrated that the -globin
genes were embedded in a cluster of ORGs (19). We have extended our sequencing to include additional regions flanking the -globin genes,
which allowed us to generate a contiguous sequence of 224 kb from mouse
and two contigs from human of 345 kb and 36 kb, separated by a gap of
about 6 kb (Fig. 1). Analysis of the
current sequence showed that at least 14 ORGs flank HBBC on
the centromeric side (5' to the -globin genes) and at least six ORGs
on the telomeric side. In mouse, Hbbc is flanked by at least
five ORGs on the 5' side and at least six on the 3' side. The sequences
we have obtained did not allow us to define the full extent of these
ORG clusters, and it is likely that additional ORGs exist beyond the
limits of our sequencing.
|
Definition of 5' Ends and Noncoding Exons for Mouse ORGs.
The coding regions of ORGs are not interrupted by introns, complicating
PCR-based analysis of ORG expressionbecause of the small amount of
RNA in olfactory epithelium that represents a given ORG, high cycle
numbers must be used, which can reveal trace contamination of RNA
samples by genomic DNA. To facilitate PCR-based expression studies, and
also to aid in the interpretation of mouse/human sequence alignments,
we mapped the 5' ends of globin-proximal ORG mRNAs from mouse olfactory
epithelium by using the 5' RACE technique. The results are summarized
in Fig. 2; detailed coordinates are in
the GenBank annotations.
|
1,
MOR3'4, and MOR3'6. Several of the ORGs located
5' to the -like globin genes have a more complex structure.
MOR3'3 had an additional exon separated from the protein-coding exon by a very short intron. The
genes MOR5'3 and
MOR5'4 had at least four and three
additional exons, respectively, upstream of the protein-coding exon,
and MOR5'1 had two upstream
noncoding exons; noncoding leader portions of the ORG mRNAs ranged
as high as 900 bp. We searched the spliced upstream exons for in-frame
ATGs or CTGs to identify alternative translation initiation codons
but found none.
The 5' RACE analysis also showed that ORG transcripts can be
alternatively spliced. Isolation and sequencing of different RACE
products for MOR5'1 and
MOR5'3 showed differential splicing of the second exon. Several RACE products were obtained for
MOR5'4, but only one was sequenced.
The major PCR product for this gene lacked the second exon of the 5'
RACE product (see below). All of the RACE products sequenced for
MOR5'2 were identical to the sequence of the genomic DNA 5' to the coding region; no introns were
detected for this gene.
Sequence Alignments Between Human and Mouse in the
ORG-HBBC Region.
Comparison of the mouse and human ORG-HBBC regions revealed
substantial blocks of conserved DNA sequences (data summarizing all of
the matching sequences also can be found at the web site http://globin.cse.psu.edu). Aligning segments were found in both protein-coding and noncoding sequences, and these were easily visualized in the percent identity plots shown in Fig.
3, which display the positions and
percent identity of aligning segments between human and mouse. The
protein-coding regions within these segments aligned at 80-85%
identity with no gaps (e.g., MOR5'4 vs. HOR5'7 and
MOR5'3 vs.
HOR5'6) or a single break in the alignment (MOR5'1 vs.
HOR5'1 and
MOR3'1 vs.
HOR3'2). Other matches (broken by
gaps to produce the many short, gap-free aligning segments displayed in
the pips) extended through the transcription units, including introns
and noncoding exons, and into the flanking regions.
|
3 and HOR5'6. Similarly, the coding regions of these genes were more closely related
to each other than they were to the coding regions of any other ORGs
(data not shown). On this basis, we are able to assign orthologous
relationships between large blocks of mouse and human sequence
throughout the HBBC/ORG region (Fig. 1).
Some alignments between human and mouse sequences were found outside of
ORG transcription units. These alignments included a region extending
3-6 kb from the 3' end of the MOR5'4 gene, another region located 1-3 kb from the transcription start site of
MOR5'4, a region 1.5-3 kb from the 3' end of
MOR5'2, and an extended series of matches that
corresponds to the -globin LCR (Fig. 3 A, C,
and F). In addition, a 1-kb block of sequence located 3' of
the globin genes also demonstrated significant homology with a
similarly placed sequence in human (Fig. 3D), which
corresponds to a nuclease hypersensitive site in erythroid cells (19,
30). Along with the sequence matches within the introns, noncoding exons, and promoters of the ORGs, all of these regions are candidates for regulatory sequences.
Sequence matches extended 5' to the first exon for orthologous pairs of
ORGs, whereas no matches outside the coding region were observed in
other ORG comparisons, which argues against a highly conserved
olfactory promoter sequence for the ORGs. However, short conserved
motifs could be missed in this analysis, so we also examined an
alignment of four orthologous pairs of ORGs. The start sites for
transcription of the mouse genes were determined experimentally, and
the homologous nucleotides were inferred as start sites for the human
genes. Inspection of the alignment revealed an A+T-rich region 25-30
bp upstream from the 5' end of the genes (Fig.
4), which could potentially function as a
TATA box. A purine-rich motif was also apparent at the beginning of the
alignment, but the distance of this motif from the TATA motif was not
consistent among different ORGs. In addition, we have subjected the
mouse ORG promoters we have mapped to analysis with transcription
factor databases (results not shown) that predicted binding of TATA
binding protein/TFIID to the A+T-rich regions at position 
30 but
failed to reveal any other motifs in common.
|
ORG Expression Is Unaffected by Deletion of the -Globin LCR.
MOR5'1 is as close to the
-globin LCR as is Hbb-y, the nearest globin gene target.
The LCR is a major cis-regulatory sequence in erythroid cells, and so
we examined the possibility that it also could play a role in
regulation of linked genes in olfactory tissue by comparing ORG
expression in olfactory epithelium of wild-type mice and mice
homozygous for a deletion of the -globin LCR (26). Using the exon
assignments derived from the 5' RACE products, we designed PCR primers
to amplify cDNAs from spliced mRNA in mouse olfactory epithelium. The
results in Fig. 5A show clear
reverse transcription-PCR products for all of the ORGs tested, even in
the absence of the -globin LCR. Similarly, in situ
hybridization to olfactory epithelium revealed no difference in the
expression pattern of -globin-proximal ORGs in comparisons of
wild-type and LCR-deleted mice (Fig. 5B and data not shown).
In both mouse strains, expression of these ORGs was observed in the
most dorsal zone of olfactory epithelium and exhibited the punctate
hybridization pattern that is characteristic of these genes.
|
| |
Discussion |
|---|
|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
The genomic arrangement of ORGs surrounding HBBC raises
questions of how these two clusters of tissue-specific genes are
regulated, and how the signals that govern expression within each
cluster are kept separate. In particular, little is known of how the
distinctive pattern of ORG expression is accomplished. Interspecies
sequence comparisons have been used to identify regulatory sequences
within several loci, including the -globin LCR (31) and the region containing the IL-4, IL-13, and IL-5
genes (32). The presence of extensive sequence conservation in the ORG
clusters flanking HBBC in mouse and human, mostly between
orthologous ORG transcription units, indicates the presence of
regulatory elements that specify the pattern of expression of these genes.
Surprisingly, however, our analysis of the paralogous ORG promoters, noncoding exons, or introns that we have characterized revealed only an A+T-rich region 25-30 bp upstream from the apparent transcription start sites and a purine-rich motif a variable distance upstream from that. In contrast, comparisons of orthologous pairs of human and mouse ORGs reveal extensive conserved regions, including the proximal promoters. Thus, sequence comparisons detected conserved putative regulatory regions for these orthologous pairs, although conservation within this set of related ORGs was confined to a minimal basal promoter. These results suggest that a generalized regulatory motif for ORGs may not exist, despite the presence of sequence determinants of ORG expression that are conserved between orthologs. We suggest that these sequence differences may represent the basis for ORG selection in olfactory neurons.
We have found that transcripts of the ORGs near Hbbc have long 5' untranslated regions, and some undergo alternative splicing. Alternative splicing of multiple noncoding exons (and lack of a generally conserved promoter sequence) also has been observed for members of a distinct cluster of ORGs located ~1 megabase from HBBC in mouse (R. Lane, T. Cutforth, R. Axel, and B. Trask, personal communication), suggesting that this is a general feature of ORG expression. Possibilities for the role of these 5' untranslated regions include control over translocation of the mRNA within the cell, translational control, or transcriptional control. Although no upstream, in-frame translation start sites were seen, it is possible that short out-of-frame translation products could be used to regulate protein synthesis, as has been observed for yeast GCN4 (33, 34). In addition, it has been observed that ORG mRNA is found both at the dendrite and at the axon (28). It is possible that such RNA localization could be regulated by alternative splicing; this could be tested by in situ hybridization with probes derived from specific noncoding exons.
The best candidates for elements involved in global regulation of the
ORG and -globin gene clusters are those conserved regions that occur
outside of ORG transcription units. Several such regions exist (Fig.
3), the most striking of which is the -globin LCR. Our results
indicate that the -globin LCR does not play a role in expression of
ORGs in nasal epithelium. The remaining candidates are then several
segments, located on either side of MOR5'4/HOR5'7, 3' of
MOR/HOR5'2, and 3' of the -globin cluster. The last of these
corresponds to a nuclease hypersensitive site (3' hypersensitive site
1) that is present in erythroid cells but also reportedly in other cell
types and that to date has no known function (30). We have found a
strong erythroid-specific hypersensitive site at the conserved sequence
located near the promoter of MOR5'4/HOR5'7 as well (unpublished
results); furthermore, we have found that the "open" domain of
nuclease-sensitive chromatin in erythroid cells extends through these
regions and thus includes several of the ORGs. Given this observation
and the presence of DNase-hypersensitive sites at both of these regions
in erythroid cells, these sequences are candidates for erythroid
regulatory elements. The results of the LCR deletions (24-26) suggest
that formation of a generalized nuclease-sensitive chromatin structure
in erythroid cells is accomplished by sequences other than the LCR, and
one or both of these conserved hypersensitive sites may play a role in
this process. We cannot at present eliminate the possibility, however,
that either or both of these regions also may be involved in regulation
of the proximal ORGs.
| |
Acknowledgements |
|---|
We thank T. Ley and G. Bepler for the gifts of BAC and PAC clones and L. Buck, T. Cutforth, and B. Trask for discussion and critical reading of the manuscript. This work was supported by National Institutes of Health Grants DK27635 (to R.H.) and DK44746 and DK54701 (to M.G.). M.B. is a fellow of the Helen Hay Whitney Foundation. M.A.B. is a J. S. McDonnell Foundation Scholar.
| |
Abbreviations |
|---|
ORG, olfactory receptor gene; LCR, locus control region; RACE, rapid amplification of cDNA ends; BAC, bacterial artificial chromosome; HOR, human olfactory receptor; MOR, mouse olfactory receptor.
| |
Footnotes |
|---|
¶ To whom reprint requests should be addressed.
Data deposition: The sequences reported in this paper have been deposited in the GenBank database (new accession nos. AF289203 and AF289204 and updates of accession nos. AF137396, AF133300, and AF071080).
| |
References |
|---|
|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
| 1. | Buck, L. & Axel, R. (1991) Cell 65, 175-187[CrossRef][ISI][Medline] . |
| 2. | Krautwurst, D. , Yau, K. W. & Reed, R. R. (1998) Cell 95, 917-926[CrossRef][ISI][Medline] . |
| 3. |
Zhao, H.
, Ivic, L.
, Otaki, J. M.
, Hashimoto, M.
, Mikoshiba, K.
& Firestein, S.
(1998)
Science
279,
237-242 |
| 4. | Rouquier, S. , Taviaux, S. , Trask, B. J. , Brand-Arpon, V. , van den Engh, G. , Demaille, J. & Giorgi, D. (1998) Nat. Genet. 18, 243-250[CrossRef][ISI][Medline] . |
| 5. |
Sharon, D.
, Glusman, G.
, Pilpel, Y.
, Horn-Saban, S.
& Lancet, D.
(1998)
Ann. N.Y. Acad. Sci.
855,
182-193 |
| 6. |
Trask, B. J.
, Friedman, C.
, Martin-Gallardo, A.
, Rowen, L.
, Akinbami, C.
, Blankenship, J.
, Collins, C.
, Giorgi, D.
, Iadonato, S.
, Johnson, F.
,
et al.
(1998)
Hum. Mol. Genet.
7,
13-26 |
| 7. | Glusman, G. , Sosinsky, A. , Ben-Asher, E. , Avidan, N. , Sonkin, D. , Bahar, A. , Rosenthal, A. , Clifton, S. , Roe, B. , Ferraz, C. , et al. (2000) Genomics 63, 227-245[CrossRef][ISI][Medline] . |
| 8. | Ressler, K. J. , Sullivan, S. L. & Buck, L. B. (1993) Cell 73, 597-609[CrossRef][ISI][Medline] . |
| 9. | Vassar, R. , Ngai, J. & Axel, R. (1993) Cell 74, 309-318[CrossRef][ISI][Medline] . |
| 10. | Malnic, B. , Hirono, J. , Sato, T. & Buck, L. B. (1999) Cell 96, 713-723[CrossRef][ISI][Medline] . |
| 11. | Mombaerts, P. , Wang, F. , Dulac, C. , Vassar, R. , Chao, S. K. , Nemes, A. , Mendelsohn, M. , Edmondson, J. & Axel, R. (1996) Cold Spring Harbor Symp. Quant. Biol. 61, 135-145[ISI][Medline] . |
| 12. | Chess, A. , Simon, I. , Cedar, H. & Axel, R. (1994) Cell 78, 823-834[CrossRef][ISI][Medline] . |
| 13. | Feingold, E. A. , Penny, L. A. , Nienhuis, A. W. & Forget, B. G. (1999) Genomics 61, 15-23[CrossRef][ISI][Medline] . |
| 14. | Vanderhaeghen, P. , Schurmans, S. , Vassart, G. & Parmentier, M. (1997) Genomics 39, 239-246[CrossRef][ISI][Medline] . |
| 15. | Asai, H. , Kasai, H. , Matsuda, Y. , Yamazaki, N. , Nagawa, F. , Sakano, H. & Tsuboi, A. (1996) Biochem. Biophys. Res. Commun. 221, 240-247[CrossRef][ISI][Medline] . |
| 16. | Drutel, G. , Arrang, J. M. , Diaz, J. , Wisnewsky, C. , Schwartz, K. & Schwartz, J. C. (1996) Recept. Channels 3, 33-40. |
| 17. |
Nef, S.
& Nef, P.
(1997)
Proc. Natl. Acad. Sci. USA
94,
4766-4771 |
| 18. | Hardison, R. C. (2000) Trends Genet. 16, 369-372[CrossRef][ISI][Medline] . |
| 19. |
Bulger, M.
, von Doorninck, J. H.
, Saitoh, N.
, Telling, A.
, Farrell, C.
, Bender, M. A.
, Felsenfeld, G.
, Axel, R.
& Groudine, M.
(1999)
Proc. Natl. Acad. Sci. USA
96,
5129-5134 |
| 20. | Hardison, R. , Slightom, J. L. , Gumucio, D. L. , Goodman, M. , Stojanovic, N. & Miller, W. (1997) Gene 205, 73-94[CrossRef][ISI][Medline] . |
| 21. |
Bulger, M.
& Groudine, M.
(1999)
Genes Dev.
13,
2465-2477 |
| 22. | Li, Q. , Harju, S. & Peterson, K. R. (1999) Trends Genet. 15, 403-408[CrossRef][ISI][Medline] . |
| 23. | Grosveld, F. (1999) Curr. Opin. Genet. Dev. 9, 152-157[CrossRef][ISI][Medline] . |
| 24. | Epner, E. , Reik, A. , Cimbora, D. , Telling, A. , Bender, M. , Fiering, S. , Enver, T. , Martin, D. , Kennedy, M. , Keller, G. & Groudine, M. (1998) Mol. Cell. 2, 447-455[CrossRef][ISI][Medline] . |
| 25. |
Reik, A.
, Telling, A.
, Zitnik, G.
, Cimbora, D.
, Epner, E.
& Groudine, M.
(1998)
Mol. Cell. Biol.
18,
5992-6000 |
| 26. | Bender, M. A. , Bulger, M. , Close, J. & Groudine, M. (2000) Mol. Cell. 5, 387-393[CrossRef][ISI][Medline] . |
| 27. | Bepler, G. , O'Briant, K. C. , Kim, Y.-C. , Schreiber, G. & Pitterle, D. M. (1999) Genomics 55, 164-175[CrossRef][Medline] . |
| 28. | Vassar, R. , Chao, S. K. , Sitcheran, R. , Nunez, J. M. , Vosshall, L. B. & Axel, R. (1994) Cell 79, 981-991[CrossRef][ISI][Medline] . |
| 29. | Conklin, D. , Holderman, S. , Whitmore, T. E. , Maurer, M. & Feldhaus, A. L. (2000) Gene 249, 91-98[CrossRef][Medline] . |
| 30. |
Fleenor, D.
& Kaufman, R. E.
(1993)
Blood
81,
2781-2790 |
| 31. | Jackson, J. D. , Miller, W. & Hardison, R. C. (1997) Genomics 39, 90-94[CrossRef][ISI][Medline] . |
| 32. |
Loots, G. G.
, Locksley, R. M.
, Blankespoor, C. M.
, Wang, Z. E.
, Miller, W.
, Rubin, E. M.
& Frazer, K. A.
(2000)
Science
288,
136-140 |
| 33. |
Hinnebusch, A. G.
, Jackson, B. M.
& Mueller, P. P.
(1988)
Proc. Natl. Acad. Sci. USA
85,
7279-7283 |
| 34. |
Cigan, A. M.
, Foiani, M.
, Hannig, E. M.
& Hinnebusch, A. G.
(1991)
Mol. Cell. Biol.
11,
3217-3228 |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg What's this?
This article has been cited by other articles in HighWire Press-hosted journals:
|
|
 |
|
  S. Harju-Baker, F. C. Costa, H. Fedosyuk, R. Neades, and K. R. Peterson Silencing of A{gamma}-Globin Gene Expression during Adult Definitive Erythropoiesis Mediated by GATA-1-FOG-1-Mi2 Complex Binding at the -566 GATA Site Mol. Cell. Biol., May 15, 2008; 28(10): 3101 - 3113. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhu, J. Ling, L. Zhang, W. Pi, M. Wu, and D. Tuan A facilitated tracking and transcription mechanism of long-range enhancer function Nucleic Acids Res., August 17, 2007; (2007) gkm595v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Dostie, T. A. Richmond, R. A. Arnaout, R. R. Selzer, W. L. Lee, T. A. Honan, E. D. Rubio, A. Krumm, J. Lamb, C. Nusbaum, et al. Chromosome Conformation Capture Carbon Copy (5C): A massively parallel solution for mapping interactions between genomic elements Genome Res., October 1, 2006; 16(10): 1299 - 1309. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Michaloski, P. A.F. Galante, and B. Malnic Identification of potential regulatory motifs in odorant receptor genes by analysis of promoter sequences Genome Res., September 1, 2006; 16(9): 1091 - 1098. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Bender, R. Byron, T. Ragoczy, A. Telling, M. Bulger, and M. Groudine Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription Blood, August 15, 2006; 108(4): 1395 - 1401. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bank Regulation of human fetal hemoglobin: new players, new complexities Blood, January 15, 2006; 107(2): 435 - 443. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. King, J. Taylor, L. Elnitski, F. Chiaromonte, W. Miller, and R. C. Hardison Evaluation of regulatory potential and conservation scores for detecting cis-regulatory modules in aligned mammalian genome sequences Genome Res., August 1, 2005; 15(8): 1051 - 1060. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Malnic, P. A. Godfrey, and L. B. Buck The human olfactory receptor gene family PNAS, February 24, 2004; 101(8): 2584 - 2589. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Godfrey, B. Malnic, and L. B. Buck The mouse olfactory receptor gene family PNAS, February 17, 2004; 101(7): 2156 - 2161. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Tanimoto, A. Sugiura, A. Omori, G. Felsenfeld, J. D. Engel, and A. Fukamizu Human {beta}-Globin Locus Control Region HS5 Contains CTCF- and Developmental Stage-Dependent Enhancer-Blocking Activity in Erythroid Cells Mol. Cell. Biol., December 15, 2003; 23(24): 8946 - 8952. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Amadou, R. M. Younger, S. Sims, L. H. Matthews, J. Rogers, A. Kumanovics, A. Ziegler, S. Beck, and K. Fischer Lindahl Co-duplication of olfactory receptor and MHC class I genes in the mouse major histocompatibility complex Hum. Mol. Genet., November 15, 2003; 12(22): 3025 - 3040. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Bulger, D. Schubeler, M. A. Bender, J. Hamilton, C. M. Farrell, R. C. Hardison, and M. Groudine A Complex Chromatin Landscape Revealed by Patterns of Nuclease Sensitivity and Histone Modification within the Mouse {beta}-Globin Locus Mol. Cell. Biol., August 1, 2003; 23(15): 5234 - 5244. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Volz, A. Ehlers, R. Younger, S. Forbes, J. Trowsdale, D. Schnorr, S. Beck, and A. Ziegler Complex Transcription and Splicing of Odorant Receptor Genes J. Biol. Chem., May 23, 2003; 278(22): 19691 - 19701. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Farrell, A. G. West, and G. Felsenfeld Conserved CTCF Insulator Elements Flank the Mouse and Human {beta}-Globin Loci Mol. Cell. Biol., June 1, 2002; 22(11): 3820 - 3831. [Abstract] [Full Text] [PDF]
|
|
X174/HindIII
standards. Total mRNA was derived from two wild-type mice and two mice
homozygous for the deletion of the 
LCR, ref.