Previous Article |
Table of Contents
| Next Article 
* Institute for Medical Microbiology, Immunology and Hygiene,
Technical University of Munich, 81675 Munich, Germany; and
§ Department of Host Defense, Research Institute for
Microbial Diseases, Osaka University, Osaka 565-0871, Japan
Communicated by Johannes van Rood, Europdonor Foundation, Leiden,
The Netherlands, June 11, 2001 (received for review February 2, 2001)
The Toll-like receptor (TLR) family consists of phylogenetically
conserved transmembrane proteins, which function as mediators of innate
immunity for recognition of pathogen-derived ligands and subsequent
cell activation via the Toll/IL-1R signal pathway. Here, we show that
human TLR9 (hTLR9) expression in human immune cells correlates with
responsiveness to bacterial deoxycytidylate-phosphate-deoxyguanylate (CpG)-DNA. Notably "gain of function" to immunostimulatory
CpG-DNA is achieved by expressing TLR9 in human nonresponder cells.
Transfection of either human or murine TLR9 conferred responsiveness in
a CD14- and MD2-independent manner, yet required species-specific
CpG-DNA motifs for initiation of the Toll/IL-1R signal pathway via
MyD88. The optimal CpG motif for hTLR9 was GTCGTT, whereas the optimal murine sequence was GACGTT. Overall, these data suggest that hTLR9 conveys CpG-DNA responsiveness to human cells by directly engaging immunostimulating CpG-DNA.
The immune system has
developed germ-line encoded pattern recognition receptors that promote
rapid responses to microbial pathogens. Cueing on conserved
pathogen-associated molecular patterns not present in the host, cells
of the innate immune system activate and direct the emanating
anti-pathogen response (1). Toll-like receptors (TLRs) are
transmembranal proteins and represent a newly recognized family of
vertebrate pattern recognition receptors (2, 3). Subsequent to
pathogen-associated molecular pattern engagement, TLRs initiate
signaling via sequential recruitment of MyD88, IRAK and TRAF6, which in
turn activate downstream mediators such as NF- Similar to lipopolysaccharide (LPS), bacterial DNA induces acute
inflammatory responses. Bacterial DNA acts as a pathogen-associated molecular pattern by virtue of a 20-fold greater frequency of unmethylated CG dinucleotides found in microbial DNA versus vertebrate DNA (11). Synthetic oligodeoxynucleotides (ODN) containing the proper
CpG-DNA motif mimic the immunostimulatory effects of bacterial DNA
(12). Cellular activation by CpG-DNA occurs via the IL-1R/TLR signal
transduction pathway because it depends on MyD88 and TRAF-6, implying
that the CpG-DNA signaling receptor utilizes a TIR domain (13, 14).
Indeed TLR9-deficient mice express a nonresponsive phenotype to
CpG-DNA, which suggests murine TLR9 (mTLR9) is a CpG-DNA receptor (15).
On the other hand, there is also evidence that DNA-PKcs-deficient mice
are nonresponsive to CpG-DNA and that the DNA-PKcs sequence
specifically recognizes CpG motifs (16).
In mouse models, the potential of CpG-DNA to serve as a Th1 biasing
adjuvant has been well documented (17-19). CpG-DNA also activates
human cells, like dendritic cells and B cells (20, 21). Interestingly,
the optimal CpG motif for activating human cells appears different from
the effective mouse sequence (GTCGTT versus GACGTT) (11, 20, 22). We
show here that expression of human TLR9 (hTLR9) is correlated with
CpG-DNA responsiveness in primary human cells and that transfection of
either hTLR9 or mTLR9 into nonresponsive cells reconstitutes
MyD88-dependent CpG-DNA responses. Transfected hTLR9 and mTLR9 required
distinct CpG motifs for signal initiation, implying they directly
engage immunostimulatory CpG-DNA in a species-specific manner.
Cells and Reagents.
Human embryonic kidney 293 cells were from ATCC. Peripheral blood
mononuclear cells (PBMC), human B cells, CD123+
dendritic cells (DC), and monocyte-derived dendritic cells (MDDC) were
obtained and purified as described elsewhere (20). Escherichia coli LPS (serotype 0127:B8) was from Sigma, Bafilomycin A1 was from Calbiochem-Novabiochem, and IL-1
Immunology
Human TLR9 confers responsiveness to bacterial DNA via
species-specific CpG motif recognition
,
,,
Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
B and
mitogen-activated protein kinases (4, 5). TLR2 and TLR4 transduce
signal via their Toll/interleukin-1 receptor domain (TIR) and are the
receptors for responses to Gram-positive and Gram-negative bacterial
cell wall components (3, 6-10).
Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
and TNF- were from
PeproTech (Boston). ODN were commercially synthesized by TIB MOLBIOL
(Berlin, Germany) in a phosphothioate protected form (see Table
1 for names and sequences). The sequence
of Me-CpG-ODN is identical to ODN 2006, but the cytosines at positions
2, 5, 13, and 21 are methylated. The sequence of the blocking ODN used
for Fig. 3D was 5'-HHHHHHHHHHHHHHWGGGGG (H = A, T, C;
W = A, T).
Table 1.
ODN sequences and ODN concentrations for half-maximal
activation (Kac) of human and
murine TLR9
Reverse Transcriptase (RT)-PCR. RNA from 106 cells was prepared by using RNAeasy kit from Qiagen (Chatsworth, CA). After DNase I treatment, 1 µg of RNA was reverse transcribed with M-MuLV reverse transcriptase from PeqLab, and fragments were amplified with Taq polymerase by using the following primer pairs: hTLR2, 5'-TGTGAACCTCCAGGCTCTG and 5'-GTCCATATTTCCCACTCTCAGG; hTLR4, 5'-ACAGAAGCTGGTGGCTGTG and 5'-TCTTTAAATGCACCTGGTTGG; hTLR9, 5'-GTGCCCCACTTCTCCATG and 5' GGCACAGTCATGATGTTGTTG; mTLR9, 5'-CCGCAAGACTCTATTTGTGCTGG and 5'-TGTCCCTAGTCAGGGCTGTACTCAG; and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5'ACGGATTTGGTCGTATTGGGC and 5'-TTGACGGTGCCATGGAATTTG. cDNA amounts were normalized based on GAPDH amount determined by TaqMAN-PCR (TaqMan probe, 5'-FAM-CCTGGTCACCAGGGCTGCTTT-TAMRA; Applied Biosystems). RT-PCR was performed for 30 cycles on normalized cDNA diluted 1:5 for human TLR2, TLR4, TLR9 and murine TLR9 and diluted 1:125 for GAPDH.
Plasmids and cDNAs. Expression plasmids for human CD14 (hCD14), human TLR4 (hTLR4), and dominant negative human MyD88 (hMyD88-C) were kindly provided from Tularik (South San Francisco, CA). Human MD2 (hMD2) expression plasmid and human TLR9 (hTLR9) cDNA were gifts from Kensuke Miyake (Saga Medical School, Japan) and B. Beutler (Scripps Research Institute, La Jolla, CA), respectively. The ORF of hTLR9 was cloned into pcDNA3.1 (Invitrogen). Murine TLR9 (mTLR9) was amplified from a RAW 264.5 macrophage cDNA using the primers 5'-GTCAGAGGGAGCCTCGGGAGAATCCTC and 5'-GCAGGCAGAGCAACTCGGGAACCAG and cloned into pcDNA3.1. Sequence information of the 5' and 3' untranslated regions for primer selection was obtained by race PCR on a spleen marathon cDNA from CLONTECH. The race PCR was performed utilizing sequence information deposited as est-sequence aa162495, which showed homology to hTLR9.
Transfection and Reporter Assays.
For monitoring transient NF-B activation, 293 cells were seeded at
105 cells per well in a 12-well plate and
transfected by the Ca2PO4 precipitation method (23) with 4 ng of hTLR4 and 4 ng of hMD2, or 50 ng
of hTLR9 expression plasmids and 0.5 ng of 6-fold NF-B luciferase
reporter plasmid and 0.25 µg of 
-galactosidase control plasmid for
normalization. For testing the dominant negative effect of MyD88-C, 293 cells stably expressing hTLR9 were transiently transfected with
increasing amounts of MyD88-C (8-250 ng), 0.5 ng of 6-fold NF-B
luciferase reporter plasmid, and 0.25 µg of -galactosidase control
plasmid. For measuring IL-8 production, 293 cells were seeded at
1.5 × 104 cells per well in a 96-well plate
and transfected with 400 ng of DNA per well by
Ca2PO4 transfection (24).
The vectors expressing hTLR9, hTLR4, hMD2, and hCD14 were used at 4 ng
per transfection plus noncoding vector DNA to give the final amount of
400 ng. After 18 h, the cells were treated with various stimuli
for 48 h, and the supernatant was harvested. Stable clones
expressing hTLR9, mTLR9, or TLR9 with a 6-fold NF-B luciferase
reporter plasmid were selected with 0.7 mg/ml G418. For monitoring of
NF-B activation or IL-8 production, cells were seeded at
104 cells per well and stimulated 16 h
later; NF-B activation or IL-8 production was monitored 12 or
48 h after stimulation, respectively. For monitoring NF-B
activation, 293 cells were lysed by using reporter lysis buffer
(Promega), and lysate was assayed for luciferase activity by using a
Berthold luminometer (Wildbad, Germany). Human IL-8 production was
monitored by ELISA using matched-pair antibodies and standard IL-8 (BD
Transduction Laboratories, San Diego) according to the manufacturer's protocol.
, human IL-8, and human
or murine IL-12p40, CD123+ DC, MDCC, PBMC, or
murine spleen cells were seeded in 24-well plates in 1 ml at 2 × 105 cells, 106 cells,
5 × 106 cells, and 2.5 × 105 cells per well, respectively. Supernatants
were harvested after 12 h (for TNF-) and 16 h (for IL-12
and IL-8), and cytokines were measured by ELISA using matched-pair
antibodies and standard from BD Transduction Laboratories. Monitoring
of B-cell proliferation has been described elsewhere (20).
| |
Results |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
hTLR9 Expression Correlates with CpG-DNA Responsiveness. Bacterial DNA is mitogenic for human B cells; however, LPS is not. Fig. 1A demonstrates that human B cells proliferate after stimulation with E. coli DNA or a CpG-ODN but not in response to digested E. coli DNA, control GpC-ODN, or LPS. We also observed that plasmacytoid DC (CD123+DC) produced IL-8 and TNF (data not shown) in response to CpG-DNA in a CpG motif-restricted manner but not LPS (Fig. 1A). In contrast, MDDC demonstrated the converse response pattern (Fig. 1A), a response to LPS but not CpG-DNA. Thus, responses to CpG-DNA or LPS segregated between B cells and CD123+DC or MDDC, respectively. We therefore tested whether absence of responsiveness correlated to absence of TLR expression. By semiquantitative RT-PCR, both B cells and CD123+DC yielded positive signals for hTLR9, whereas MDDC, monocytes, and T cells appeared weak to negative (Fig. 1B). LPS-responsive MDDC and monocytes were positive for both TLR2 and TLR4, whereas B cells, T cells, and CD123+DC were weak to negative (Fig. 1B). These data suggest a clear correlation between hTLR9 mRNA expression and responsiveness to CpG-DNA or hTLR2/hTLR4 expression and LPS responsiveness.
|
hTLR9 Genetic Complementation Yields CpG-DNA Responsiveness.
We next determined whether hTLR9 genetic complementation confers
CpG-DNA responsiveness to nonresponder cells. hTLR9-transfected 293 cells were responsive to CpG-ODN but not the control GpC-ODN, whereas
hTLR4-transfected cells gained responsiveness to LPS (Fig. 2 A and B). These
data demonstrate the CpG-DNA specificity of the hTLR9-dependent
response and noncrossreactivity between hTLR9 or hTLR4 and their
respective ligands. Because CpG-DNA and LPS responsiveness segregated
with TLR genetic complementation and because LPS responses are
dependent on the coexpression of MD2 and CD14 (7, 25, 26), we asked
whether hTLR9 shared CD14 or MD2 dependency. Cotransfection of TLR9
with either human MD2 or CD14, however, had little consequence on IL-8
production or NF-B activation (Fig. 2C and data not
shown). In contrast, hTLR4 cotransfection with MD2 alone dramatically
improved LPS responsiveness, whereas the addition of CD14 was
potentiating, especially at lower LPS concentrations. We concluded that
unlike TLR4 responses to LPS, hTLR9 responses to CpG-DNA were
independent of both MD2 and CD14.
|
Genetic Complementation of 293 Cells with hTLR9 Recapitulates
CpG-DNA Mechanisms of Action.
We next established stable human TLR9 positive clones plus or minus an
NF-B luciferase reporter, 293-hTLR9 or 293-hTLR9-luc, respectively
(see Materials and Methods). These cells showed reactivity to CpG-DNA and not LPS in a CpG motif-dependent manner as the methylation of CpG-DNA or inversion of the CpG ablated responsiveness (Fig. 3A). The 293-hTLR9-luc
cells were also dose-dependently responsive to bacterial DNA and mute
toward Dnase I-digested DNA (Fig. 3B). Similar data were
obtained through monitoring IL-8 production and were reproducible with
phosphodiester-linked ODN (data not shown). We also tested whether DNA
uptake and endosomal maturation were required for signal initiation by
CpG-DNA, as has been reported for wild-type cells (27). Interrupting
endosomal maturation with Bafilomycin A (28) fully blocked
CpG-ODN-mediated induction of NF-B (Fig. 3C). The
blockade was specific to CpG-DNA, as both IL-1 and TNF induction of
NF-B were unaffected. We have previously postulated that a receptor
not dependent on a CpG motif translocates DNA into the
endosomal/lysosomal compartment because nonactivating ODN block the
cellular uptake of immunostimulatory CpG-ODN (27). Fig. 3D
demonstrates that 293-hTLR9-luc cells were sensitive to blockade with a
non-CpG-ODN. Based on these criteria, we concluded that 293 cells
complemented with hTLR9 behave similar to CpG-DNA responsive wild-type
cells.
|
B induction but not TNF-induced signal
transduction in 293-hTLR9 cells. These data established a central role
for MyD88 in CpG-DNA signaling and thus implied engagement of the
Toll/IL-1R signal transduction pathway in human cells responsive to
CpG-DNA.
TLR9 Confers Species-Specific CpG Motif Signaling. Human primary cells have been shown to respond to the CpG motif GTCGTT, whereas primary murine cells respond best to GACGTT (11, 20, 22). As shown in Fig. 4A, titration of the optimal human ODN-2006 on human PBMC dose dependently induced IL-12, whereas the optimal murine ODN-1668 was poor. In contrast, murine splenocytes responded best to ODN-1668 and to a lesser extent toward ODN-2006 (Fig. 4B). Assuming that the ODN concentration yielding half-maximal cytokine production reflects receptor affinity, the affinity of murine splenocytes for ODN-1668 was apparently greater than that of human PBMC for ODN-2006 (compare Fig. 4 A and B).
|
B driven luciferase by the human
ODN-2006 or the murine ODN-1668 in either 293-hTLR9-luc or
293-mTLR9-luc cells, whereas Fig. 4D depicts the respective
IL-8 responses. Strikingly, CpG motif sequence specificity was granted
in a species-specific manner by TLR9. In addition, the half-maximal
concentration for either ODN-2006 or ODN-1668 appeared nearly identical
to that determined by IL-12 release from primary cells (compare Fig. 4 A or B with C and D). These
data suggested that TLR9 confers species-specific CpG motif
responsiveness, implying that TLR9 acts as the CpG-DNA receptor.
TLR9 Determines CpG-ODN Affinity. If indeed TLR9 acts as the CpG-DNA receptor, TLR9 ought to determine CpG-ODN affinity. Because all measurements of species specificity had been performed by using two dissimilar sequences, human ODN-2006 or murine ODN-1668 (22), we produced several sequences attempting a stepwise progression from the mouse sequence to the human sequence. The ODN-5002 is like ODN-1668 with the exception that Cs at positions 12 and 19 have been converted to Ts (Table 1). The last 16 nucleotides of ODN-5007 are the same as the last 15 nucleotides of ODN-2006 with the exception of an additional T (Table 1). Similar to ODN titrations in Fig. 4, we titrated these ODN versus either 293-hTLR9-luc or 293-mTLR9-luc cells to determine whether species specificity was preserved and to establish ODN concentration of half-maximal activation (Kac) (Table 1). The Kac displayed by the 293-hTLR9-luc clone strengthened with progressive nucleotide substitutions converting the mouse sequence toward the human sequence (Table 1, progression from 5000 to 5007). The reverse was true for the 293-mTLR9-luc clone, which showed a weakened Kac throughout the same progression. These results confirmed the notion that the preferred mouse motif contains ACG, whereas the human sequence is TCG. Of additional interest, we have observed that a CA substitution converting the mouse CpG motif from GACGTTC to GACGTCA was deleterious (data not shown). To extend our examination of the motif, we created three more ODN and measured Kac (5008-5010, Table 1). The change from CGTT to CGTC ablated 293-mTLR9-luc cell responsiveness. Overall, these data strongly suggest direct CpG motif engagement by TLR9.
| |
Discussion |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Activation of murine innate immune cells by CpG-DNA occurs via the Toll/IL-1R signal pathway, suggesting that the CpG-DNA receptor utilizes a TIR domain for the sequential recruitment of MyD88 and TRAF-6 (13, 14). Supporting this concept, TLR9-deficient mice express a nonresponsive phenotype toward CpG-DNA, implying TLR9 as a major component of the CpG-DNA receptor (15). This conclusion, however, has been subsequently challenged by the observation that DNA-PKcs deficient mice are also nonresponsive to CpG-DNA (16).
Based on the data presented here, it would seem clear that
immunostimulatory CpG-DNA is engaged by TLR9. First, the distribution of hTLR9 in primary human cells correlated with CpG-DNA responsiveness (Fig. 1). Second, genetic complementation of CpG-DNA nonresponder cells
with either hTLR9 or mTLR9 yielded a gain of function phenotype (Figs.
2-4). Last, both hTLR9 and mTLR9 appear to directly interact with
CpG-DNA, as not only CpG restriction but also dose-dependent CpG motif
species specificity was conferred through TLR9 (Fig. 4 and Table 1).
Combined with the observations made in TLR9-deficient mice, these data
clearly demonstrate TLR9 as necessary and sufficient for CpG-DNA driven
responses. Because DNA-PKcs is ubiquitously expressed (29), one may
assume TLR9
/ mice and 293 cells are positive
for DNA-PKcs; yet, both were nonresponsive to CpG-DNA. Even though
DNA-PKcs/ mice showed a partial loss of
CpG-DNA responder phenotype (16, 30), our genetic complementation data
suggest that DNA-PKcs may be necessary for signaling but not
sufficient. In support, mice deficient for CpG-DNA receptor signaling
mediators, such as MyD88/ mice, displayed a
nonresponder phenotype (13, 31, 32). Loss of any downstream mediator
would interrupt signaling, yet alone it could not restore function to a
receptor-deficient system. The notion of DNA-PKcs as a candidate
CpG-DNA receptor also conflicts with the finding that SCID mice,
because of a mutation-induced truncation (33, 34), are deficient in
DNA-PKcs yet respond in vivo to CpG-DNA with the release of
serum cytokines and succumb to TNF-driven toxic shock (35, 36). Serum
cytokine release and toxic shock after in vivo CpG-DNA
challenge were absent in TLR9/ mice (15).
Whether DNA-PKcs is auxiliary to TLR9 in CpG-DNA signaling or part of
an ill-defined signaling pathway is yet unanswered.
We observed in human immune cells a correlation between hTLR9 or hTLR2/hTLR4 expression and CpG-DNA or LPS sensitivity, respectively. For example, primary human plasmacytoid DCs and B cells expressed hTLR9 but minimal hTLR2/hTLR4 and were responsive to CpG-DNA but not to LPS. On the other hand, MDDCs showed converse TLR expression and pattern of responsiveness (Fig. 1). TLR2 and TLR4 mRNA expression in monocytes and MDDC but not B cells has been described (37-39). TLR1-5 were shown to be differentially expressed on various immune cells, whereas monocytes and immature MDDC differentially regulated TLR1-6 upon stimulation (37-39). It is thus tempting to speculate that the immune system can integrate infectious signals via TLR by virtue of receptor density and/or cellular distribution and thus tailor the emanating adaptive immune responses.
CpG-DNA nonresponsive 293 cells recapitulated upon TLR9 genetic
complementation the bacterial DNA and CpG-DNA response phenotype previously established for primary DCs and macrophages (12). On
stimulation with CpG-DNA, these cells activated NF-B and produced the cytokine IL-8 (Figs. 2-4). Furthermore, CpG-DNA initiated
signaling was ablated through blockade of cellular uptake by
non-CpG-ODN or by Bafilomycin A, which blocks endosomal maturation
(Fig. 3 C and D) (28). Finally, hTLR9 initiated
signaling flows into the Toll/IL-1R signal pathway, as it depends on
MyD88 (Fig. 3E). Similar data were obtained by hTLR9
complementation of the CpG-DNA nonresponsive human HL-60 cells (data
not shown). Overall, these data suggested that hTLR9 grants "gain of
function" to CpG-DNA with fidelity previously established for
primary CpG-DNA responsive immune cells.
Signaling by hTLR9-reconstituted 293 cells was independent of the coreceptors MD2 and CD14 (Fig. 2), a characteristic that separates TLR9 from TLR4 (7, 25) and TLR2 (26). Expression of both MD2 and CD14 is regulated, which influences cellular responsiveness to bacterial substances. It is thus curious that TLR9 does not require either of these helper components. One explanation may be differences in the ligand character. For example, the well characterized ligands for TLR2 or TLR4 are hydrophobic in nature, forming micellular structures, whereas CpG-DNA is hydrophilic and fully water-soluble. Whether TLR9 is assisted by a modulated coreceptor is not clear; however, TLR9 alone was sufficient to reconstitute CpG-DNA responses in 293 cells.
The human optimal CpG motif GTCGTT differs from the optimal murine CpG motif GACGTT (11, 20, 22, 40). Because the genetic complementation system allowed the use of either human or murine TLR9, we were in the position to analyze whether TLR9 confers species-specific CpG motif signaling. Unambiguously, hTLR9 recognized the human CpG motif most efficiently, whereas mTLR9 had a high preference for the murine CpG motif (Fig. 4). This suggested direct interactions of the TLR9 receptor with its CpG-DNA ligand. In support, CpG-ODN point mutated in a manner that the individual ODN progressed from a murine to human CpG motif displayed inverse Kac toward hTLR9 and mTLR9, respectively (Table 1). Additionally, the extracellular region of TLR9 contains a DNA-binding motif described to occur in a family of methylated CpG-DNA binding proteins, MBD-1-4 (41, 42). Point mutations of this motif in TLR9 destroyed CpG-DNA driven responses (S.B. and G.B.L., unpublished data). Taken together, these data strongly implicate TLR9 as the receptor for CpG-DNA by directly engaging its ligand. Genetic complementation has also revealed direct interaction of TLR4 and LPS (43). In contrast to Drosophila where infection activates a proteolytic cascade producing an endogenous ligand (spaetzle) that engages Toll (44), in mammals the Toll receptors seem to directly interact with their respective microbial ligands.
The TLR9 complementation system described here may be useful to optimize species-specific immunostimulatory CpG motifs because we show that TLR9 prefers a mouse motif containing ACG, whereas hTLR9 prefers the sequence TCG. In addition, the conserved pyrimidine for pyrimidine change T to C in the mouse motif, ACGTT versus ACGTC (Table 1, ODN 5002 versus 5009), completely destroyed recognition by mTLR9. We therefore propose that the TLR9 genetic complementation system will allow definition of species-specific CpG motifs useful as vaccine adjuvants not only in man but also in diverse animal species.
| |
Acknowledgements |
|---|
We acknowledge B. Beutler for kindly providing human TLR9 cDNA, P. Baeuerle for providing 6-fold NF/B luciferase reporter plasmid,
and K. Miyake for providing human MD2 expression plasmid. We thank T. Gellert, F. Ampenberger, and S. Fichte for excellent technical
assistance. We thank H. Hemmi for helpful discussion. This work was
supported by Deutsche Forschungsgemeinschaft Grants BA1618/2-1 and
KI591/1-2 Bundesministerium für Bildung und Forschung, Forschungsverbund Grundlagen Gentechnischer Verfahren (FORGEN II),
Sonderforschungsbereich SFB-1738, and Coley Pharmaceutical Group GmbH.
| |
Abbreviations |
|---|
TLR, Toll-like receptor; LPS, lipopolysaccharide; CpG, deoxycytidylate-phosphate-deoxyguanylate; DC, dendritic cell; ODN, oligodeoxynucleotides; PBMC, peripheral blood mononuclear cells; MDDC, monocyte-derived dendritic cells; RT, reverse transcriptase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
| |
Footnotes |
|---|
S.B. and C.J.K. contributed equally to this work.
To whom reprint requests should be addressed.
E-mail: G.B.Lipford{at}lrz.tum.de or stefan.bauer{at}lrz.tum.de.
Data deposition: The sequence reported in this paper has been deposited in the GenBank database (accession no. AF348140).
| |
References |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Medzhitov, R. & Janeway, C. A., Jr. (1997) Curr. Opin. Immunol. 9, 4-9. |
| 2. | Rock, F. L. , Hardiman, G. , Timans, J. C. , Kastelein, R. A. & Bazan, J. F. (1998) Proc. Natl. Acad. Sci. USA 95, 588-593. |
| 3. | Aderem, A. & Ulevitch, R. J. (2000) Nature (London) 406, 782-787. |
| 4. | Medzhitov, R. , Preston-Hurlburt, P. , Kopp, E. , Stadlen, A. , Chen, C. , Ghosh, S. & Janeway, C. A., Jr. (1998) Mol. Cell 2, 253-258. |
| 5. | Muzio, M. , Polentarutti, N. , Bosisio, D. , Manoj Kumar, P. P. & Mantovani, A. (2000) Biochem. Soc. Trans. 28, 563-566. |
| 6. | Poltorak, A. , He, X. , Smirnova, I. , Liu, M. Y. , Huffel, C. V. , Du, X. , Birdwell, D. , Alejos, E. , Silva, M. , Galanos, C. , et al. (1998) Science 282, 2085-2088. |
| 7. | Lien, E. , Chow, J. C. , Hawkins, C. D. , McGuiness, P. D. , Miyake, K. , Espevik, T. , Gusovsky, F. & Golenbock, D. T. (2001) J. Biol. Chem. 276, 1873-1880. |
| 8. | Schwandner, R. , Dziarski, R. , Wesche, H. , Rothe, M. & Kirschning, C. J. (1999) J. Biol. Chem. 274, 17406-17409. |
| 9. | Yoshimura, A. , Lien, E. , Ingalls, R. R. , Tuomanen, E. , Dziarski, R. & Golenbock, D. (1999) J. Immunol. 163, 1-5. |
| 10. | Takeuchi, O. , Hoshino, K. , Kawai, T. , Sanjo, H. , Takada, H. , Ogawa, T. , Takeda, K. & Akira, S. (1999) Immunity 11, 443-451. |
| 11. | Krieg, A. M. , Yi, A. K. , Matson, S. , Waldschmidt, T. J. , Bishop, G. A. , Teasdale, R. , Koretzky, G. A. & Klinman, D. M. (1995) Nature (London) 374, 546-549. |
| 12. | Wagner, H. (1999) Adv. Immunol. 73, 329-368. |
| 13. | Hacker, H. , Vabulas, R. M. , Takeuchi, O. , Hoshino, K. , Akira, S. & Wagner, H. (2000) J. Exp. Med. 192, 595-600. |
| 14. | Schnare, M. , Holtdagger, A. C. , Takeda, K. , Akira, S. & Medzhitov, R. (2000) Curr. Biol. 10, 1139-1142. |
| 15. | Hemmi, H. , Takeuchi, O. , Kawai, T. , Kaisho, T. , Sato, S. , Sanjo, H. , Matsumoto, M. , Hoshino, K. , Wagner, H. , Takeda, K. , et al. (2000) Nature (London) 408, 740-745. |
| 16. | Chu, W. , Gong, X. , Li, Z. , Takabayashi, K. , Ouyang, H. , Chen, Y. , Lois, A. , Chen, D. J. , Li, G. C. , Karin, M. , et al. (2000) Cell 103, 909-918. |
| 17. | Lipford, G. B. , Bauer, M. , Blank, C. , Reiter, R. , Wagner, H. & Heeg, K. (1997) Eur. J. Immunol. 27, 2340-2344. |
| 18. | Chu, R. S. , Targoni, O. S. , Krieg, A. M. , Lehmann, P. V. & Harding, C. V. (1997) J. Exp. Med. 186, 1623-1631. |
| 19. | Carson, D. A. & Raz, E. (1997) J. Exp. Med. 186, 1621-1622. |
| 20. | Bauer, M. , Heeg, K. , Wagner, H. & Lipford, G. B. (1999) Immunology 97, 699-705. |
| 21. | Hartmann, G. , Weiner, G. J. & Krieg, A. M. (1999) Proc. Natl. Acad. Sci. USA 96, 9305-9310. |
| 22. | Hartmann, G. , Weeratna, R. D. , Ballas, Z. K. , Payette, P. , Blackwell, S. , Suparto, I. , Rasmussen, W. L. , Waldschmidt, M. , Sajuthi, D. , Purcell, R. H. , et al. (2000) J. Immunol. 164, 1617-1624. |
| 23. | Regnier, C. H. , Song, H. Y. , Gao, X. , Goeddel, D. V. , Cao, Z. & Rothe, M. (1997) Cell 90, 373-383. |
| 24. | Chen, C. & Okayama, H. (1987) Mol. Cell. Biol. 7, 2745-2752. |
| 25. | Shimazu, R. , Akashi, S. , Ogata, H. , Nagai, Y. , Fukudome, K. , Miyake, K. & Kimoto, M. (1999) J. Exp. Med. 189, 1777-1782. |
| 26. | Dziarski, R. , Wang, Q. , Miyake, K. , Kirschning, C. J. & Gupta, D. (2001) J. Immunol. 166, 1938-1944. |
| 27. | Hacker, H. , Mischak, H. , Miethke, T. , Liptay, S. , Schmid, R. , Sparwasser, T. , Heeg, K. , Lipford, G. B. & Wagner, H. (1998) EMBO J. 17, 6230-6240. |
| 28. | Yoshimori, T. , Yamamoto, A. , Moriyama, Y. , Futai, M. & Tashiro, Y. (1991) J. Biol. Chem. 266, 17707-17712. |
| 29. | Smith, G. C. & Jackson, S. P. (1999) Genes Dev. 13, 916-934. |
| 30. | Aderem, A. & Hume, D. A. (2000) Cell 103, 993-996. |
| 31. | Adachi, O. , Kawai, T. , Takeda, K. , Matsumoto, M. , Tsutsui, H. , Sakagami, M. , Nakanishi, K. & Akira, S. (1998) Immunity 9, 143-150. |
| 32. | Kawai, T. , Adachi, O. , Ogawa, T. , Takeda, K. & Akira, S. (1999) Immunity 11, 115-122. |
| 33. | Blunt, T. , Gell, D. , Fox, M. , Taccioli, G. E. , Lehmann, A. R. , Jackson, S. P. & Jeggo, P. A. (1996) Proc. Natl. Acad. Sci. USA 93, 10285-10290. |
| 34. | Danska, J. S. , Holland, D. P. , Mariathasan, S. , Williams, K. M. & Guidos, C. J. (1996) Mol. Cell. Biol. 16, 5507-5517. |
| 35. | Lipford, G. B. , Sparwasser, T. , Bauer, M. , Zimmermann, S. , Koch, E. S. , Heeg, K. & Wagner, H. (1997) Eur. J. Immunol. 27, 3420-3426. |
| 36. | Sparwasser, T. , Miethke, T. , Lipford, G. , Erdmann, A. , Hacker, H. , Heeg, K. & Wagner, H. (1997) Eur. J. Immunol. 27, 1671-1679. |
| 37. | Muzio, M. , Bosisio, D. , Polentarutti, N. , D'amico, G. , Stoppacciaro, A. , Mancinelli, R. , van't Veer, C. , Penton-Rol, G. , Ruco, L. P. , Allavena, P. , et al. (2000) J. Immunol. 164, 5998-6004. |
| 38. | Muzio, M. , Polentarutti, N. , Bosisio, D. , Prahladan, M. K. & Mantovani, A. (2000) J. Leukocyte Biol. 67, 450-456. |
| 39. | Visintin, A. , Mazzoni, A. , Spitzer, J. H. , Wyllie, D. H. , Dower, S. K. & Segal, D. M. (2001) J. Immunol. 166, 249-255. |
| 40. | Modlin, R. L. (2000) Nature (London) 408, 659-660. |
| 41. | Hendrich, B. & Bird, A. (1998) Mol. Cell. Biol. 18, 6538-6547. |
| 42. | Fujita, N. , Shimotake, N. , Ohki, I. , Chiba, T. , Saya, H. , Shirakawa, M. & Nakao, M. (2000) Mol. Cell. Biol. 20, 5107-5118. |
| 43. | Poltorak, A. , Ricciardi-Castagnoli, P. , Citterio, S. & Beutler, B. (2000) Proc. Natl. Acad. Sci. USA 97, 2163-2167. (First Published February 18, 2000; 10.1073/pnas.040565397) |
| 44. | Lemaitre, B. , Nicolas, E. , Michaut, L. , Reichhart, J. M. & Hoffmann, J. A. (1996) Cell 86, 973-983. |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg What's this?
This article has been cited by other articles in HighWire Press-hosted journals:
|
|
 |
|
  J. West and B. Damania Upregulation of the TLR3 Pathway by Kaposi's Sarcoma-Associated Herpesvirus during Primary Infection J. Virol., June 1, 2008; 82(11): 5440 - 5449. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Knuefermann, M. Schwederski, M. Velten, P. Krings, H. Ehrentraut, M. Rudiger, O. Boehm, K. Fink, U. Dreiner, C. Grohe, et al. Bacterial DNA induces myocardial inflammation and reduces cardiomyocyte contractility: role of Toll-like receptor 9 Cardiovasc Res, April 1, 2008; 78(1): 26 - 35. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Forsbach, J.-G. Nemorin, C. Montino, C. Muller, U. Samulowitz, A. P. Vicari, M. Jurk, G. K. Mutwiri, A. M. Krieg, G. B. Lipford, et al. Identification of RNA Sequence Motifs Stimulating Sequence-Specific TLR8-Dependent Immune Responses J. Immunol., March 15, 2008; 180(6): 3729 - 3738. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F.-x. Wang, J. Huang, H. Zhang, X. Ma, and H. Zhang APOBEC3G upregulation by alpha interferon restricts human immunodeficiency virus type 1 infection in human peripheral plasmacytoid dendritic cells J. Gen. Virol., March 1, 2008; 89(3): 722 - 730. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. B. Anderson, G. J. Cianciolo, M. N. Kennedy, and S. V. Pizzo {alpha}2-Macroglobulin binds CpG oligodeoxynucleotides and enhances their immunostimulatory properties by a receptor-dependent mechanism J. Leukoc. Biol., February 1, 2008; 83(2): 381 - 392. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. B. Fenske, A. Chonn, and P. R. Cullis Liposomal Nanomedicines: An Emerging Field Toxicol Pathol, January 1, 2008; 36(1): 21 - 29. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sivori, M. Falco, S. Carlomagno, E. Romeo, L. Moretta, and A. Moretta Heterogeneity of TLR3 mRNA transcripts and responsiveness to poly (I:C) in human NK cells derived from different donors Int. Immunol., December 1, 2007; 19(12): 1341 - 1348. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Leonard, B. K. Link, C. Emmanouilides, S. A. Gregory, D. Weisdorf, J. Andrey, J. Hainsworth, J. A. Sparano, D. E. Tsai, S. Horning, et al. Phase I Trial of Toll-Like Receptor 9 Agonist PF-3512676 with and Following Rituximab in Patients with Recurrent Indolent and Aggressive Non Hodgkin's Lymphoma Clin. Cancer Res., October 15, 2007; 13(20): 6168 - 6174. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. V. Girart, M. B. Fuertes, C. I. Domaica, L. E. Rossi, and N. W. Zwirner Engagement of TLR3, TLR7, and NKG2D Regulate IFN-{gamma} Secretion but Not NKG2D-Mediated Cytotoxicity by Human NK Cells Stimulated with Suboptimal Doses of IL-12 J. Immunol., September 15, 2007; 179(6): 3472 - 3479. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Schroder, M. Spille, A. Pilz, J. Lattin, K. A. Bode, K. M. Irvine, A. D. Burrows, T. Ravasi, H. Weighardt, K. J. Stacey, et al. Differential Effects of CpG DNA on IFN-beta Induction and STAT1 Activation in Murine Macrophages versus Dendritic Cells: Alternatively Activated STAT1 Negatively Regulates TLR Signaling in Macrophages J. Immunol., September 15, 2007; 179(6): 3495 - 3503. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ivanov, A.-M. Dragoi, X. Wang, C. Dallacosta, J. Louten, G. Musco, G. Sitia, G. S. Yap, Y. Wan, C. A. Biron, et al. A novel role for HMGB1 in TLR9-mediated inflammatory responses to CpG-DNA Blood, September 15, 2007; 110(6): 1970 - 1981. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wang, G. Roderiquez, T. Jones, P. McPhie, and M. A. Norcross Control of In Vitro Immune Responses by Regulatory Oligodeoxynucleotides through Inhibition of pIII Promoter Directed Expression of MHC Class II Transactivator in Human Primary Monocytes J. Immunol., July 1, 2007; 179(1): 45 - 52. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Tran, A. Koch, R. Berkels, O. Boehm, P. A. Zacharowski, G. Baumgarten, P. Knuefermann, M. Schott, W. Kanczkowski, S. R. Bornstein, et al. Toll-Like Receptor 9 Expression in Murine and Human Adrenal Glands and Possible Implications during Inflammation J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2773 - 2783. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Leppert, J. M. Mansfield, and D. M. Paulnock The Soluble Variant Surface Glycoprotein of African Trypanosomes Is Recognized by a Macrophage Scavenger Receptor and Induces I{kappa}B{alpha} Degradation Independently of TRAF6-Mediated TLR Signaling J. Immunol., July 1, 2007; 179(1): 548 - 556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Schroder, M. Lichtinger, K. M. Irvine, K. Brion, A. Trieu, I. L. Ross, T. Ravasi, K. J. Stacey, M. Rehli, D. A. Hume, et al. PU.1 and ICSBP control constitutive and IFN-{gamma}-regulated Tlr9 gene expression in mouse macrophages J. Leukoc. Biol., June 1, 2007; 81(6): 1577 - 1590. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Forster, S. Gallinat, J. Jablonska, S. Weiss, H.-P. Elsasser, and W. Lutz p300 Protein Acetyltransferase Activity Suppresses Systemic Lupus Erythematosus-Like Autoimmune Disease in Mice J. Immunol., June 1, 2007; 178(11): 6941 - 6948. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Keestra, M. R. de Zoete, R. A. M. H. van Aubel, and J. P. M. van Putten The Central Leucine-Rich Repeat Region of Chicken TLR16 Dictates Unique Ligand Specificity and Species-Specific Interaction with TLR2 J. Immunol., June 1, 2007; 178(11): 7110 - 7119. [Abstract] [Full Text] [PDF]
|
|
) or stimulated with 2 µM
CpG-ODN (2006) (
) or 10 ng/ml TNF-
), and
NF-
)
at the indicated concentrations, and IL-12 production was monitored by
ELISA (n = 2, mean ± SD). The 293 cells
stably transfected with a 6-fold NF-