Cysteinyl-tRNA synthetase is not essential for viability of the archaeon Methanococcus maripaludis
- Constantinos Stathopoulos*,
- Wonduck Kim†,
- Tong Li*,
- Iain Anderson†,
- Britta Deutsch†,
- Sotiria Palioura*,
- William Whitman†, and
- Dieter Söll*,‡,§
- Departments of *Molecular Biophysics and Biochemistry, and ‡Chemistry, Yale University, New Haven, CT 06520-8114; and †Department of Microbiology, University of Georgia, Athens, GA 30602-2605
-
Contributed by Dieter Söll
Abstract
The methanogenic archaea Methanocaldococcus jannaschii and Methanothermobacter thermautotrophicus contain a dual-specificity prolyl-tRNA synthetase (ProCysRS) that accurately forms both prolyl-tRNA (Pro-tRNA) and cysteinyl-tRNA (Cys-tRNA) suitable for in vivo translation. This intriguing enzyme may even perform its dual role in organisms that possess a canonical single-specificity cysteinyl-tRNA synthetase (CysRS), raising the question as to whether this latter aminoacyl-tRNA synthetase is indeed required for cell viability. To test the postulate that all synthetase genes are essential, we disrupted the cysS gene (encoding CysRS) of Methanococcus maripaludis. The knockout strain was viable under normal growth conditions. Biochemical analysis showed that the pure M. maripaludis ProCysRS was capable of forming Cys-tRNA, implying that the dual-specificity enzyme compensates in vivo for the loss of CysRS. The canonical CysRS has a higher affinity for cysteine than ProCysRS, a reason why M. maripaludis may have acquired cysS by a late lateral gene transfer. These data challenge the notion that all twenty aminoacyl-tRNA synthetases are essential for the viability of a cell.
Prior to the availability of genomic sequences, aminoacyl-tRNA synthetases (AARSs) were believed to consist of a family of twenty highly conserved enzymes found in all organisms (1). They were divided into two classes (I and II) of ten members each, based on the presence of mutually exclusive amino acid sequence motifs that reflected structurally distinct topologies of the active site. These conserved features allow the facile recognition of AARS genes by sequence similarity searches of the known organismal genomes. In addition, the two classes differ in the way they bind their substrates. Whereas the class I enzymes approach the minor groove side of the tRNA's acceptor helix, the class II enzymes bind to the major groove side (1). Based on these idiosyncrasies, an aminoacyl-tRNA synthetase of particular substrate specificity was always believed to belong to the same class regardless of its biological source, reflecting the ancient origin of this enzyme family. The process of amino acid attachment to tRNA is further refined in some synthetases by editing mechanisms that enhance amino acid selection and contribute to the overall quality control during protein synthesis (2). Because faithful translation is indispensable for viability of organisms, all twenty members of the AARS family were thought to be essential.
Research in the last few years revealed that, whereas translation certainly requires a full complement of AA-tRNAs, their synthesis is not always catalyzed by the complete set of twenty canonical AARS enzymes (3). The most frequent exception is the formation of Asn-tRNA and Gln-tRNA; their synthesis is accomplished in most bacteria, in all archaea, and also in some organelles by an indirect route involving transamidation of misacylated tRNA in contrast to the direct acylation by asparaginyl-tRNA synthetase or glutaminyl-tRNA synthetase (4, 5). tRNA-dependent transamidation may also represent in some organisms the sole route to asparagine synthesis (6, 7). Whole genome sequence analyses have failed to identify genes encoding two other AARSs in some organisms. The lack of a recognizable LysRS in most archaea was explained by the discovery of a novel class I-type synthetase, which was unrelated to the class II-type lysyl-tRNA synthetase previously characterized in bacteria and eukaryotes (8). The absence of a canonical class I cysteinyl-tRNA synthetase (CysRS) in the genomes of the thermophilic archaea Methanocaldococcus (Methanococcus) jannaschii (9) and Methanothermobacter (Methanobacterium) thermautotrophicus (10) was an additional puzzle. Subsequent biochemical experimentation revealed that CysRS was indeed absent and instead, cysteinyl-tRNA (Cys-tRNA) was synthesized by a dual-specificity prolyl-tRNA synthetase (11, 12), termed ProCysRS (13). The presence of synthetases with relaxed substrate specificity is assumed to have been a step in AARS evolution (11, 14). Recently, the dual-specificity ProCysRS was also shown to be present in Giardia lamblia (15), which represents an ancient lineage of the eukaryotes, and the extremely thermophilic bacterium Thermus thermophilus (16). However, both of these organisms also possess a canonical CysRS. These observations raised the question of whether the dual-specificity enzyme was sufficient for Cys-tRNA biosynthesis in organisms with both enzymes.
Previous studies have suggested that the mesophilic archaeon Methanococcus maripaludis, which contains a canonical CysRS (17), also possessed a ProCysRS because a temperature-sensitive Escherichia coli cysS mutant could be rescued by the methanococcal proS gene (11). Because M. maripaludis is a genetically tractable archaeon (18), we wanted to test whether the ProCysRS was sufficient for Cys-tRNA synthesis in vivo, as it appears to be in the hyperthermophile M. jannaschii. If the dual-specificity enzyme was sufficient, we predicted that the cysS gene, which encodes the canonical CysRS enzyme, would not be essential for growth. Here, we document the viability of a mutant of M. maripaludis where the cysS gene has been disrupted, and propose that the presence of a functional proS gene is the minimum requirement for Cys-tRNA synthesis in this archaeon.
Materials and Methods
Construction of the Integration Vectors for M. maripaludis.
The integration vector pIJA03 was based on the E. coli plasmid pUC and lacks a suitable replication origin for the methanococci. It contains the pac cassette, which encodes puromycin resistance in methanococci (19, 20). The pac cassette is flanked by two multicloning regions that allow direct cloning of genomic DNA. For construction of pIJA03-cysS, an internal part of the cysS gene (507 bp) was PCR amplified from the plasmid pPH21310 (21) containing the M. maripaludis strain JJ1 cysS gene with the primers cysSA (GGACGCGTTGCATACAAAACTGAAGACG) and cysSB (GCTCTAGACAATCGGGCTTCGGTAG), and it was subsequently cloned into the pZERO-2 vector (Invitrogen). After digestion of the construct with the appropriate restriction enzymes (MluI and XbaI), the cysS fragment was excised, purified, and cloned into the pIJA03 vector by using the multicloning site MCS1. The orientation of the cysS fragment was confirmed by DNA sequencing. The plasmid pIJA03-hdrA was constructed in a similar fashion by using specific primers (179A: GCAGATCTCTGAATTAGACGGTGTAGCC and 179B: GGTCTAGAGTCATCTGTCGGGAAAGT) and plasmid pPH41717f containing the gene encoding heterodisulfide reductase as template. The PCR product was cloned in to pZERO-2 vector after digestion with the restriction enzymes BglII and XbaI. Finally, the plasmid pIJA03-fmdB was constructed as above (primers: 132A, GGAGATCTTATCGTCTGTCCAGTATGC; and 132B, GGTCTAGAGGAAATACTCCATATCTTGAC) by using the plasmid pPH22314r containing the gene encoding the molybdenum-dependent formyl methanofuran dehydrogenase. The PCR product was cloned into the pZERO-2 vector previously digested with BglII and XbaI restriction enzymes. Both pIJA03-hdrA and pIJA03-fmdB plasmids were used as control vectors to check transformation efficiencies in M. maripaludis after replacement of an essential and a nonessential gene, respectively.
Replacement of the cysS Gene in M. maripaludis.
The pBD1 vector for the cysS gene replacement was constructed by using the plasmid pPH21310 (containing the complete cysS gene of M. maripaludis strain JJ1 as well as part of the upstream ORF). The plasmid was digested with the blunt end restriction endonucleases MscI and HpaI to remove a 482-bp internal fragment of cysS, and it was replaced with a 1351-bp EcoRV/Eco47III fragment from pIJA03 containing the pac cassette. After screening, a plasmid pBD1 was found that contained the pac cassette in the same orientation as the remaining portions of the cysS gene. Before transformation of M. maripaludis cells by using the polyethylene glycol (PEG) method (22), pBD1 was linearized by digestion with HindIII and PvuII restriction enzymes. To verify the insertion of the pac cassette into the cysS gene, total M. maripaludis DNA was isolated and PCR analyzed with the primers cysSF (ACTTACAACAACACTCGGGG) and cysSR (CCTTCTTTTTGGGTTGTCCTC).
Cloning, Overexpression, and Purification of M. maripaludis Prolyl-tRNA Synthetase (ProCysRS) and CysRS.
The sequences of M. maripaludis proS (accession no. AAG28517) and cysS gene (accession no. AF163997) were used to design specific primers for amplification of both genes from M. maripaludis genomic DNA (wild-type strain JJ1). The primers in both cases contained NdeI and BamHI restriction sites for subsequent cloning in to the pET 15b expression vector (Novagen). The PCR product was first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced. On digestion with NdeI and BamHI, the genes were ligated into pET15b for expression of N-terminal His6-tagged proteins in the E. coli BL21-Codon Plus(DE3)-RIL strain. Cultures were grown at 37°C in LB medium, supplemented with 100 μg/ml ampicillin and 34 μg/ml chloramphenicol. Expression of the His6-tagged protein was induced for 4–6 h with the addition of 1 mM isopropyl-β-d-thiogalactoside before harvesting the cells. The enzyme was purified by Ni-nitrilotriacetic acid-agarose chromatography (Qiagen, Chatsworth, CA) as previously described (23). The M. maripaludis His6-ProRS and His6-CysRS were >99% pure, as judged by Coomassie Brilliant Blue staining after SDS/PAGE. Active fractions were pooled and dialyzed against aminoacylation buffer (see below) containing 40% glycerol and stored at −20°C.
Detection of ProCysRS and CysRS by Immunoblot Analysis.
Both recombinant proteins were used to raise polyclonal rabbit antibodies (four injections, ≈250 μg each) at the Yale Immunization Service (Yale University, New Haven, CT). The polyclonal antibodies were purified before use by Sepharose-protein A affinity chromatography. Different dilutions of S100 extracts from both the wild-type and the mutant strain (varying from 1:10–1:100) were analyzed on 10% polyacrylamide/SDS gels. As positive controls for the detection of the corresponding proteins in the cell extracts, we included purified His6-tagged enzymes. The proteins were transferred onto nitrocellulose membranes (Nitropure, Micron Separations) by using a Bio-Rad semidry blotter. For the immunoblot analysis, the colorimetric Opti-4CN substrate and detection kit (Bio-Rad) was used (horseradish peroxidase conjugate). The membranes were incubated with different dilutions of the polyclonal antibodies (1:100–1:1000) for optimal detection.
Aminoacylation and ATP-PPi Exchange Assays.
Cys-tRNA or prolyl-tRNA formation was assayed in aminoacylation buffer [50 mM Hepes-KOH, pH 7.0/50 mM KCl/10 mM ATP/15 mM MgCl2/5 mM DTT/0.05 mM [35S]cysteine (1,075 Ci/mmol) or [3H]proline (104 Ci/mmol)] at 37°C as previously described (23) in the presence of 50–250 nM of either M. maripaludis ProCysRS or CysRS, by using unfractionated tRNA from M. maripaludis (40 μM, 1 mg/ml) as a substrate (prepared with standard methods and purified by DEAE-cellulose chromatography). Aliquots (20 μl) from the reaction mixture were removed periodically, spotted on Whatman 3 MM paper filter disks and washed three times in 10% trichloroacetic acid to remove the free amino acid. After drying, the radioactivity was measured by liquid scintillation counting. The K M values were determined from the corresponding reciprocal plots in the presence of limiting concentrations of the variable substrates (0.5–500 μM [35S]cysteine or [3H]proline) and saturating conditions of the fixed substrates (10–100 × K M). Values of k cat were determined by using saturating substrate concentrations and 100–250 nM of either ProCysRS or CysRS. Pro-AMP and Cys-AMP formation were determined in the presence or absence of unfractionated M. maripaludis tRNA (40 μM) by using [32P]PPi with a specific activity of 2000 cpm/nmol. The reaction mixture also contained 50–500 nM ProCysRS, 1 mM ATP, 1 mM KF, and 2 mM proline or 1–10 mM cysteine in aminoacylation buffer. Aliquots (40 μl) were removed periodically, and the reaction was quenched by the addition of 1% activated carbon in the presence of 0.4 M sodium pyrophosphate and 15% perchloric acid. After filtration of the mixture through glass microfiber filter disks (GF/C, Whatman), the amount of 32P-labeled ATP was measured by liquid scintillation counting.
Results
M. maripaludis Cells Are Viable in the Absence of cysS.
To determine whether cysS was indeed essential for cell viability, M. maripaludis cells were transformed with pIJA03-cysS, a “suicide” vector containing 507 bp of an internal portion of cysS. This vector contains the pac cassette, which encodes puromycin resistance in methanococci (19). The transformants were expected to acquire puromycin resistance after a single homologous recombination between the cysS fragment on the circular plasmid and the cysS gene encoded in the genomic DNA of the organism (24). The resulting merodiploid would then contain two truncated copies of the cysS gene and would be viable only if cysS was not an essential gene. Thus, the ability to recover transformants would be a first test of whether or not cysS was essential. Because the transformation frequency depends to a great extent on the size of the fragment used to achieve homologous recombination, controls included fragments of the same size from essential and nonessential genes. Moreover, even for an essential gene, a low transformation frequency was expected because of rearrangements that might restore a wild-type copy of the gene or recombination at other sites. The number of transformants obtained with pIJA03-cysS was comparable to that found with pIJA03-fmdB, a plasmid that integrated at a nonessential gene encoding for the molybdenum-dependent formyl methanofuran dehydrogenase (Table 1). In contrast, the number of transformants obtained with pIJA03-hdrA, a plasmid that integrated at an essential gene encoding for the heterodisulfide reductase, was much lower. Therefore, by this test, cysS did not appear to be an essential gene in M. maripaludis.
Transformation of M. maripaludis by integration vectors at essential and nonessential genes*
To confirm this result, cells were transformed with the linearized plasmid pBD1 (Fig. 1 A). In this plasmid, the pac cassette was incorporated in the middle of the cysS gene. Puromycin resistance would then be acquired by homologous recombination at two sites, so that an internal portion of cysS would be replaced by the pac cassette (Fig. 1 A). The number of transformants obtained with pBD1 was comparable to that of other linear plasmids containing similar size fragments of genomic DNA (data not shown), supporting the conclusion that integration of the pac cassette did not require rare rearrangements or other genetic events. To determine whether the cysS gene was in fact disrupted, the DNA near the cysS locus and the levels of CysRS were examined in a representative mutant strain JJ200. Amplification by PCR of the cysS locus in strain JJ200 indicated an increase in the size of the DNA from 1.9 kb to 2.8 kb, as expected if a ≈500-bp fragment of cysS was replaced with the 1.35-kb pac cassette (Fig. 1 B). Similarly, immunoblot analysis with polyclonal antibodies raised against either M. maripaludis ProCysRS or CysRS also verified that CysRS was not present in cell extracts of the mutant strain (Fig. 1 C Lower). On the contrary, both synthetases were present in cell extracts of the wild type strain JJ1 (Fig. 1 C Upper). The inability to detect CysRS in the mutant strain confirms that the cysS gene is not functional and that this gene is not essential for growth.
Replacement of the M. maripaludis cysS gene with the pac cassette. (A) Strategy for construction of the gene replacement. pBD1 was constructed by replacement of the MscI (M)-HpaI (H) fragment of cysS (solid arrow) with the pac cassette (arrow with vertical bars). Before transformation, pBD1 was digested with PvuII (P) and HindIII (I) to form a linear plasmid. Puromycin resistance can then be acquired through two homologous recombination events leading to the replacement of the internal portion of cysS with the pac cassette on the genome. Neighboring ORFs are indicated by open and stippled arrows. (B) PCR amplification of the cysS locus in the mutant and wild type. The amplification was performed with the primers cysSF and cysSR (A). The templates were: 1, pPH21310, which contained the wild-type cysS gene; 2, pBD1, which contained the pac cassette inserted into the cysS gene; 3, genomic DNA of the wild-type strain JJ1; 4, genomic DNA of the M. maripaludis mutant strain JJ200 (see Materials and Methods). (C) Immunoblot analysis of M. maripaludis ProCysRS and CysRS expression in wild-type and mutant strains. (Upper) S100 extracts (wild-type and mutant) and purified recombinant M. maripaludis CysRS and ProCysRS in the presence of polyclonal anti-ProCysRS antibodies. (Lower) The same as above in the presence of polyclonal anti-CysRS antibodies.
ProCysRS Is Sufficient for Cys-tRNA Formation in the M. maripaludis cysS Mutant.
To elucidate which enzyme was responsible for Cys-tRNA formation in the mutant lacking the canonical CysRS, cell lysates were prepared from both the wild-type strain JJ1 and the mutant strain JJ200. Thiaproline, which is a specific inhibitor of the aminoacylation reactions of ProRS, also inhibits the Cys-tRNA synthetase activity of the ProCysRS from M. jannaschii and other organisms (11, 15). For an S100 extract of the wild-type strain of M. maripaludis, 1 mM of the inhibitor caused an almost 50% inhibition of the trichloroacetic acid-precipitable counts (Fig. 2 A). The residual activity was attributed to the canonical CysRS. On the other hand, when S100 extracts from the mutant strain were tested for Cys-tRNA formation, only background activity was detected in the presence of 1 mM of the inhibitor (Fig. 2 B). Thus, the only Cys-tRNA synthetase activity detectable in the mutant was thiaproline sensitive. This result supports the conclusion that M. maripaludis possesses a ProCysRS capable of forming Cys-tRNA efficiently.
Inhibition of Cys-tRNA formation in M. maripaludis S100 extract in the presence of 1 mM thiaproline. (A) Wild-type S100 extract in the absence (●) or presence (○) of thiaproline. The residual activity is attributed to the canonical CysRS present in the extract. (B) Mutant JJ200 S100 extract under the same conditions. The level of inhibition (≈95%) indicates that only ProCysRS is responsible for Cys-tRNA formation in this strain. Closed squares represent the background level.
Genes encoding ProCysRS from three methanogenic archaea have been previously shown to rescue the growth of a temperature-sensitive E. coli cysS strain that also contained a gene encoding the M. jannaschii tRNACys. To examine the dual specificity of M. maripaludis ProCysRS in vitro, we cloned and expressed the corresponding gene in E. coli, and purified the enzyme by affinity chromatography. When M. maripaludis ProCysRS was tested in the presence of homologous tRNA and cysteine in the reaction mixture, we observed direct attachment of cysteine on the tRNA (Fig. 3 B). The enzyme was also able to use proline (like any other ProRS, Fig. 3 A). A conserved property of all currently characterized dual-specificity ProCysRS enzymes is the tRNA-dependent activation of cysteine (11, 15, 16, 23). This result is also the case with the M. maripaludis enzyme, because Cys-AMP was formed only in the presence of unfractionated homologous tRNA (Fig. 3 C).
Aminoacyl-tRNA and Cys-AMP formation by M. maripaludis ProCysRS. Aminoacylation was performed as described in Materials and Methods in the presence of 0.05 mM [3H]proline or 0.05 mM [35S]cysteine (A and B; ●). No activity was observed in the absence of either enzyme or tRNA (A and B; ■). (C) tRNA-dependent Cys-AMP synthesis as measured in the ATP-PPi exchange reaction (see Materials and Methods). The cysteine concentration used was 1–10 mM. Formation of radiolabeled ATP was observed only in the presence of 1 mg/ml total M. maripaludis tRNA (●) and not in the absence of tRNA (○). Closed squares represent the background level (absence of either enzyme or cysteine from the reaction mixture).
The coexistence of two pathways of Cys-tRNA formation in M. maripaludis, one employing the canonical CysRS and one based on ProCysRS, led to the examination of the kinetic parameters that govern both aminoacylation reactions in vitro. As determined in the aminoacylation reaction, the K M for cysteine of the ProCysRS was almost eight times higher than that of the canonical CysRS (Table 2). However, the k cat values for the formation of Cys-tRNA by both enzymes were much closer (2.2 s−1 for CysRS and 0.8 s−1 for ProCysRS). The canonical activities of both enzymes exhibit almost the same affinities for cysteine and proline, respectively, and the k cat values are comparable. From all of the above, it appears that, although ProCysRS in this organism has a lower affinity for cysteine than the single-specificity canonical enzyme, its catalytic efficiency as measured in vitro was sufficient to support Cys-tRNA formation in vivo in the absence of CysRS.
Kinetic constants of M. maripaludis ProCysRS and CysRS in tRNA aminoacylation
Growth Phenotype of M. maripaludis cysS Mutant.
The growth of the M. maripaludis cysS deletion mutant strain JJ200 was very similar to that of the wild-type strain under a variety of conditions. M. maripaludis is a facultative autotroph (25). Although it is capable of autotrophic growth in mineral medium, it readily assimilates acetate and a variety of amino acids, including proline, when they are present (26, 27). Both the mutant and the wild-type strains exhibited similar growth rates under autotrophic growth conditions as well as in rich medium containing organic carbon sources (Fig. 4 A and B, and data not shown). Low concentrations of proline (≤0.05 M) had little effect on the growth of the wild-type or mutant strains (data not shown). Higher concentrations were inhibitory for both strains, and, finally, no growth was observed above 0.6 M proline (data not shown). M. maripaludis as a marine archaeon exhibits optimum growth in medium containing a high salt concentration (0.4 M NaCl). Both the mutant and wild-type strains grew similarly throughout a concentration range of 0.05–1.2 M NaCl (data not shown). However, the mutant strain was somewhat less sensitive to a rapid downshift of NaCl concentration than the wild-type (Fig. 4 A). When cultures were shifted from the optimum NaCl concentration (0.4 M) to 0.1 M, the wild-type strain underwent a prolonged lag of ≈10 h (Fig. 4 C). In contrast, the lag for the mutant was only 5 h, and was comparable to the lag observed in the absence of a change in salt concentrations. This difference was observed only over a narrow salt concentration range. A shift to 0.05 M NaCl caused a prolonged lag for both the mutant and wild-type strains (Fig. 4 C). Similarly, when the shift to 0.1 M NaCl was performed in mineral medium, both strains exhibited prolonged lags (data not shown).
Growth response of the cysS mutant strain JJ200 and wild-type strain JJ1 of M. maripaludis to a down shift in NaCl concentrations. The inoculum was grown in rich medium with acetate and casamino acids at 37°C containing 0.4 M NaCl (24). Wild-type cells (● and ○) and cysS mutant JJ200 (▴ and ▵). (A) At zero time, 5 × 107 cells were inoculated into prewarmed medium containing the same concentration of NaCl (● and ▴) or 0.1 M NaCl (○ and ▵). (B) Specific growth rates after the shift from 0.4 M NaCl into media of lower NaCl concentrations. (C) Growth lags after the same shift into media of lower NaCl concentrations.
Discussion
The growth rate of prokaryotes depends on the complex interaction of the rates of small molecule and macromolecule biosynthesis and is tightly regulated. Not surprisingly, the growth of the M. maripaludis mutant that lacks a canonical CysRS was nearly identical to that of wild type over a range of growth conditions. Thus, the rate of Cys-tRNA formation was not growth limiting under the conditions tested even in the absence of the canonical CysRS. The Cys-tRNA-forming activity of the ProCysRS is inhibited by high concentrations of proline. Therefore, the failure of high concentrations of extracellular proline to inhibit growth was presumably due to an inability of the cells to accumulate high intracellular concentrations. The major growth difference between the mutant and wild type was a 2-fold reduction in the growth lag of the mutant during the shift to low salt in rich medium. This effect did not appear to be a general stress response because no difference was observed during the shift from rich to mineral media. Salt downshifts in prokaryotes are usually accompanied by rapid efflux of potassium ions and other small molecules (28), and for some reason the mutant strain was able to recover more quickly. The very narrow range of conditions where this effect was observed is consistent with the hypothesis that Cys-tRNA formation is not growth-limiting under the described conditions.
The set of twenty different single-specificity aminoacyl-tRNA synthetases has been regarded to be essential for translation in every cell. Whereas other pathways exist for the generation of amide aminoacyl-tRNAs (5), until recently, Cys-tRNA formation was considered to be carried out only by a canonical CysRS. Our data clearly show that CysRS is not required for M. maripaludis to be viable. Instead, a dual-specificity ProCysRS appears to take over the task of Cys-tRNA synthesis in this organism. Thus, one wonders how many other single-specificity AARS enzymes may be dispensable in organisms that contain the full complement of twenty AARSs. The intriguing discovery that ProRS from several bacteria (e.g., T. thermophilus; ref. 16) is able to catalyze in vitro the formation of both prolyl-tRNA and Cys-tRNA suggests that such a dual-specificity enzyme may exist even in bacteria. This remains to be tested in the future. Are there any candidates for other dual-specificity synthetases? Transposon mutagenesis studies to create a minimal Mycoplasma genitalium genome suggested that the genes encoding isoleucyl- (IleRS) and tyrosyl-tRNA synthetase were dispensable (29). However, such a procedure could give rise to truncated versions of AARS enzymes, some of which have been shown to be active as well as pairs of noncontiguous fragments with synthetase activity (30). There is also no compelling reason why an AARS should be required to compensate for the loss of another synthetase. Possibly, synthetase activity could also be provided by proteins that have other functions. For instance, a recent report (31) demonstrated CysRS activity by a M. jannaschii ORF (MJ1477) that was assigned a polysaccharide hydrolase function (32). Because this M. jannaschii protein has homologs only in a small number of organisms with known genomes (Thermotoga maritima and Deinococcus radiodurans), it is not a general CysRS enzyme that provides Cys-tRNA in the genomes that lack the canonical cysS gene such as M. thermautotrophicus.
Aminoacyl-tRNA synthetase evolution may have involved enzymes that could specify more than one amino acid in a primitive protein synthesis machinery (33). Duplication and diversification of these primitive synthetases would then form the basis for the evolutionary radiation that gave rise to the contemporary AARSs. However, the high specificity of the ProCysRS for each of its substrates is not a property expected of a primitive synthetase. Therefore, we propose that this enzyme has evolved to function optimally in certain types of cells. Because of its lower affinity for cysteine, these cells presumably contain higher cytoplasmic concentrations of this amino acid. Whereas further proposals must be speculative given the limited data on the dual-specificity enzyme's distribution, one can imagine that many anaerobes or organisms that do not make glutathione might possess high cytoplasmic concentrations of cysteine. The presence of a canonical CysRS in many of these same organisms is consistent with proposals that this gene was acquired late in evolution by horizontal gene transfer (34). Because of the higher affinity of the CysRS for cysteine, the acquisition of this enzyme could have been selected for because it enabled the organism to grow with lower cysteine levels in the cytoplasm.
Acknowledgments
We thank Carla Polycarpo, Gregory Razcniak, and Anselm Sauerwald for advice, and Michael Ibba for critical comments. We also thank Gary Olsen and Paul Haney for sharing sequences of M. maripaludis genes before their publication. This work was supported by grants from the National Institute for General Medical Sciences (D.S.), the National Aeronautics and Space Administration (D.S.), and the Office of Science of the Department of Energy (W.W. and D.S.).
Footnotes
-
↵ § To whom reprint requests should be addressed at: Department of Molecular Biophysics and Biochemistry, Yale University, P.O. Box 208114, 266 Whitney Avenue, New Haven, CT 06520-8114. E-mail: soll{at}trna.chem.yale.edu.
- Abbreviations:
- AARS,
- aminoacyl-tRNA synthetase;
- Cys-tRNA,
- cysteinyl-tRNA;
- CysRS,
- cysteinyl-tRNA synthetase;
- ProRS,
- prolyl-tRNA synthetase;
- ProCysRS,
- prolyl-cysteinyl-tRNA synthetase
- Copyright © 2001, The National Academy of Sciences



