MicroRNAs direct rapid deadenylation of mRNA

Wu et al. 10.1073/pnas.0510928103.

Supporting Information

Files in this Data Supplement:

Supporting Figure 6
Supporting Figure 7
Supporting Table 1
Supporting Figure 8
Supporting Figure 9
Supporting Materials and Methods

Supporting Figure 6

Fig. 6. Relative cellular concentration of miRNAs. (A) miR-125b. Equal amounts of total cytoplasmic RNA from 293T cells transfected with a gene encoding or not encoding miR-125b (the same RNA samples used in Fig. 1 to examine mRNA deadenylation and decay), from undifferentiated P19 cells transfected or mock-transfected with miR-125b (the same RNA samples used in Fig. 2A to probe mouse genome arrays), from differentiating P19 cells 8 days after induction with retinoic acid, or from mouse brain were analyzed by electrophoresis and blotting, using a radiolabeled probe complementary to miR-125b. The tRNA content of each sample (internal standard) was analyzed by electrophoresis and staining with ethidium bromide. (B) let-7. Equal amounts of total cytoplasmic RNA from 293T cells transfected with a gene encoding or not encoding let-7a (the same RNA samples used in Fig. 3C to examine mRNA deadenylation and decay) were analyzed by electrophoresis and blotting, using a radiolabeled probe for let-7.

Supporting Figure 7

Fig. 7. Inability of miR-125b to direct endonucleolytic cleavage within miRE2. (A) Duplex thought to be formed by lin-28 miRE2 (top) and miR-125b (bottom). (B) Absence of miRE2 cleavage products. Luciferase reporter mRNAs bearing miRE2 or a synthetic element (element P) perfectly complementary to miR-125b were extracted from 293T cells that did or did not produce miR-125b, and equal amounts of each RNA sample were analyzed by RNA ligation and RT-PCR as in Fig. 1C. B and C represented a degradation intermediate resulting from miR-125b-directed mRNA cleavage within perfectly complementary element P; this band was absent for the reporter containing miRE2. Band X, which resulted from miR-125b-independent mRNA cleavage upstream of the site of miRE2 insertion, served as an internal standard. Calibration is in base pairs.

Supporting Figure 8

Fig. 8. Influence of miR-125b on the deadenylation and decay of a reporter transcript bearing the A1 element of Ajuba mRNA. The degradation of BG mRNA bearing one copy of the Ajuba A1 element in the 3' UTR (BG+A1) was analyzed in 293T cells in the presence or absence of miR-125b, as described in Fig. 1.

Supporting Figure 9

Fig. 9. Influence of miR-125b on the deadenylation and decay of a reporter transcript bearing the M7 element of MKK7 mRNA. The degradation of BG mRNA bearing one copy of the MKK7 M7 element in the 3' UTR (BG+M7) was analyzed in 293T cells in the presence or absence of miR-125b, as described in Fig. 1.

Supporting Materials and Methods

DNA Used for Transfection. Plasmid pBG, which encodes a rabbit b-globin reporter mRNA expressed from a c-fos promoter, was derived from plasmid pBBB (1) by inserting a spacer sequence containing adjacent NheI and XbaI sites (GATCTATGCATTGTTGAGGTGGTCTGAATGTTCTGACATTAACAGTTTTCCATGATATCTTCATAAAGCTTCGATTAGTGAACGGATCTCGGCTAGCTTATCATCTAGAGTCGGGGCGGCCGGCTCGAGACAGAGATC) into a BglII site located just downstream of the b-globin stop codon. Plasmids pBG+2E1, pBG+A1, pBG+M7, and pBG+L7 were constructed by inserting two tandem copies of the human lin-28 element miRE1 (TCCTGCACTGTGTTCTCAGGTACATTCCTGCACTGTGTTCTCAGGTACATA), one copy of the mouse Ajuba element A1 (TGTGTTGCCTGTTTCTCAGGGACCT), one copy of the mouse MKK7 element M7 (TCCTATGGGGTGAGGTTCCTATTCTCAGGGTTTG), or one copy of the human lin-28 element L7 (GGAGTGCACAGCCTATTGAACTACCTCATTTTT) between the NheI and XbaI sites of pBG. Plasmid pBG+2E1+hp is identical to pBG+2E1 except for the presence of a large inverted repeat (GGGGCGCGTGGTGGCGGCTGCAGCCGCCACCACGCGCCCC) in the b-globin 5' UTR, 39 nt upstream of the initiation codon; it was constructed from pBG+2E1 by substituting a 0.73-kb SacII–AccI fragment from a related b-globin construct containing this inverted repeat (pBBB-hp), which was kindly provided by Ann-Bin Shyu (2). Plasmids pCBL+2E1+hp and pCBL+2E1, which were used to measure the inhibitory effect of the inverted repeat on translation in the context of the BG+2E1 5' and 3' UTR, are derivatives of pBG+2E1+hp and pBG+2E1, respectively, in which b-globin codons 3-147 were replaced with firefly luciferase codons 2-550 and the c-fos promoter was replaced with a CMV promoter. Plasmids pCL-6E1, pCL-2E1, and pCL-2E2, which are described in ref. 3, encode firefly luciferase reporter mRNAs (Luc+6E1, Luc+2E1, or Luc+2E2) that contain six copies or two copies of lin-28 miRE1 or two copies of lin-28 miRE2, respectively, in the 3' UTR and are transcribed from a CMV promoter. Plasmid pCL-2P is identical to pCL-2E1 except that it encodes a luciferase reporter mRNA containing two copies of a synthetic element perfectly complementary to miR-125b (TCACAAGTTAGGGTCTCAGGGA) instead of miRE1. Plasmid pCL-6E1.HSL, encoding Luc+6E1.HSL mRNA, was constructed by inserting a 975-bp fragment of the human histone H1.3 gene (4) between the XbaI and SalI sites of pCL-6E1, so as to introduce a 3' histone stem-loop 50 nt downstream of the six tandem copies of miRE1 in the 3' UTR. Plasmids pSVa1-GAPDH and pBC21/CMV/b-Gal (5, 6) served as internal transfection controls.

Plasmid pMIR125b, from which miR-125b is expressed in 293T cells at a level comparable with that in untransfected P19 cells treated with retinoic acid, has been described previously, as has the deletion variant pMIR125bD, which lacks the DNA segment encoding the premiR-125b stem-loop and served as a negative control (3). Plasmid pLET7a was constructed from pCMV-Luc (3) by replacing the luciferase translational unit between the CMV promoter and the SV40 3' UTR with a 0.57-kb fragment of human chromosome 11 that encodes let-7a flanked upstream by 104 bp and downstream by 445 bp. In plasmid pLET7aD, which was used as a negative control, a 63-bp segment of pLET7a that encodes most of the prelet-7a stem-loop was deleted.

Growth and Transfection of 293T and HeLa Cells. 293T human embryonic kidney cells and HeLa cells were grown in DMEM (GIBCO) supplemented with 10% FBS. Transient transfection of 293T cells with DNA was performed for 12 h in 60-mm wells coated with poly(D-lysine) by using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s protocol. HeLa cells were transfected for 12 h in 60-mm wells in the presence of GeneJuice (Novagen), according to the manufacturer’s protocol.

Oligoribonucleotide Ligation and RT-PCR. Oligoribonucleotide ligation and RT-PCR were used to determine whether miR-125b can direct cleavage of a luciferase reporter mRNA within miRE1 or miRE2. First, 293T cells were cotransfected with pCL-2E1, pCL-2E2, or pCL-2P (positive control) and with a plasmid encoding miR-125b or a deletion variant thereof. Cytoplasmic RNA was extracted 36 h after transfection was completed, and after treatment with DNase I, polyadenylated mRNA was isolated by using an Oligotex Direct mRNA kit (Qiagen) according to the manufacturer’s instructions. Equal amounts of each RNA sample (0.20 mg) were ligated to a synthetic RNA oligonucleotide (CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA, 0.25 mg) by treatment with T4 RNA ligase (5 units) and ATP (1 mM) for 1 h at 37°C. The ligation products were reverse-transcribed by treating them with SuperScript III reverse transcriptase (Invitrogen; 200 units) and an oligo(dT) primer (0.1 mg) for 1 h at 45°C in the presence of RNasin (Promega, 40 units), and the resulting DNAs were amplified by successive rounds of PCR with nested pairs of primers (CGACTGGAGCACGAGGACACTGA + ACAAATAAAGCAATAGCATCACAAAT, and then GGACACTGACATGGACTGAAGGAGTA + GCATTCTAGTTGTGGTTTGTCCAA). Finally, the RT-PCR products were examined by electrophoresis on a 6% polyacrylamide gel.

1. Shyu, A. B., Greenberg, M. E. & Belasco, J. G. (1989) Genes Dev. 3, 60–72.

2. Chen, C. Y. A., Xu, N. & Shyu, A. B. (1995) Mol. Cell. Biol. 15, 5777–5788.

3. Wu, L. & Belasco, J. G. (2005) Mol. Cell. Biol. 25, 9198–9208.

4. Neu-Yilik, G., Gehring, N. H., Thermann, R., Frede, U., Hentze, M. W. & Kulozik, A. E. (2001) EMBO J. 20, 532–540.

5. Chen, C. Y. A. & Shyu, A. B. (1994) Mol. Cell. Biol. 14, 8471–8482.

6. Zeng, Y., Wagner, E. J. & Cullen, B. R. (2002) Mol. Cell 9, 1327–1333.