Cytokinin-mediated control of leaf longevity by AHK3 through phosphorylation of ARR2 in Arabidopsis

Kim et al. 10.1073/pnas.0505150103.

Supporting Information

Files in this Data Supplement:

Supporting Figure 7
Supporting Figure 8
Supporting Figure 9
Supporting Figure 10
Supporting Table 1
Supporting Table 2
Supporting Figure 11
Supporting Figure 12
Supporting Figure 13
Supporting Figure 14
Supporting Materials and Methods

Supporting Figure 7

Fig. 7. The Arabidopsis ore12-1 mutant shows delayed dark-induced leaf senescence. (Top) Dark-induced senescence phenotype of wild-type (Col) and ore12-1 leaves. (Middle) The chlorophyll content and photochemical efficiency (Fv/Fm) were examined every 2 days after dark treatment. Error bar, standard deviation (n = 24). (Bottom) expression of the senescence marker SEN4 in wild-type and ore12-1 leaves. For dark-treatment, leaves at 12 days after leaf emergence (DAE) were detached and floated on 3 mM Mes buffer (pH 5.7) in the dark.

Supporting Figure 8

Fig. 8. Map-based cloning of the ORE12 gene. (A) Genetic mapping of the ORE12 locus. The number of recombination events (r) between the CAPS markers and the ORE12 locus is shown. The open arrow shows the location of the ORE12 gene. The other arrows denote annotated genes around the ORE12 locus. The genetic distances are shown in cM (centimorgans). BAC, bacterial artificial chromosome. (B) Alignment of the amino acid sequences of the extracellular domain of ORE12/AHK3 with those of AHK2 and AHK4. The asterisk indicates the ore12-1 mutation.

Supporting Figure 9

Fig. 9. Localization of AHK3 at the plasma membrane in an Arabidopsis protoplast as revealed by the green fluorescence of AHK3-GFP. The transmission (Left) and fluorescence (Right) microscopic images are shown. The red fluorescence is from chlorophyll.

Supporting Figure 10

Fig. 10. Ectopic expression of either ore12-1 or AHK recapitulates the ore12-1 phenotype. The photochemical efficiency (Fv/Fm) was examined every 2 days during dark-induced senescence. Error bar, standard deviation (n = 12).

Supporting Figure 11

Fig. 11. Characterization of ahk3, a null mutant allele of AHK3. (A) Location of the T-DNA insertion in the ahk3 mutant. (B) AHK3 mRNA is not detectable in the ahk3 plants as determined by RT-PCR.

Supporting Figure 12

Fig. 12. Transgenic overexpression of ARR2 (35S::ARR2), but not that of ARR2^D80N (35S::ARR2^D80N), results in delay of age-dependent leaf senescence. Error bar, standard deviation (n = 48). The chlorophyll content and the photochemical efficiency (Fv/Fm) of leaves from wild-type (Col) and the transgenic lines (35S::ARR2, 35S::ARR2^D80N) were examined at the indicated ages (DAE).

Supporting Figure 13

Fig. 13. The ahk3 knockout plant does not show a noticeable early-senescence phenotype during age-dependent senescence. Error bar, standard deviation (n = 36). The chlorophyll content and the photochemical efficiency (Fv/Fm) of leaves from wild-type (Col) and ahk3 knockout plants (ahk3) were examined at the indicated ages (DAE).

Supporting Figure 14

Fig. 14. The arr2 knockout plant does not show an early-senescence phenotype during age-dependent senescence. Error bar, standard deviation (n = 48). The chlorophyll content and the photochemical efficiency (Fv/Fm) of leaves from wild-type (Col) and arr2 knockout plants (arr2) were examined at the indicated ages (DAE).

Supporting Materials and Methods

Genetic Mapping. The ore12-1 plants were crossed with wild-type Landsberg erecta (Ler) plants to create mapping populations, and 919 plants showing the mutant phenotype were selected from the F₂ progenies. Genomic DNA of each of these plants was used for mapping of the ORE12 locus relative to those of the known cleaved amplified polymorphic sequence (CAPS) markers. Additional CAPS markers were generated in the sequences of the bacterial artificial chromosome (BAC) clone F17L21 for fine mapping of the ORE12 locus. The new markers were F17L21-3A (amplification with primers 5'-GAGATTCTCCTTCTACGATCGC-3' and 5'-TCAGCCAATCTCCTTACCTTCG-3' yielding a 1.2-kb product with 3 and 2 DdeI sites in Col and Ler, respectively) and F17L21-4A (amplification with primers 5'-CACCAGACGATTAGGGTTACGA-3' and 5'-CTAATGTACTTAGCTATCTCTAG C-3', yielding a 1.4-kb product with 1 and 2 EcoRI sites in Col and Ler, respectively). The ORFs in the vicinity of the mapped ORE12 locus were subjected to sequencing to identify the mutated sequence.

Complementation Test. The 7.2-kb DNA fragment containing 2.0 kb of the promoter region, the predicted ORF, and 1.0 kb of downstream sequence was amplified by PCR using two oligonucleotides, 5'-CATCGAAGGTCGACTAGTAGTGCTCAACGAAA-3' and 5'-AATCGAGATCCCGGGCTATACCATGATTACA-3'. The fragment was cloned into the SmaI site of the pCAMBIA1300 vector (MRC) and transformed into the ore12-1 plants. T₂ seeds from two independent T₁ transgenic lines were plated on a medium supplement with 20 mg/ml hygromycin. Hygromycin resistance was scored after 10 days. The phenotypes of T₂ plants were determined by measuring the two senescence parameters, chlorophyll content and photochemical efficiency, after dark treatment for 7 days (1).

Screening for ahk3 T-DNA Insertion Mutant. The loss-of-function ahk3 mutant was screened from the Salk T-DNA collection by using a PCR-based method (2). The AHK3-specific primers used were 5'-GATGGGTTGGAACGTGTTAGTC-3' and 5'-TGTTCAACACGTGGAACTACTTC-3'. The T-DNA-specific primer used was 5'-TGGTTCACGTAGTGGGCCATCG-3'. For expression of AHK3 in the ahk3 mutant background, RT-PCR analysis was carried out with the gene-specific primers, 5'-GCCATGTCTATCTTGATCTCAAC-3' and 5'- TGTTCAACACGTGGAACTACTTC-3'.

Microarray Analysis. Total RNA was extracted from the 3rd and 4th leaves of 21-day-old wild-type and the ore12-1 plants by using the TRIzol reagent (Invitrogen). Double-stranded cDNA was synthesized from 16 mg of total RNA by using the Superscript II system (GIBCO-BRL) and an oligonucleotide (dT)24-T7 primer (Genset, La Jolla, CA). cDNA was converted to biotinylated cRNA by using the BioArray High Yield Transcript Labeling kit (Enzo Life Sciences, Farmingdale, NY). The cRNA was purified with RNAEasy columns (Qiagen, Valencia, CA). Twenty mg of cRNA was fragmented and hybridized to Affymetrix ATH1 GeneChip arrays according to the manufacturer’s instruction. Expression levels were estimated with the microarray suite 5.0 (Affymetrix, Santa Clara, CA). Microarray analysis was performed twice.

Expression of Cytokinin Response Genes. Total RNA was isolated from the 3rd and 4th leaves with a TriReagent kit (Molecular Research Center, Cincinnati, OH). The following pairs of primers were used; 5'-GTTACTATAAGCTCGTCTATGGC-3' and 5'-ACACGGCATCCCAGAATAGTTC-3' for ARR4, 5'-CTACTCTTCTTGA

TATGGCTGAG-3' and 5'-TATCGTACGTGGAATCTGATAAAC-3' for ARR5, 5'-CATTCGTTGATCAATGGCTGAAG-3' and 5'-ATCGGAGAGCTCAGATCTTTGC-3' for ARR6, 5'-CTGAGTTTGACAATGGCGGTTG-3' and 5'-GCTAAGGTCTT

GGCCTCTATAC-3' for ARR7, 5'-ATGGGTATGGCAGCAGAATCGC-3' and 5'-TCAGACAGCGGTTGCGATACC-3' for ARR9, 5'-ATGGCTCTCAGAGA

TTTATCTTCT-3' and 5'-TTAACCCCTAGACTCTAATTTGATC-3' for ARR15, and 5'- AATCAGATGTGGATCTCTAAG GCA-3' and 5'- TCCGAGTTTGAAGA

GGCTACAAAC-3' for Actin8.

1. Oh, S. A., Park, J. H., Lee, G. I., Paek, K. H., Park, S. K. & Nam, H. G. (1997) Plant J. 12, 527–535.

2. Alonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J., Chen, H., Shinn, P., Stevenson, D. K., Zimmerman, J., Barajas, P., Cheuk, R., et al. (2003) Science 301, 653–657.