Adult-onset pulmonary fibrosis caused by mutations in telomerase

Tsakiri et al. 10.1073/pnas.0701009104.

Supporting Information

Files in this Data Supplement:

SI Table 2
SI Figure 6
SI Table 3
SI Table 4

SI Figure 6

Fig. 6. Sequence electropherograms of PCR products amplified from genomic DNA of individuals heterozygous for mutations in TERT and TERC. Wild-type (wt) and mutant cDNA sequences are listed directly below the tracings. Heterozygous missense mutations are indicated at the positions marked by the short arrows. Deletions are indicated by the long arrows and result in an overlap of wt and mutant sequences. For the TERT c.2240delT mutation, the deleted thymidine is boxed. For the TERT c.3346_3522del mutation, 177 bp are deleted which include 54 bp of coding sequence and 123 bp of 3' UTR. (The mutant sequence is displayed more clearly because the smaller product is preferentially amplified.)

Table 2. Additional clinical features of individuals in families with idiopathic interstitial lung disease

Family	Subject	FVC, %	FEV1, %	DLco, %	WBC, x10⁹/liter	Hct, %	Plt, x10⁹/liter	Clinical features
F8	I.1				5.9	23		Pulmonary fibrosis by report. Excised mediastinal lymph node biopsy with Hodgkins lymphoma, nodular sclerosis subtype. Normochromic, normocytic anemia with 30% cellularity in a bone marrow biopsy.
	II.1							Chronic cough, dyspnea, restriction and severe decrease in DLco, CT with pulmonary fibrosis. No response to immunosuppression.
	II.2	52	64		6.5	40.8	131	Smoker, cough, dyspnea, crackles, CXR with diffuse pulmonary fibrosis, OLBx with UIP. No response to immunosuppression. Underwent lung transplantation.
	II.3	62	67	51	11.9	41.0	321	Smoker, cough, dyspnea, crackles, HRCT with peripheral lower lung predominant interstitial fibrosis, OLBx with pulmonary fibrosis. No response to immunosuppression or gamma-interferon. Normal bone densitometry.
F11	II.1							Cough, dyspnea, crackles, suspected atypical mycobacterial infection, CXR with pulmonary fibrosis.
	II.3							Smoker, cough, dyspnea, suspected tuberculosis, respiratory failure.
	II.6	51	41		13.2	28.4	515	Osteoporosis with vertebral compression fractures, anemia of chronic disease, basal cell carcinoma. Nonsmoker, cough, dyspnea, crackles, clubbing, CXR with pulmonary fibrosis, OLBx with UIP.
	II.8							Nonsmoker with longstanding dyspnea by report.
	III.1							Smoker, cough, dyspnea, CXR with pulmonary fibrosis.
	III.4	43	49		4.7	32.7	252	Osteoporosis with hip fracture^† and anemia. Smoker, cough, progressive dyspnea, CT with peripheral lower lobe pulmonary fibrosis with superimposed ground glass opacity, OLBx with chronic interstitial pneumonia. No response to immunosuppression.
	III.6				14.3	42.3	520	Sarcoidosis with pulmonary, dermatologic, and neurologic manifestations. Diagnosis made by TBBx of the lung, skin biopsy, and sural nerve biopsy. Also with severe peripheral neuropathay secondary to sarcoid, pulmonary mycobacterial disease (sputum smear 2-3+ and culture positive for MAI), baseline leukocytosis and thrombocytosis, basal cell carcinoma. Smoker, CXR with cavitary and fibrotic changes of the left upper lobe.
	III.7				4.7	36.3	122	Nonsmoker, no cough, or dyspnea, or crackles. Abdominal ascites, jaundice. Cryptogenic liver cirrhosis and portal hypertension. Liver biopsy with moderate chronic portal triaditis with architectural distortion. Died in an accident.
	III.12	42	46	27	9.5	41.3	368	Breast cancer. Nonsmoker, cough, dyspnea, crackles, HRCT with extensive interstitial fibrosis, OLBx with UIP. No response to immunosuppression.
	IV.1	106	99	61	5.8	42.8	188	Osteoporosis.^† Smoker, cough, dyspnea, crackles, HRCT with peripheral upper and lower lobe peripheral interstitial fibrosis.
	IV.2	70	64	50	6.9	46.3	202	Osteopenia. Smoker, cough, dyspnea, HRCT with peripheral lower lobe predominant interstitial fibrosis. OLBx with UIP. Underwent lung transplantation.
F31	II.1							Died of respiratory failure by report.
	II.3							Suspected tuberculosis by report. Died in an accident.
	II.4							Smoker, diagnosed with "emphysema" by report.
	II.6							Smoker, cause of death "pneumonia" by report.
	III.3	39	49		9.3	32.2	169	Osteoporosis with vertebral compression fractures^† and anemia. Nonsmoker, cough, dyspnea, crackles, progression of pulmonary fibrosis favoring the upper lobes over 4 years by CXR, nondiagnostic TBBx.
	III.4	72	78	31	7.4	42.1	199	Large cell lymphoma of the ileum. Smoker, dyspnea, crackles, HRCT with peripheral lower lobe predominant interstitial fibrosis, nondiagnostic TBBx.
	III.9	69*		52	6.8			Osteoporosis with vertebral compression fractures.^† Nonsmoker, cough, dyspnea, HRCT with peripheral interstitial fibrosis favoring the upper lobes, radiographic progression of pulmonary fibrosis over 6 years.
F34	I.1							Died of suspected tuberculosis by report.
	II.2							Died of pulmonary fibrosis by report.
	III.2	74	58	47	6.8	32.4	283	Osteoporosis with vertebral compression fracture and anemia. Smoker, dyspnea, cough, crackles, clubbing, HRCT with peripheral lower lung predominant interstitial fibrosis, OLBx with UIP. Developed anemia after undergoing single lung transplant.
F40	I.2							Death certificate "severe pulmonary fibrosis for 5 years, respiratory failure."
	II.1				4.7	37.2	248	Osteopenia.^†
	II.2	42	44	31	5.6	40.8	289	Smoker, dyspnea, cough, crackles. HRCT with peripheral lower lung predominant interstitial fibrosis. OLBx with interstitial pneumonia with advanced pulmonary fibrosis. No response to immunosuppression.
F61	I.1							Died of interstitial lung disease 2 years after diagnosis by radiographic studies.
	II.2	57	68	14	8.8	39.9	383	Osteopenia.^† Smoker, cough, dyspnea, crackles, HRCT with peripheral lower lung predominant interstitial fibrosis. No response to immunosuppression.
	III.2	69	69	65				Smoker, chronic dry cough, dyspnea, HRCT with minimal scarring, no interstitial fibrosis, honeycombing, or bronchiectasis.
F71	I.2				9.1	37.7	340	Osteoporosis^†
	II.1	48	47	31	6.8	37.6	329	Smoker, cough, dyspnea, crackles, HRCT with peripheral interstitial fibrosis throughout the lungs. OLBx read as UIP vs UIP with features of non-caseating granulomas. No reponse to immunosuppression.
	II.2	41	38	25	10.2	32	408	Ulcerative colitis, osteopenia, anemia. Nonsmoker, cough, dyspnea, crackles, HRCT with peripheral interstitial fibrosis, OLBx with UIP. Underwent double lung transplant.
Sporadic		45	61	33	2.0	38	201	Osteopenia. Nonsmoker, cough, dyspnea, CT chest with peripheral interstitial fibrosis throughout the lungs, OLBx with UIP with non-caseating granulomas. Developed neutropenia after undergoing lung transplantation.

Pulmonary function tests measurements were obtained prior to lung transplantation. FVC, forced vital capacity; FEV1, forced expiratory volume in 1 second; DLco, diffusing capacity for carbon monoxide; WBC, white blood cell count; Hct, hematocrit; Plt, platelet count; CXR, chest x-ray; OLBx, open lung biopsy; UIP, usual interstitial pneumonia; CT, computed tomography (of the chest); HRCT, high resolution computed tomography (of the chest), TBBx, transbronchial biopsy of the lung, MAI, Mycobacterium avium intercellulare.

*TLC (total lung capacity) measurement reported.

^†Diagnosis of osteoporosis/osteopenia made prior to or in the absence of treatment with steroids.

Table 3. Sequence variants in TERT found in individuals with interstitial lung disease (n = 90)

Exon	Nucleotide change	Amino acid change	Frequency
1	IVS1+7C>T		0.01
2	c.835G>A	A279T	0.05
	c.915G>A	A305A	0.37
	IVS2+39G>C		0.16
4	IVS3-24C>T		0.23
	c.1812A>G	A604A	0.02
	IVS4+10C>T		0.01
	IVS4+21C>T		0.01
5	IVS4-42C>T		0.01
	c.2031C>T	G677G	0.01
	c.2097C>T	A699A	0.03
	c.2118G>A	L706L	0.01
9	c.2517G>A	T839T	0.02
12	IVS12+75G>A		0.08
14	IVS13-96A>G		0.04
	c.3039C>T	H1013H	0.24
	c.3105C>T	V1035V	0.01
15	c.3184G>A	A1062T	0.02
	IVS15+26A>G		0.03
16	c.3324G>A	P1108P	0.04
	c.3498C>T		0.37
	c.3548T>C		0.01

Table 4. PCR primers and conditions used to sequence genomic DNA for TERC and TERT

Gene	Exon	Forward primer	Reverse primer	Size	Taq polymerase	[Mg⁺²]	Annealing temperature
TERC		tcatggccggaaatggaact	gggtgacggatgcgcacgat	653	Advantage-GC	1.1	60
TERT	1	agcccctccccttccttt	ctccttcaggcaggacacct	451	Advantage-GC	1.1	60
	2a*	accagcgacatgcggaga	GTCGCCTGAGGAGTAGAGGAA	844	Advantage-GC	1.1	60
	2b	GGTGTACGCCGAGACCAAG	CGTTCGTTGTGCCTGGAG	486	Advantage-GC	1.1	58
	2c	CCGAGGAGGAGGACACAGAC	aaaccgcgtgtccatcaa	493	Amplitaq Gold	1.5	60
	3	ccttggtgagctggatgtg	cacagaatccacttggaccag	455	Amplitaq Gold	1.5	55
	4	gtgagcttccccctagtctgt	ataccaaatgtggggctcaa	307	Amplitaq Gold	1.5	55
	5	tttcaaacagggtctgaggaa	tgtgtcctcaacagtgacagg	478	Amplitaq Gold	1.5	55
	6	ggcagaggtgatgtctgagtt	agatacatgcaccacgacaca	385	Amplitaq Gold	1.5	55
	7	ggagtcccaggtgtgtctgta	caaggcacacagctcatcat	454	Amplitaq Gold	1.5	55
	8	cgcacttcatcacaaacactg	ccagaaaaggagactctggtg	328	Amplitaq Gold	1.5	55
	9	gctgaatggtagacgtgtcgt	cactgaatgcatcaaaagcaa	299	Amplitaq Gold	1.5	55
	10	agaattgcacaagctgatggt	gagaggacttggcagagacaa	419	Amplitaq Gold	1.5	55
	10	agtccctcgtagacagatacta	gcctcacCTGAGGAAGGTTT	149	Amplitaq Gold	1.5	55
	11	tgctccaaatcaccacttctc	cctcactcccacagaaagatg	486	Amplitaq Gold	1.5	55
	12	gatggcatgtagcatttggag	ccatgccttcatgtacacaca	486	Amplitaq Gold	1.5	55
	13	tctcctggttccttcctgtct	agacattccttgcccctaaaa	422	Amplitaq Gold	1.5	55
	14	tgcgtgttcatacagatggtg	tcctaagcccagattcactca	461	Amplitaq Gold	1.5	55
	15	ggaaatttcacctggagaagc	ccagcgtttaatcacataggg	481	Amplitaq Gold	1.5	55
	16	gtcctaggagggttggaggat	ATTCCTATGTGGGGAGTGGAA	489	Amplitaq Gold	1.5	55

Intron sequences are indicated by the lowercase letters; exon sequences are indicated by the uppercase letters. All primer sequences are listed from 5' to 3'. Advantage-GC Genomic polymerase (Clontech) was used with a final concentration of 1.0 M GC-Melt. Amplitaq Gold (Applied Biosystems) was used according to the manufacture's instructions.

*This amplicon also was sequenced by using the following internal primers: 5'-ACGCTAGTGGACCCCGAAG-3' and 5'-CCCTGACGCTATGGTTCCAG-3'.

This Article

Published online before print April 25, 2007, doi: 10.1073/pnas.0701009104 PNAS May 1, 2007