R-Spondin1 regulates Wnt signaling by inhibiting internalization of LRP6

Binnerts et al. 10.1073/pnas.0702305104.

Supporting Information

Files in this Data Supplement:

SI Figure 7
SI Figure 8
SI Figure 9
SI Figure 10
SI Figure 11
SI Figure 12
SI Methods

SI Figure 7

Fig. 7. RSpo1 and Wnt3A induce TCF reporter activation in a dose-dependent manner. HEK-293 cells stably expressing a 16TCF luciferase reporter (HEK-293 A6) show dose-dependent activation of 16TCF reporter activity upon treatment with recombinant RSpo1 or Wnt3A proteins.

SI Figure 8

Fig. 8. Expression of Wnt signaling components in HEK-293 and L-cells. mRNA expression levels of indicated genes in HEK-293 A6 cells (A) or mouse L- cells (B) were analyzed by Q-PCR as described in SI Methods.

SI Figure 9

Fig. 9. Validation of Wnt3A and WLS siRNA duplexes. (A) HEK-293 A6 cells were transfected with Wnt3A or nontargeting siRNA duplexes (50 nM) and Wnt3A mRNA levels monitored by Q-PCR. (B) HEK-293 cells were first transfected with HA-tagged Wnt3A plasmid and then with Wnt3A or control siRNA duplexes (100 nM). Wnt3A protein levels were analyzed by Western-blotting using anti-HA antibodies. (C) HEK-293 A6 cells were sequentially transfected with Wnt3A expression plasmid (3.5 ng/well) and Wnt3A or control siRNA complexes (50 nM) and reporter activity determined. (D) HEK-293 A6 cells were transfected with WLS or nontargeting siRNA (50 nM) and Wnt3a mRNA levels monitored by Q-PCR. (E) HEK-293 A6 cells were sequentially transfected with Wnt3a expression plasmid (3.5 ng/ well) and WLS or control siRNA complexes (50 nM) and reporter activity determined.

SI Figure 10

Fig. 10. RSpo1 antagonizes DKK1 activity in HEK-293 cells overexpressing LRP6 and Kremen1. HEK-293 A6 cells were transfected with LRP6 and Kremen1 receptors (18 ng each/well), treated with RSpo1 and DKK1 as indicated and reporter activity determined.

SI Figure 11

Fig. 11. Quantitation of RSpo1-dependent inhibition of LRP6 internalization. HEK-293 cells cotransfected with LRP6-HA and Kremen1 constructs were treated for 10 minutes with recombinant DKK1 (200 ng/ml) in the presence or absence of RSpo1 protein (800 ng/ml). Distribution of immunostained HA-tagged LRP6 was evaluated by confocal microscopy and the percentage of cells with LRP6 on the cell surface or in vesicles quantified. At least 100 LRP6-expressing cells were counted for each treatment condition.

SI Figure 12

Fig. 12. Validation of Kremen2 siRNA. HEK-293 cells were first transfected with HA-tagged Kremen2 plasmid, followed by transfection with Kremen2 or control siRNA duplexes (10 nM). Kremen2 protein levels were analyzed by Western blotting using antiHA antibodies.

SI Methods

Q-PCR. RNA was isolated from HEK-293 cells using an RNAeasy mini kit (Qiagen, Valencia, CA) and cDNA was synthesized using Cloned AMV RT and oligo-DT primers (Invitrogen). Q-PCR was carried out on an ABI Prism 7900HT instrument using SYBR green detection (Eurogentech, San Diego, CA). Primers used are: hWnt1 and hWnt3 (SuperArray, Frederick, MD), hWnt2 (forward: ctgtatcagggaccgagagg; reverse: cccacagcacatgacttcac), hWnt3A (forward: gccccactcggatacttctt; reverse: agcccagggaggaatactgt), hKremen1 (forward: ctggaaaccttggctgctac; reverse: tccgacaaaaactgatgcaa, hKremen2 (Superarray), and EF1a (forward: gtagattcgggcaagtccaccac; reverse: ttcccatctcagcagcctcctt). Expression of Wnt1, -2, -3, -3A, and DKK1 in mouse L-cells was analyzed using a mouse Wnt pathway Q-PCR array (SuperArray) according to the manufacturer's instructions. Expression of mDKK2 and 18S was analyzed using the following primers: mDKK2 (forward: taggaaggccacactccaag; reverse: cagaagtggcgagcacaac), mKremen1 and mKremen2 (Superarray), 18S (forward: gggagcctgagaaacggc; reverse: gggtcgggagtgggtaattt.