Narciso et al. 10.1073/pnas.0701743104.
Fig. 7. Short- and long-patch BER efficiency of cell extracts from proliferating and terminally differentiated muscle cells. Repair assay on plasmid DNA containing a regular abasic site (pGEM-AP) or a 2-deoxyribonolactone residue (pGEM-dL). pGEM (AP/dL) was incubated with cell extracts in the presence of a-32P-TTP. Repair products were analyzed by 15% urea-denaturing polyacrylamide gel, and the radioactivity for each band was quantified by using a PhosphorImager. The intensity of each band relative to the total 32P signal of all bands in the same lane is reported: (product) complete repair and (intermediate) repair intermediates produced by resynthesis of one or two nucleotides at the lesion site. The data relative to three independent experiments are shown. Error bars indicate standard deviation. Proliferating (P) and terminally differentiated (TD) cells.
Fig. 8. Efficiency of the incision and resynthesis steps of cell extracts from proliferating and terminally differentiated muscle cells. (A) Duplex oligonucleotides containing a single AP site were incubated at 30°C with whole-cell extracts for 5 min. The 5'-end-labeled oligonucleotide was the 3-hydroxy-2-hydroxymethyl tetrahydrofuran (THF)-containing strand. The products were separated by 20% urea-denaturing polyacrylamide gel. Incision reaction with decreasing concentrations (10, 5, 1, 0.5, 0.1, and 0.05 mg) of myoblast (lanes 1-6) and myotube (lanes 7-12) extracts. Lane 13, uncleaved oligonucleotides. At least two independent extracts per cell type were tested. (B) APE1 and b-tubulin protein levels in myoblasts (lane 1) and myotubes (lane 2). The measurement of the levels of APE1 in nuclear extracts at different days after addition of differentiation medium (days 0-3) showed no changes in the APE1 levels during differentiation (data not shown). (C) Duplex oligonucleotides containing a single-nucleotide gap were incubated with 5 mg of whole-cell extracts in the presence of a-32P-dCTP. The products were separated by 20% urea-denaturing polyacrylamide gel. Gap-filling reaction by myoblast (lanes 1-3) and myotube (lanes 4-6) extracts for increasing periods of time as indicated. At least two independent extracts per cell type were tested. (D) DNA polymerase b and b-tubulin protein levels in myoblasts (lane 1) and myotubes (lane 2).
Fig. 9. Induction of DNA SSB after H2O2 treatment of proliferating and terminally differentiated cells. Cultures of myoblasts (open bars) and myotubes (closed bars) were exposed to 100 mM H2O2 for 30 min and then incubated in drug-free medium. At different time intervals (30 min, 120 min, and 24 h), samples were taken for analysis by the comet assay. The tail moment (TM) of at least 100 comets per experimental point was measured by computerized image analysis, and the comets were classified in different classes according to TM values. Two independent experiments with similar results were performed. Proliferating (P) and terminally differentiated (TD) cells.
SI Materials and Methods
Cells and Growth Conditions. To induce terminal differentiation, proliferating myoblasts were plated on gelatin-coated dishes in DMEM containing 10% FBS. The day after seeding, DMEM containing 5% horse serum was added, and 48 h later terminal differentiation was reached.
Cell Extracts. Nuclear cell extracts used for Western blot analysis were prepared by resuspending cells in ipotonic buffer [10 mM Hepes (pH 7), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and 0.5 mM phenylmethylsulphonyl fluoride] for 1 h on ice. Nonidet P-40 was then added, and nuclei were collected and lysed in RIPA buffer [50 mM Tris·HCl (pH 8.0), 0.1% SDS, 1% Nonidet P-40, 0.5% sodium deoxycholate, 150 mM NaCl, 1 mM Na2EDTA, 1 mM PMSF, and 1m/ml of aprotinin, leupeptin, and pepstatin].
Plasmid Construction. Closed circular DNA containing a single uracil residue (pGEM-U) was produced by priming single-stranded (+) pGEM-3Zf DNA (Promega, Madison, WI) with a 30-fold molar excess of uracil-containing oligonucleotide and incubating with T4 DNA polymerase holoenzyme, single-stranded DNA binding protein, and T4 DNA ligase (Roche Diagnostics, Indianapolis, IN). Closed circular DNA duplex molecules were purified by cesium chloride equilibrium centrifugation. The uracil-containing oligonucleotide was 5'-end labeled by polynucleotide kinase and [g-32P]ATP precursor according to standard procedure to construct 32P-radiolabeled DNA plasmids that were used without further purification. Immediately before use, pGEM-U was treated with a catalytic amount of UDG (New England Biolabs, Ipswich, MA) to produce a single-AP site-containing plasmid (pGEM-AP). The generation of the abasic site was verified by APE1 treatment. Conversion of the lactone precursor to lactone (dL) to generate the pGEM-dL plasmids was completed by photolysis at 350-nm wavelength for 120 min before use.
Repair Assay. Plasmid DNA containing a regular abasic site or a lactone residue pGEM (AP/dl) were incubated at 30°C with cell extracts of proliferating or terminally differentiated muscle cell extracts in 25-ml reactions containing 5 mM MgCl2, 40 mM Hepes-KOH (pH 7.8), 0.5 mM DTT, 2 mM ATP, 20 mM dNTPs, 5 mCi a-32P-TTP, and 0.36 mg/ml of BSA. At each specified time point, reactions were terminated by addition of EDTA to 20 mM, and DNA was then recovered by ethanol precipitation. Repaired DNA molecules were digested with restriction endonucleases as indicated, and repair products were revealed by a 15% urea-denaturing gel and analyzed by using a PhosphoImager or Instant Imager. When the repair assay was performed with 32P-radiolabeled plasmid DNA, the radiolabeled dNTP was omitted from the reaction mixture and substituted with 50 mM of each dNTP. The closed and nicked plasmid forms were resolved on 1.2% agarose gel. When the repaired plasmid molecules were further analyzed by restriction endonuclease digestion, the resulting fragments were separated on 15% urea-denaturing gel.
Oligonucleotide Assays. Nicking Assay. [g-32P]ATP-end-labeled 5'-GATCCTCTAG (THF) GTCGACCTGCAGGCATGCA-3' oligonucleotides were annealed to the complementary counterpart to create duplex molecules containing a synthetic abasic site [3-hydroxy-2-hydroxymethyl tetrahydrofuran (THF)]. The duplex oligonucleotides were incubated at 30°C for 5 min in the presence of increasing quantities of whole-cell extracts in a buffer containing 70 mM Hepes/KOH (pH 7.8), 10 mM DTT, 3 mM MgCl2, and 1 mM Na2EDTA. After DNA purification, the incision products were separated in a denaturating 20% polyacrylamide gel, visualized and quantified by electronic autoradiography (Instant Imager; Packard, Meriden, CT)
Gap-Filling Assay. Single-nucleotide gap substrate was constructed by annealing three oligonucleotides specifically drawn to obtain a duplex substrate with a single-nucleotide gap at position 21:
5' upper strand, 5'-CTGCAGCTGATGCGC-3'; 3' upper strand, 5'-pGTACGGATCCCCGGGTAC-3'; lower strand, 5'-GTACCCGGGGATCCGTACGGCGCATCAGCTGCAG-3'.
Then 2 pmol of duplex molecules were incubated with 5 mg of total proteins at 37°C for different times. The incubation buffer contained 50 mM Hepes/KOH (pH 7.8), 2 mM Na2EDTA, 1 mM DTT, 10 mM MgCl2, 100 mM KCl, and 330 nM a-32P-dCTP. After DNA purification, the reaction products were resolved on a denaturating 15% polyacrylamide gel, visualized, and quantified by electronic autoradiography.
Ligation Assay. The sequence of the 61-nt strand was 5'CTCGAGGTCGACGAATTCTAGTGATGGTGATGGTGATGCAGCAGGTCCGAGATGACGTACT3'. Annealed molecules were incubated at 30°C for increasing time with 40 mg of whole-cell extracts. The incubation buffer was the same described for the BER plasmid assays. After DNA purification, the reaction products were resolved on a denaturating 12% polyacrylamide gel, visualized, and quantified by electronic autoradiography.
Measurement of 8-hydroxyguanosine by HPLC/ED. Briefly, DNA was isolated and incubated with RNases A and T1 at 37°C for 1 h and precipitated. Enzymatic digestion was then performed at 37°C by using nuclease P1 (Boehringer Mannheim, Monza, Italy) for 2 h and alkaline phosphatase (Boehringer Mannheim) for 1 h. Enzymes were precipitated by the addition of CHCl3. DNA hydrolysate was analyzed by HPLC/ED (Coulochem I, ESA, Inc., Chelmsford, MA) by using a C18 250 ´ 46-mm, 5-microm Uptishere column (Interchim, Montlucion, France) equipped with a C18guard column. The eluent was 50 mM ammonium acetate (pH 5.5) containing 9% methanol at a flow rate of 0.7 ml/min. The potentials applied were 150 and 400 mV for E1 and E2, respectively. The retention time of 8-OH-dG was »23 min. Deoxyguanosine was measured in the same run of corresponding 8-OH-dG with a UV detector (model SPD-2A; Shimadzu, Kyoto, Japan) at 256 nm; the retention time of dG was »17 min.
DNA Damage Analysis. Comet Assay. Briefly, cells were embedded in agarose gel and then spread on a microscope slide. After lysis cells were preincubated in the electrophoresis buffer (300 mM NaOH, 1 mM EDTA) and subjected to alkaline gel electrophoresis (25V, 30 mA). Cell DNA was stained with ethidium bromide (Sigma-Aldrich, St. Louis, MO) and examined at ×200 magnification with an Olympus fluorescent microscope. Slides were analyzed by a computerized image analysis system (Delta Sistemi, Rome, Italy). To assess the amount of DNA damage, computer-generated tail moment (TM) values (tail length × fraction of total DNA in the tail) were used.
gH2AX Foci Analysis. Before treatment, cells were pulse labeled for 30 min with 30 mg/ml bromodeoxyuridine. Cells were fixed with 2% formaldehyde/PBS for 10 min, permeabilized by using 0.2% Triton X-100 for 10 min, and incubated with 3% normal goat serum/PBS for 60 min. After blocking, cells were incubated for 2 h with mouse monoclonal anti-gH2AX antibody (1:1,500; Upstate Biotechnology, Lake Placid, NY) alone or in combination with Alexa488-conjugated anti-BrdU (1:50; Invitrogen, Carlsbad, CA). Cells were then washed extensively and incubated with fluorescent secondary antibodies (Alexa 594-conjugated anti-mouse) before being counterstained for 3 min with 0.1 mg/ml solution of Hoechst 33258 dye in PBS.