Antagonistic nature of T helper 1/2 developmental programs in opposing peripheral induction of Foxp3⁺ regulatory T cells

Wei et al. 10.1073/pnas.0703642104.

Supporting Information

Files in this Data Supplement:

Fig. 5. Robust Foxp3⁺ Treg differentiation from naïve CD4⁺ T cells induced by TGF-b1. Naive CD4⁺ T cells were stimulated by plate-bound anti-CD3 and soluble anti-CD28 in the presence of various amounts of TGF-b1 for 4 days to induce Foxp3⁺ Tregs. (A) Representative FACS plots of anti-Foxp3 and anti-CD25 double staining (Left) and histograms of anti-Foxp3 single stain (Right). (B) TGF-b1 dose-dependent induction of Foxp3⁺ Tregs measured by FACS staining (averaged from three independent experiments ± SD). (C) Western blot analysis of Foxp3 protein expression induced TGF-b1. Untreated naïve CD4⁺ cells (naïve) and natural Tregs (n-Treg) were included as controls. (D) Suppressive activity of TGF-b1 induced Foxp3⁺ Tregs measured by [³H]thymidine incorporation assay (Left) and CFSE-based proliferation assay (Right). Control, target cell only; No TGF-b1, normal effector cells; +TGF-b1, TGF-b1-induced Tregs.

Fig. 6. Inhibition of Foxp3⁺ Treg differentiation by T helper polarizing cytokines. Dose-dependent inhibitory effect on Foxp3⁺ Treg induction by IL-12, IFNg, and IL-4 was quantified. IL-6 treatment was included for comparison. Foxp3 expression is assayed by FACS staining as in SI Fig. 5A.

Fig. 7. Mutual antagonistic effect between IL-4 and TGF-b1 in regulating Foxp3⁺ Treg differentiation. Two-way dose titration was performed to determine the antagonistic relationship between IL-4 and TGF-b.

Fig. 8. Low levels of TGF-b fail to completely inhibit autocrine production of IFNg/IL-4 in naïve CD4⁺ T cells induced by antigen receptor activation, which may antagonize Foxp3⁺ Treg differentiation. Naïve T cells from WT mice were stimulated by anti-CD3 and soluble anti-CD28 in the presence of various amounts of TGF-b1 (0.1-10 ng/ml) to induce Foxp3⁺ Treg differentiation. (A) Anti-Foxp3 and anti-CD25 double staining (Left) and histogram of anti-Foxp3 single staining (Right). (B) FACS plots of intracellular staining for IFNg (Left) and IL-4 (Right). Percentage numbers were averaged from two independent experiments.

Fig. 9. The requirement of Stat4-dependent pathway and IFNg receptor signaling for IL-12 to inhibit Foxp3 induction. Naïve CD4⁺ T cells from WT, Stat4, and IFNgR1 knockout mice were stimulated by anti-CD3/spleen APC in the presence of 1 ng/ml TGF-b1. IFNg (100 ng/ml) or IL-12 (10 ng/ml) was added to the cultures as indicated to examine their effect on Foxp3⁺ Treg induction. Representative FACS plots of Foxp3 staining are shown, and the numbers were averaged from two independent experiments.

Fig. 10. Inhibition of Foxp3⁺ Treg development by Th1/Th2 polarizing cytokines correlates with their instructive role in driving Th1/Th2 lineage fates. Naïve CD4⁺ T cells from WT mice were stimulated by anti-CD3 and soluble anti-CD28 under various priming conditions: primed by IL-12 (10 ng/ml), IFNg (100 ng/ml), or IL-4 (10 ng/ml) in the presence of TGF-b1 (1 ng/ml) or TGF-b1 alone (A); primed under nonpolarizing, Th1-polarizing (10 ng/ml IL-12), Th2-polarizing (10 ng/ml IL-4), or neutral (10 mg/ml anti-IFNg plus 10 mg/ml anti-IL-4) in the absence of TGF-b1 (B). Th1 and Th2 differentiation were measured by intracellular staining for IFNg and IL-4, respectively.

Fig. 11. A model illustrates the negative cross-regulation of Foxp3⁺ Treg fate imposed by Th1/Th2 polarization cytokines, autocrine IFNg/IL-4, and Th1/Th2 lineage transcription factors T-bet/GATA-3.

SI Materials and Methods

Tissue Culture Reagents and Antibodies. T cell cultures were carried out in complete RPMI medium 1640 supplemented with 10% FCS, 2 mM L-glutamine, 1 mM Na pyruvate, 0.1 mM nonessential amino acids, 10 mM Hepes (pH 7.04), 1´ penicillin/streptomycin, and 50 mM 2-merceptoethanol (Invitrogen). Tissue culture grade (NA/LE) mAbs to CD3e(145-2C11), CD28 (37.51), IL-4 (11B11), IFNg (XMG1.2), and the IgG isotype controls were obtained from BD Biosciences. Neutralizing mAbs to IL-4 (11B11) and IFNg (XMG1.2) for in vivo experiments were from Bio-Express. Human rTGF-b1 was from eBioscience; mouse rIL-12 was from R & D Systems; human rIL-2, mouse rIL-4, and rIFNg were from PeproTech; and phorbol 12-myristate 13-acetate (PMA) and ionomycin were from Sigma-Aldrich. OVA_323-339 (ISQAVHAAHAEINEAGR) peptide was synthesized and purified by reverse-phase HPLC (>98% purity) at the M. D. Anderson Cancer Center peptide core facility.

Cell Preparation. Single-cell suspensions were prepared from pooled lymph nodes and spleen. CD4⁺ cells were enriched by depleting CD8⁺ T cells, B cells, and myeloid cells using rat anti-mouse mAbs (BD Biosciences) to CD8a (53-6.7), B220 (RA3-6B2), CD11b (M1/70), and Gr-1 (RB6-8C5), followed by sheep anti-rat IgG Dynal beads (Dynal). Enriched CD4⁺ cells were stained with PerCP-labeled anti-CD4 (L3T4), FITC-labeled anti-CD62L (MEL-14), and APC-labeled anti-CD25 (PC61) and further sorted on a FACSAria cell sorter (Becton Dickinson) to obtain pure populations of CD4⁺CD25^-CD62L^hi naïve T cells (>99% purity). To prepare spleen APCs, T cells were depleted from total splenocytes by using anti-Thy1.2 Dynal beads (Dynal, >95% purity), and the resulting cells were g-irradiated (3,000 rad) before culture. Dendritic cells were derived from GM-CSF bone marrow cultures.

Cell Culture. All experiments were performed with highly purified CD4⁺CD25^-CD62L^hi naïve T cells (>99% purity). For plate-bound anti-CD3 stimulation, the cells were cultured on 2 mg/ml anti-CD3-coated plastic with 2 mg/ml soluble anti-CD28. For stimulation with soluble anti-CD3, 0.5 mg/ml anti-CD3 was used with g-irradiated, T cell-depleted spleen APCs. For antigen-specific stimulation, purified OT-II T cells were incubated with 2.5 mg/ml OVA_323-339 peptide presented by g-irradiated, T cell-depleted spleen APCs or bone marrow-derived dendritic cells. rIL-12 (10 ng/ml) and rIL-4 (10 ng/ml) were used for Th1 and Th2 polarizing, respectively, and 10 mg/ml anti-IFNg and anti-IL-4 were used for neutral priming. rTGF-b1 (0.1-10 ng/ml) was used for Foxp3⁺ Treg induction. rIL-12 (0.1-10 ng/ml), rIFNg (1-100 ng/ml), or rIL-4 (0.1-10 ng/ml) was added together with rTGF-b1 as indicated for Treg inhibition studies. Cells were expanded with 50-200 units/ml rIL-2 and harvested on days 6-8 for analysis or for secondary culture. For secondary stimulation, dead cells were removed by centrifugation over Lymphoprep (Axis-Shield PoC AS). After washing, the cells were restimulated on anti-CD3-coated plastic (1 mg/ml) with rIL-2 (50-200 units/ml) and rTGF-b1(1-3 ng/ml). Neutralizing mAbs to IFNg and/or IL-4 were also added to the cultures as indicated.

[³H]Thymidine Proliferation Assay. CD4⁺CD25^- and CD4⁺CD25⁺ cells were purified from lymph nodes and spleen of C57BL/6 mice with anti-CD4 and anti-CD25 MACS beads (Miltenyi Biotec). CD4⁺CD25^- target cells (5 ´ 10⁴) were cultured either alone or with different effector cells in the presence of irradiated T cell-depleted spleen APCs (5 ´10⁴) and 0.5 mg/ml anti-CD3 (145-2C11) in 200 ml of complete RPMI medium 1640. The cells were cultures for 72 h in 96-well flat-bottom plates. [³H]Thymidine (1 mCi per well; NEN) was added in the last 16 h of this 72-h culture. Results are expressed as the mean of triplicate wells ±SD.

CFSE-Based Suppression Assay. CD4⁺CD25^- and CD4⁺CD25⁺ cells were sorted from lymph nodes and spleen of C57BL/6 mice with a FACSAria (Becton Dickinson). A total of 2 ´ 10⁷ cells per milliliter of CD4⁺CD25^- T cells were incubated with 4 mM CFSE in PBS at 25°C for 5 min. The CFSE-labeled target cells (5 ´ 10⁴) were cultured either alone or with different effector cells (1:1 target:effector ratio) in the presence of irradiated T cell-depleted spleen APCs (5 ´10⁴) and 0.5 mg/ml anti-CD3 in 200 ml of complete RPMI medium 1640. The cells were cultures for 72 h in 96-well plates, and proliferation was assessed by the CFSE dilution profile of the labeled target cells acquired on a FACSCalibur.

Real-Time PCR. Total RNA was extracted by using RNeasy Miniprep kit (Qiagen) and subsequently converted to cDNA with oligo-dT, random hexamers, and SuperScript RT II according to the manufacturer's protocol (Invitrogen). Real-time PCR was performed by SYBR Green Gene Expression Assays using the Universal PCR Master Mix (Applied Biosystems) and the ABI-PRISM 7500 Sequence Detector System (PerkinElmer). The following gene-specific PCR primers were used: murine Foxp3, agaagctgggagctatgcag (forward) and gctacgatgcagcaagagc (reverse); ubiquitin, tggctattaattattcggtctgcat (forward) and gcaagtggctagagtgcagagtaa (reverse). Target gene expression was calculated by using the comparative method for relative quantitation upon normalization to ubiquitin housekeeping gene.

• Early Edition
• Archives
• Online Submission

• Feature Articles

  (Expanded research articles of exceptional breadth)

• Commentaries

  (Expert commentary on leading research)

• Letters

  (Online-only letters to the editor)

• Inaugural Articles

  (Articles by recently elected NAS members)

• PNAS Profiles

  (Biographical profiles of Academy members)

• Sustainability Science

  (Interactions of human and environmental systems)

• Collected Papers

  (Editorials, Perspectives, Reviews, Colloquia, etc.)

• Special Features

  (Solicited articles on exceptional research topics)

• Sackler Colloquia

  (Scientific reports held under NAS auspices)

• Podcasts

  Brief podcasts with leading scientists