Bischof et al. 10.1073/pnas.0611511104.

Fig. 4. Chromosomal analysis of transgenic fC31 integrase lines.
(a) Line Df(3L)G680 carries an EMS-induced deletion at position 75B-C, spanning a region of approximately 500 kb (arrow). The Inset shows a close-up of this region from another sample, the chromosomes being dissociated. (b) Example of an inversion present in a CyO balancer line. (c and d) A representative example for one chromosome preparation of line nos-fNLS-zh86Fb/attP-zh102D (c), and for one example of line attP-zh86F/vas-f-zh102D (d) (see Table 1). Samples were examined at a magnification of ´100. Chromosomal regions of minor quality were analyzed in neighboring chromosomes of the same sample. None of altogether 136 chromosome preparations analyzed revealed any chromosomal abnormalities.
Fig. 5. Detection of b-galactosidase activity in representative ZH-attP lines.
Transgenic lacZ lines were crossed to apterous (ap)- and omb-Gal4 driver lines. The b-galactosidase activity in third instar wing imaginal discs of the indicated attP lines was detected by standard X-gal color reaction (color reaction was stopped after 20 min at room temperature). The observed expression domains correspond to the pattern expected from the driver lines used (the same is the case for the other seven lines listed in Table 3).
Table 4. ZH-attP lines and their genomic location of the attP landing sites
|
ZH-attP line |
Chrom. 1 |
|
ZH-attP line |
Chrom. 3 |
|
zh-1E |
X 1E |
|
zh-62B |
3L 62B |
|
zh-2A |
X 2A |
|
zh-64A |
3L 64A |
|
zh-3Aa |
X 3A |
|
zh-67C |
3L 67C |
|
zh-3Ab |
X 3A |
|
zh-68E |
3L 68E |
|
zh-3B |
X 3B |
|
zh-70C |
3L 70C |
|
zh-5D |
X 5D |
|
zh-75C |
3L 75C |
|
zh-6E |
X 6E |
|
zh-75D |
3L 75D |
|
zh-14F |
X 14F |
|
zh-82F |
3R 82F |
|
zh-20C |
X 20C |
|
zh-83A |
3R 83A |
|
zh-X |
X-linked |
|
zh-83D |
3R 83D |
|
ZH-attP line |
Chrom. 2 |
|
zh-85D |
3R 85D |
|
zh-21F |
2L 21F |
|
zh-85Ea |
3R 85E |
|
zh-22A |
2L 22A |
|
zh-85Eb |
3R 85E |
|
zh-27F |
2L 27F |
|
zh-85F |
3R 85F |
|
zh-30A |
2L 30A |
|
zh-86Da |
3R 86D |
|
zh-30B |
2L 30B |
|
zh-86Db |
3R 86D |
|
zh-32C |
2L 32C |
|
zh-86Dc |
3R 86D |
|
zh-35B |
2L 35B |
|
zh-86Fa |
3R 86F |
|
zh-36B |
2L 36B |
|
zh-86Fb |
3R 86F |
|
zh-38D |
2L 38D |
|
zh-87E |
3R 87E |
|
zh-44F |
2R 44F |
|
zh-88A |
3R 88A |
|
zh-45A |
2R 45A |
|
zh-88D |
3R 88D |
|
zh-46A |
2R 46A |
|
zh-89E |
3R 89E |
|
zh-46D |
2R 46D |
|
zh-91B |
3R 91B |
|
zh-49B |
2R 49B |
|
zh-92Aa |
3R 92A |
|
zh-49D |
2R 49D |
|
zh-92Ab |
3R 92A |
|
zh-50C |
2R 50C |
|
zh-93D |
3R 93D |
|
zh-51C |
2R 51C |
|
zh-94D |
3R 94D |
|
zh-51D |
2R 51D |
|
zh-96E |
3R 96E |
|
zh-52E |
2R 52E |
|
ZH-attP line |
Chrom. 4 |
|
zh-58A |
2R 58A |
|
zh-102D |
4 -102D |
|
zh-59D |
2R 59D |
|
|
|
|
zh-60E |
2R 60E |
|
|
|
List of the mapped attP lines. ZH-attP-X could be mapped to the X chromosome, but due to three X-chromosomal hits not to a specific cytological region. Similarly, several hits each were found for three more lines, indicating integration into repetitive elements (not included in this list). Lines highlighted in gray contain a putative intergenically located landing site (according annotated genes or GCs provided in Ensembl V.41).
SI Text
Plasmid Constructions
pM{3xP3-RFPattP}. The ORF of RFP was equipped with a tubulina1 3' UTR and inserted into pBluescript (pBSIISK), resulting in construct pRFP-tuba1. On either site of the insert, a loxP site was placed, both orientated in the same direction, giving rise to construct ploxP-RFP-tuba1-loxP. The 3xP3 fragment was then PCR-amplified from pMos{3xP3-EGFPafm} (1), cut with NotI, and introduced between the 5' loxP site and the ORF of RFP, resulting in the construct ploxP-3xP3-RFP-tuba1-loxP.
pMos{3xP3-EGFPafm} was used as template to PCR-generate two fragments: one of approx. 550 bps containing the mariner 3'IR element, and one of approx. 700 bps containing the mariner 5'IR. In both cases, the fragments contained flanking sequences on both sides of the mariner IR. The mariner 3'IR element was cut with ApaI/PstI and ligated into a pBSIISK vector containing an inactivated Asp718, creating the construct pmar(3). Next a 221 bp attP fragment was PCR-amplified from template pBCPB+ (2), cut with PstI/XbaI, and together with an XbaI/SacII digested mariner 5'IR simultaneously ligated into pmar(3), which was opened with PstI/SacII. This led to pmar(3)-attP-mar(5). Last, the loxP-3xP3-RFP-loxP cassette from ploxP-3xP3-RFP-tuba1-loxP was released with Asp718, and ligated into the Asp718 site of pmar(3)-attP-mar(5) (this Asp718 site was previously introduced via the reverse primer used for generating mariner 3'IR). This gave the landing site construct pmar(3)-3xP3-RFP-attP-mar(5), abbreviated as pM{3xP3-RFPattP}, which was used for the generation of the ZH-attP lines 1-16.
In the attP sequence used a T-C transition was noticed at position 26 downstream of the crossover TTG site. This transition was already present in the PCR template pBCPB+. Although this nucleotide exchange was outside of the "core region" of 39 bps (3), and even outside of the "footprint" region (4), another landing site construct with a corrected attP site was generated. For this plasmid pCaryP (2) was used as PCR template and a 221bp attP fragment was generated (5 superfluous bps present between the attP fragment (221 bps) and the flanking PstI/XbaI sites were also eliminated). The newly generated fragment was used to replace the previous attP site, giving rise to the version of the landing site construct pM{3xP3-RFPattP'}, which was then used for generating the ZH-attP lines 17-68.
pUASTattB. A pBSIISK vector with an inactivated Asp718 site was cut with XbaI/SacI, followed by blunting and religation to delete part of the polylinker. The white gene was PCR-amplified from the pUAST vector (5) and cloned as a DraII/(NheI)BamHI fragment into the modified pBSIISK vector mentioned above (a restriction site in parentheses indicates that this site was introduced via the PCR primer). A double-stranded loxP oligonucleotide was then ligated into the NheI site. Next, a 285 bp attB fragment was PCR-amplified from pUASTB (2) and introduced as an SpeI fragment downstream of white-loxP. Last, the UAS-MCS-SV40 cassette was released with BamHI from a pUAST template and ligated into the assembled construct, resulting in the transformation vector pUASTattB.
pUAS-lacZattB. A lacZ gene containing a N-terminal SV40 nuclear localization signal (NLS) was PCR amplified from the vector pX27 (6) and cloned via EcoRI/XhoI into the MCS of pUASTattB, resulting into pUAS-lacZattB.
pnos-fC31NLS. The coding region of the fC31 gene was amplified by PCR from pET11C31-polyA using a 5' primer containing a unique NdeI site and a 3' primer containing the coding sequence for an SV40 NLS and a unique EcoRI site. The product of this reaction was cut with NdeI and EcoRI and cloned into the pHSX-nosN plasmid (a gift from E. Gavis). The region containing the fC31NLS flanked by the nanos promoter/5' UTR and 3'UTR was then excised from this plasmid using NotI and cloned into the P-element vector, C4-yellow.
p3xP3-EGFP/vas-fC31(+/-NLS)attB. To fuse the vasa promoter/5' UTR sequence to the fC31 integrase, overlap extension PCR was applied (7). As PCR templates Pvas-egfp-vas (8) and pET11fC31poly(A) (2) were used to generate a fragment consisting of about 320 bp of the vasa promoter/5' UTR and about 1.2 kb of the fC31 integrase (N-terminal part). This fusion-fragment was subcloned into a pCR2.1-Topo plasmid, which was then further used as a vector to include the PCR-amplified C-terminal part of the fC31 integrase via BstEII/XhoI. This resulted in the construct Pshortvas-fC31, containing part of the vasa promoter, the full vasa 5' UTR, and the complete ORF of the fC31 integrase. Next Pvas-egfp-vas was cut with PstI/XhoI, leading to the release of a fragment containing about 2.2 kb of the vasa 5'-flanking sequence and the egfp ORF, which was ligated into a pBS vector. This construct was cut with NdeI/XhoI, leading to the release of the approx. 320 bp vasa promotor/5' UTR sequence and the egfp. The remaining construct was used as a vector to hold the NdeI/XhoI fragment of Pshortvas-fC31, leading to pPlongvas-fC31. This plasmid contained about 2.2 kb of the vasa 5'-flanking sequence and the complete ORF of the fC31 integrase. For the NLS-version pPlongvas-fC31 was cut with BseAI/XhoI and then used as vector to integrate the PCR-amplified C-terminal fC31 integrase stretch with an attached NLS, right before the stop codon, leading to pPlongvas-fC31NLS. The NLS motif used resembles the SV40 T-antigen NLS (PKKKRKV), which was introduced via the 3' fC31 integrase PCR primer. Next the vasa 3'-flanking sequence was introduced into the two constructs, containing the vas 3' UTR and genomic sequence. For this, a PCR fragment of 575 bp downstream of the vasa stop codon was generated from Pvas-egfp-vas and ligated into the two constructs via XhoI/ApaI, resulting in the constructs pPlongvas-fC31-vas3' UTR and pPlongvasfC31NLS-vas3' UTR. Next a 285 bp attB sequence was PCR-amplified from the pUASTB vector and introduced into the mentioned pBSIISK vector (DXbaI/SacI) via SpeI sites. The resulting attB-containing plasmid was then digested with BamHI, followed by blunting and PstI digestion. This plasmid was used as a host for the vasa-fC31(NLS)-vasa cassettes present in the above-described constructs; these cassettes were released via ApaI, blunting, and PstI, and then introduced into the provided attB-containing vector. This led to the constructs pPlongvas-fC31-vas3'UTR-attB and pPlongvas-fC31NLS-vas3'UTR-attB (here referred to as "vasa-fC31" constructs).
Both constructs were then equipped with a 3xP3-EGFP-loxP cassette, which was assembled as follows. Construct pMos{3xP3-EGFPafm} was used as PCR template to amplify the 3xP3 part, and independently, the EGFP-SV40 part (this was done to eliminate some restriction sites). The 3xP3 fragment was cut with ApaI/XhoI, the EGFP-SV40 fragment with XhoI/PstI, and both were simultaneously ligated into pBSIISK (DXbaI/SacI) prepared with ApaI/PstI. Next the loxP site was introduced with the loxP oligonucleotide via NheI (the NheI site was introduced previously via the reverse primer in the PCR amplification of EGFP-SV40). The generated 3xP3-EGFP-SV40-loxP cassette was released with ApaI/PstI and integrated via the same sites into the "vasa-fC31" constructs (mentioned above), leading to the final integrase constructs, abbreviated as p3xP3-EGFP/vas-fC31attB and p3xP3-EGFP/vas-fC31NLSattB.
p3xP3-EGFP/nos-fC31(+/-NLS)attB. These two constructs were to a large extent cloned along the lines of the two vasa-fC31(+/-NLS) constructs. Therefore only the sequences of the nanos regulatory regions are described. The fC31(+/-NLS) fragment was flanked by 935 bp nanos upstream sequence, which was derived from the construct pBSPnosNcoID (gift of E. Gavis), and by 946 bp nanos 3' UTR plus flanking sequence, which was derived from construct pBSKSnos3'UTR (gift of E. Gavis).
p3xP3-RFP/wEx3-6attP/B. First, the 3xP3-RFP-tuba1 cassette was PCR-amplified from the template pM{3xP3-RFPattP} and subcloned into a pCRII-Topo vector. Next this cassette was released with SpeI/XhoI (including some vector sequences next to the SpeI cutter of the Topo MCS) and ligated into a pBSIISK vector with an inactivated BamHI site (plus DXbaI/SacI). This was digested with XhoI and a double-stranded loxP oligonucleotide was introduced, giving the vector ploxP-3xP3-RFP-tuba1. The whiteEx3-6 fragment (exons 3 to 6) was PCR-amplified from pUAST and ligated into pBSIISK via XhoI/BamHI. In detail, the whiteEx3-6 part contains the sequences of exon 3-6, the intervening introns 3-5, and the 57 bps of intron 2 next to exon 3 (all with respect to the sequence present in the pUAST vector). This plasmid was then cut with BamHI/SpeI to introduce a double-stranded oligonucleotide containing 54 bps of the core region of attP. This places the attP into the intron 2 of white. In the next step the fragment loxP-3xP3-RFP-tuba1 was released via Asp718/XhoI, and the whiteEx3-6attP fragment via XhoI/SpeI, followed by simultaneous ligation of both fragments into a pBSIISK vector cut with Asp718/SpeI. This produced the plasmid p3xP3-RFP/wEx3-6attP. Last, this construct was opened with SpeI and a PCR-generated attB fragment of 254 bps from the template pBSPB+ (2) was introduced via SpeI, resulting in p3xP3-RFP/wEx3-6attP/B. This attB fragment was trimmed at its 5' part, only leaving 24 bp upstream of the TTG-crossover site, whereas a long 3' attB part of 227 bps was used (downstream of TTG). (The 3xP3-RFP and wEx3-6 parts are orientated in a reverse/complement fashion, see Fig. 3).
pwP-Ex2UASTattB. First, the whiteE2 fragment was generated. It consists of the white promoter, the white exons 1 and 2, the white intron 1, and the first 17 nucleotides of white intron 2 (all with respect to the sequence in the pUAST vector). The whiteP-Ex2 fragment was PCR-amplified from pUAST and ligated into pBSIISK via XhoI/BamHI. This plasmid was then cut with BamHI/SpeI to introduce a double-stranded oligonucleotide containing 50 bps of the core region of attB, resulting into construct pwP-Ex2attB. Next the UAS-MCS-SV40 cassette was PCR-amplified from a pUAST template and ligated via BamHI (NheI)/BamHI into construct pwP-Ex2attB, resulting into pUAS-MCS-SV40wP-Ex2attB. Finally, this construct was digested with NheI, and a double-stranded loxP oligonucleotide was then introduced via NheI. This led to the split-white transformation vector ploxP-UAS-MCS-SV40wP-Ex2attB, abbreviated as pwP-Ex2UASTattB (see Fig. 3)
PCR fragments were generally subcloned; generated sequences and orientations were verified by sequencing. Further details regarding cloning, other constructs, and primer sequences are provided upon request.
1. Horn, C. & Wimmer, E. A. (2000) Dev. Genes Evol. 210, 630-637.
2. Groth, A. C., Fish, M., Nusse, R. & Calos, M. P. (2004) Genetics 166, 1775-1782.
3. Groth, A. C., Olivares, E. C., Thyagarajan, B. & Calos, M. P. (2000) Proc. Natl. Acad. Sci. USA 97, 5995-6000.
4. Thorpe, H. M., Wilson, S. E. & Smith, M. C. (2000) Mol. Microbiol. 38, 232-241.
5. Brand, A. H. & Perrimon, N. (1993) Development 118, 401-415.
6. Segalat, L., Berger, G. & Lepesant, J. A. (1994) Mech. Dev. 47, 241-251.
7. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease, L. R. (1989) Gene 77, 61-68.
8. Sano, H., Nakamura, A. & Kobayashi, S. (2002) Mech. Dev. 112, 129-139.
Sequences
Genomic sequences (5'-3' direction) immediately flanking the landing site at the mariner 5' terminal repeat, which lies at the 3' end of the landing site construct (see Fig. 1a), of 25 attP lines.
ZH-attP-2A:
TATATATTTCTTCGCGGTAACCTCTGCCCATTTTCGGATCTTTGTGCTGGCTCGCTCATCCATCCCTACCTACCGACTCCAAGCGACTACTACTCCTTCCCTGGTCAGGCCTAGCCATGTGACTACTTCATCCGCAAGTAAGCGATACCTCGGCTGGGCTCTTGTTTGTAACAATCTTACTTTCTGCATGCATTTGCTGTACTAATGATTATATAGAGCACACACGGGCCCACACACACCACACCAAGTC
ZH-attP-3B:
TAAGGTCGGGTCTCCAAAAAAGGCATAAAACCCAGAAAAGGCAATGAAAATTGCCAAGTCGCATTATTTATCGTATACGCATCGGGGAGTATAGCGAGCACACACACACACGCACACAAGTGCTCTTAAATGCACACACACAGACACAGATACACACACACACACATGCAGTGTTAGAGCGGAAGGGGGCAAAACAAAATGGCGCTGCATTCATAATGGCGGTTGGTGGTTCGGTCGCTTCCTGTCGTCG
ZH-attP-6E:
TAATCGTTGGTCACCTCCTGGAATTCCTGTTCGCCTGGTAATTTAAGCCGAAAATCTCTAAATTTTGCTTACAAAATGAGCATTTTAGTGGCAAATTTTGGGATGTTTGGTACCAGGCCATCATACTCAGTAGCGGGTGTCTACTGAAAACCAACTAATCGTTGGTCGCCTCCTGGAATTCCTGTTCGCCTGGTAATTTAAGCCGAAAATCTCTAAATTTTGCTTACAAAATGAGCATTTTAGTGGCAAA
ZH-attP-20C:
TATATCTCCGCCTGTCTAAGCCTTAAGTCAGCTCATTTCCTAAATGCTCACTAATCATCCAAACTACCGGCATTCAAAGACGACGACCGCCTTCGCACATCTCAATTAGTGGCAATAAATTTAAGTTTCATTTAGGTGCGAAGCACAGTT
ZH-attP-22A:
TACATTGTTTATACGAGAGCTGTCTTTGCACGGCTCCCAAAAATATGACTCACAAGAAGTTTGACTTCACTCCTTCATTCCGAGGTATGAAATATTTATAAACGCATAATGCATGGCATGTGAAGTGAGGTGAGATGAGGTGACGTTTGAAGGATGCACTGCGAAGCAGCCAGCTGCAAGATCATCATCAAATGCATCAACCCCTCAACGGCGAACCCATCGACGACTTCAAACGAAAACGAAGCGTGTT
ZH-attP-30A:
TAGATGGTGGTGTCCTTTGAAATGTTGTTGCAAATTGTTAGCTCTTGTCCCATAAAAGTGCACATAAAATCAAAAAGGGGAAAAATGTGCGGGCCTCCCTCCCCTAACAATTCCCAAACATTTTCGCATGGCACGCCAAGCAATTAAAGCGGCCCATACAAAACTCCAACTCCGCGTTGCATGTGGCAAACTTCTGGTTCCCAACTGGCGCCCAAATGGCGGACATGTCGACGGCGGCGCCTCAATGTCA
ZH-attP-35B:
TATTAAGTGGCTCTTTAGGACCTGTTAAAAATGCCCGAACACGCCCGCCCAAAAAAGTTGGCATTGCTAACCCAATTTTCCCCGGTATGGGAATCTGCGTGCGATTCAAATTTCCATTTCCTTCAATCGCCATTGGCCAGCTCGGCCAAACACACGCACACCTGCCGAGCGGGGCCAACAAATTTCACTTATTGCCAATTTGCTGGCAATGAAATAAAATACTTTTCTTCCGCGACGCGCCTGTTTGTTG
ZH-attP-36B:
TAAAACAAAAGTAAGTTGAGTAGCCTCGGTACTTCGAGAAGATTTCCCAATCTAAGCGCCACTTTGGACATTCGATACCCATTTCGTTATTAGTTTTCTGCTGAAATGGAATTTTTCTGCAGTATATAATGTGGCATTCGCCCCATAAATTGTCAACGCATGTTGTCAAGGTGCTTCGGACACTTTTTTCAATTAATTGGCGAAACTTCAAATTTCACTTTTTCTTTATTTCTTGCTTATTTTTTTTTCT
ZH-attP-51C:
TAAGTGGCATTTTTAAATTGATTAAAAAAGAATTGGTGATGCAGCCAGTGCCTTCTTCGCAGTTTTCATTCGCTACTCCAGCTCATTGTGGCTCTGAATTTTCCCCTTGTTTTTCGCTGGCGTTTAATTAACGAGGCCTGGACGACATTTGTGCCGAGCGACATTTTTAATTTCCTTTATTTTGTACTCAGCAACATCGGAAGTGCCGTCAGCCAAACCGGAAGTACGCCGCTCACACACACACTCACAC
ZH-attP-51D:
TAAAAGGGTGGGATGTGACGTTAGCTCCTCAACTACCTGAAATTGTTTTACTAATTTGATAAGTAACAAGGAACTGTTGCAGCTATTTTCTTTATTTCTTTAATTTACTAAATAAAACATATATTCTCTTAATCATAGCATTTTCACATTGTTAAAAGCTAAGTTTTTGAAAGCCGCTCGCCTGCATGATGCCACTATGCCCAATTCGATCCACTGTGCAATATCTTGTGAACTTGATTTGGGGAGCGAA
ZH-attP-58A:
TAGATATTAACAGCAAAATGCAATTAACTAGCACCATGACCGTTCGAAAAATTCGCGACAATTTAGCGACGCTGTGGAAATGCAAACCTCTACTGCCAAGAATTCGTGGTCCGCCGCATGACAACGGAAATTAAATTGCATGAAATTGGAAAATTATTACACGCAGGCACACAGAGAGAGTGGAAAATGCATTTGCATAGTGCTGAGGTAGCCATGCAATTTGGCCGGCCATTTAAGCCAAATTAAGGCC
ZH-attP-62B:
TATGGTAATAAACACTCACCATGGGAGTTAATATTTGTATTCTTTACATATTTTCAGAAATAACATTATCTGTATGACTACGCACGGAGCCTCGAAATTGACTAAATGGCTTCAGAGGCTGTGGCCCTTAGTTTGCTCAATTTCAGATTTCTTCTTGAAAAGTCAGTAGCGGTCTTAGGGTTCCAAATATAATGAAAAAGTTAAGGGGATAGAGTTCAAAAGCAATTTTCTATTGTTCGTGCTTAAAAGT
ZH-attP-64A:
TAATGCAGCAATGTTGCCCAAAAGTTGCCATTGCAGTTGGGAAATCTTGTTGGTCGGCAAGCACGCCGTGCACCACCGCCCTATATCCTGCACGGTGAAAAAGGAAGCGAGGGGACAAATTTTAAGTTTCATAACAATTAATGTATTTAAAAATAACAGGTTTGTAGAGTGAAACCGAAAGTAAATGGTTATAAAGGTGTTTAGATAAAGGTGTTTCTCATTCATTGATAAATCCTTCGCTTAGCCGCCT
ZH-attP-68E:
TATATATACCATTCTTTCAGCTGGATATTCTTGTACTAAGTTGATATGTATATTTATTTATCAGAAACTGTTTCCATTAAAACTTGCTCCTAAAAAAATTATTAAGTCGATTGTGATGTGGCATCTATTGCAACACTTCCGGCTAAATTAAACGGATGAGGTTTCCTGGAGTGTAAAGCAAGGCAAACATGACGTATGGAAAATATCGGTTCACGCTCGTAAATCGCCCCAAAAACACGCTCCATGCACA
ZH-attP-75C:
TATATATCCGCACATGCAACCCTCAGCTACCTTCAACTACATTTTGTATCTTTTGTTTTCTCGGATGTTGCGTATTTTGACAATGTGCCTACAGTTTGCTTTGTGTGTCTTTTGTTCTGCGAAGGGTTTTCTCCTGGGTCTATAAAATTCGCAACAAAGTCAATTTCAGAACTATCGGCATACCGATTCCAGTGGATCTTAGAAAATTGTGTTTTTGTAAAAGGATTAGTTATGGTTATCCTGTTTCCTG
ZH-attP-83D:
TAGATGATTGTATGATTAGGAACAAAAACAGGCGCCCAGGAAATTAACCAACATTTGGGCAGCTAATTGGCTGCCTAAATGGCTCAAGCTGCTCGTGTGGAAATCCATTGAGGGTCCTGCTCCGAATCCAATGAACCGCACAGCGTAAAGTGTCGTCTTCCACACTTCATTGAAGGCTGTCAAAAAATTTTCAATTTACCAAATTAGTCCGGCAGATGTGTGGGCTCGAATACGGAAGGATCCCAGGACA
ZH-attP-86Da:
TAATCAACTTCAGGCTGGCAGGACTCATTAAAAATTGAAATCATTTTCGGGTGCACGGCGAAAAGTCAACGCAAATTGCAGCCTATTTGTCAGTCGGCATGCGTTTTAACCTCGCTTTTCCTATCTTTTTGACTCGCAACGTGGGCGTGGCTGTCATTTTAATTAGGGCAAGAAATGAAAAACATGGGTCACAAACAAAAAAACGCAAAAAAACCAACACACCAAAAGGAAAGTTTGCCAACAGCCTGAG
ZH-attP-86Dc:
TATATGGGAGATTATATAAAGGGTTAAACGAATTAATATGGGTACTTGGATCAACACTACATTTAAACCTATTAAATGCACCAAATACCGATTTTTATAATAAGCGAAGTATTTTTTGTTCAAAAGTAGGTGGGAATCCGATTGAAGTGTAGCAAGTGGAAGCCCCCACAAAAAAATGTTGGCCCTTGCATATTGTTTTCCGTTGTTTGGGAGCCCAAAAAAGCTGGATTCGCGAGCAGAAATCGTGATG
ZH-attP-86Fa:
TATACAAGGTTTTGCAATATGTCGCATTGCTATGTATTCTTTTGGATCTGTTAAATCGTTTACTTTATCGTTAATCGTTAATCTCAAAATGCTTTGTATTTGAACAGTAAATTACGTTGTCACTTGCTCGAAGTGTTTGCACTTTATTTCGGTTATTGTTTTATGCCTTTATTCCTATTCGGTTTTCATATGCTCTCTCTTTTGTATTTATATATAAAAATATCCTTTTATACAGTTGTGTTTTCGGTTA
ZH-attP-86Fb:
TAATAGGTCATAGAGATATACTTTCTTGCTATGGTCATAAAGTTACTAAGCCAAATTTATATTTCTTTATAGCCAGTTATTTACACTTTGGCCCTAACTCTTTATCTTTTTGCCATGGATATAAGAAATTTACGGTCACATGCACCCAGAAGCTAAGCACGATATTTACTTAAAGATTTTGTTCAATTTTTAATTTCGTTCGGCTGCTTCTGTCCCCCATCCTGAATAATTTCTAACCGCGCCTCAGGTT
ZH-attP-88A:
TAAATTCCATAGAACAAACTCGGGGGAAACAAACCCTCATAAAGTGACAATGGCAAAAGCAATTCAATTTGAAAATTTCGATTTAATTGTCCTTGTGTTTTCGCTGCATTGTGTACGATATTT
ZH-attP-92Aa:
TAAGCCTTTAATTGCACAGACCGCAAACAATGAATGGAAAAAGGGAGCTTCAACTCACCAGAAACGGACATAAATCACGTTGAATTCGAAGAGCTGAAGAGTTGGTAGAGGGAAATCAAAATTCTATTAATCAGCAACGGCGGCGTTTAGCCCAAAAACAAGCGAATGAAAAAAAATTAACACCCAACTAATGCCGACTGCCGACAAAAGATGACGAACCGAAATCCCGAAACAAGCTGAAATAAACCCT
ZH-attP-94D:
TAAGAACTTCTAATCCTATGACCAAAGAGTACTCATAAGTCATTAAAGAGTACCCCCTTTTCTCTCAGTGCACCATCCAGCATTGATGGGTAACTCCTGCTCTGGAAACGAAAGTCGAATGCATTTGGCCAAAGCCTTTGCACTGTATTGGCTCCTTTATGCACATTCAATTGGTGGTGTGGCTAATCTAGCGAAATTCCAGCCAACTGAGAAGGACCAAACGACTAAATCGAATCGCAGCTTATTTGAG
ZH-attP-96E:
TACATTTTATTTTCATGGCAAACGTGAGCCGTGCAGCACGTTAATCGATTCAAATCGATGCGACTGCCGAAATCCGCTCACAATATGCCGACATTTCGC
ZH-attP-102D:
TAAGTAGGTACGCAAGAAAAATCAAATATCATGAGTGCAAAATTTAATGGTTATATGCATTTGTTGCAGCCCAGACACTACGCTAAATAATATAAATTAAGGTATTTTCACACATTCCAGGAAAATCAGATTCGTCACCTTTACAATGCGCCATGAAATTTTTGGCACACGCAATAGGAATGACAAAAAGGCGATTCAAGAATATGCCCCTTTGAAGAAGCCCAGCACACTGGATGCCGGCACTACAATA