Castelletti et al. 10.1073/pnas.0707730105.
Fig. 4. Linkage analysis at 1q32 in the F233 pedigree. (a) Pedigree of the family and haplotype analysis of 10 microsatellite markers at the 1q32 locus. Studied individuals are identified by numbers within each generation (in roman numbers). Age at present is in parentheses. Affected individuals are indicated with solid symbols. Deceased individuals are crossed. Microsatellite loci are given on the left. (b) Two-point lod scores of linkage analysis between chromosome 1q32 locus and GFND. LOD scores were calculated by use of liability classes, as described in methods. Intermarker distances (in Mb) were taken from NCBI. (c) Multipoint linkage analysis of the pedigree. Ten marker loci were calculated versus a GFND locus by use of Genehunter. Vertical dashed lines indicate positions of microsatellite markers.
Fig. 5. Haplotype analysis of 20 microsatellite markers at the FN1 locus on 2q34 in pedigrees sharing the Y973C mutation. Note the absence of a shared haplotype.

Fig. 6. Haplotype analysis of 13 coding SNPs of FN1 in pedigree F233. The 5773T>A mutation is also reported in red. The mutation carrier allele is in pink. Note lack of segregation between any SNPs but the 5773T>A mutation, and the disease.
Fig. 7. Alignment of the amino acid sequence of III4 and III13 domains in five species from NCBI sequences (Homo Sapiens NP_997647.1, Mus musculus NP_034363.1, Bovine P07589, Chicken P11722, Rattus Norvegicus NP_062016.1). Conserved residues implicated in heparin binding activity are red, amino acid of the hydrophobic core are blue. Mutated residues are green.
Fig. 8. Binding of wild type and mutant poli-His tagged Hep-II recombinants to human umbilical vein endothelial cells (HUVEC), by FACS (a) and confocal microscopy (b, original magnification X600). Control: no recombinant.
Table 2. Pairwise lod scores reflecting linkage between chromosome 2q34 markers and GFND in family 233
|
Mb |
Marker |
lod score (q=0.0) |
|
193.09 |
D2S2167 |
-4.916 |
|
196.89 |
D2S2387 |
-4.699 |
|
203.37 |
D2S2289 |
2.056 |
|
214.80 |
D2S128 |
3.084 |
|
216.19 |
D2S2361 |
3.084 |
|
219.94 |
D2S2244 |
2.709 |
|
220.65 |
D2S2359 |
0.249 |
|
230.08 |
D2S2297 |
2.658 |
Max SLINK=3.385
Table 3. List of primers used for FN1 exon sequencing
|
Exon |
Forward primer 5'-3' |
Reverse primer 5'-3' |
Length |
|
1 |
TTCTTGGAGGCGACAACCC |
CCCTAAAGCCGACCAAAGTTG |
335 |
|
2 |
GGAAAAGGAGAAATGCAAATGTAAC |
AGTGGTAATTGTTAAACTTTGCATTAGTAAG |
251 |
|
3 |
ACTAGAAAAGCTTGTACCTAAGTGAGGC |
AGAGATTGTGTAAAATGATGCCAAAA |
226 |
|
4 |
ACCTAAGTACCTACCATGGGTGGAA |
GCTGAGCAAGAGCTGGGATG |
256 |
|
5 |
ACAGGGAGCTTGCACAATTCA |
TTAAAGATTAAGCCAGGTATTGTTTTCTG |
251 |
|
6 |
ATTGACCACTTGCGACTCTCG |
GAAATGGGGAAGCAGGTCAA |
261 |
|
7 |
CCTGACTGCAGAAAGTAGTGAATTG |
GAAGGACAATACATTTTCAATGTGAAA |
342 |
|
8 |
GGAGATAAAGCATCTCTGTTTACTGACA |
CACAGAAGTGAGAAAAACTCACTTTCA |
277 |
|
9 |
TTGGAAAGCTCAGCGGTAATC |
TGAAGCCCTTGTGGGTTGTC |
257 |
|
10 |
TTAGACCTGGTGATCATTTATCAAGTG |
GAGATGGCAAAAGGTACAGAAAGG |
256 |
|
11 |
TTTGAGAAGCATACCTTTTTTCTTTCAT |
GTTTGCACAGGGGGAATGG |
251 |
|
12 |
AGCACCCTGAAATTAAATTCGTAGTTA |
TACTGCAAGTTGAGAACTGCCAA |
251 |
|
13 |
GTACACAGTTTTAAGTTGAAGTGAGTGAATATT |
TCTGATGGTTTCTTTTTTTCCCA |
263 |
|
14/15 |
TCCTGCTTAAGTCATTTTTCTTTGAA |
CGCTCAAGACAGGTTCAGGG |
693 |
|
16/17 |
TTACCTTCTAGTCGCTTTTCCCTATG |
AATGACATCAGCAGGGAGGG |
501 |
|
18 |
AAACAGTGCATCTTACTTTTGCTCAT |
CCTGAAGGAGGGTTGTTTTGTC |
301 |
|
19 |
TGGCTTCTTAAAAGTAATCTTCAGCA |
CACCCTCACTTGCAGCCTG |
393 |
|
20 |
CTTAGACATTCAATCAAGTTTCAGGACT |
TTTTCTTAACTATATTTACATTCTCTATTCTTCATG |
410 |
|
21 |
CTTGGTTAAACTGAGGTTCTCCATAAA |
AGCCCTGAGCTGTCCTTGTG |
251 |
|
22/23 |
AATCATAGCCTCACAGCAGTAACAGT |
ACCTTCCCAAGACAAAGATTTTAGAA |
851 |
|
24 |
AGTCCTGCATTCCGCCC |
ACACTTCCAATAAGAGTGGGGATT |
351 |
|
25 (EDII) |
TTCCTTTTGCCTCCCCCTC |
ATGGATGTTTCATGGGGGAA |
406 |
|
26 |
TGATTTTACCTTTCCAGCTACTTCG |
AATTCTCAAGTAGGAGGAGCTAAGAGC |
351 |
|
27 |
TCAAATAGTCCTGGGCGTGC |
TGTTGGCAGTATGACTATCCAGTAGC |
201 |
|
28 |
CGTTAATTTCCCCTACACCTTCC |
TTGCTGTTGTCTGTCATCAGCTC |
451 |
|
29 |
ATTGTTTGAAAATTACGGATGTGAAA |
AGCCCCAACAGTGAACAAAGAATTAA |
251 |
|
30 |
GCTCTAAACCCCTCACACTCTGAA |
GGGTGACACCAGCTTTTACTTATTC |
251 |
|
31 |
AATATGTACCAGACCTAGAGAGGAGGACT |
AGATCACTTGAGGTTAGGAGTTCGA |
347 |
|
32 |
ACTCTAGACGCCACTTGAGGACTT |
TCTTGGGTGTCTGAATGCCC |
251 |
|
33 (EDI) |
TGCAAAACTGCTTTGCATGTT |
ATGGGAGCAGCGGCTTTA |
402 |
|
34 |
TTTTCCTTTTCCCCCATTTCC |
TCATCTCTAACACAGTTTCTAAGGTGG |
311 |
|
35 |
CTTGGGTTTCAGTTGAGGACG |
CCAAGCACTTTGGGAAGCTG |
258 |
|
36 |
CATGGATGAGCCAAGCAGG |
GTAAACGGGCTTATTAACTGTTCTACG |
301 |
|
37/38 |
AATTGCAGGCTAGCTTGAGAATTC |
ATGAAGTCCTTAGCAAACTCCCAC |
651 |
|
39 |
ACCGACTTCCACTTGACTAGCTG |
AAGGTTCTCCATGTTTTGATGCA |
251 |
|
40 (IIICS) |
TCCTGGAGCTTAATGCGCTTT |
CTCATGGGGCAGCACAGAA |
560 |
|
41 |
AGCCCGTGTCATTCCTCACT |
TGCTGTACACCAGAGATGGGC |
259 |
|
42 |
TACAGTCATTCGATTTTCTTCTTATGGT |
TTGTCTCCTCAAGTTCCATGCA |
301 |
|
43 |
GTGACACGTCCCAGTTCACCT |
CATTCTCACTTTCATTATCAGGCTG |
271 |
|
44 |
ACAAATTTAGGACAGAAATAGAACCCA |
GGGCAGACCCTTCGGA |
301 |
|
45/46 |
CTCAAACACTAAATTACGATGTCCTCA |
TGTTAGCAGACCCAGCTTAGAGTTC |
685 |
Table 4. Summary of 9 known coding SNPs and 2 novel intronic SNPs detected in GFND probands with FN1 mutations
|
SNP |
F233 717 |
F468-II2 |
F546-I1 |
F656-II1 |
F663-II3 |
F1098-II2 |
Position (strand)b |
Sequence |
Amino acid change |
Minor allele frequency |
|
rs17449032 |
A/A |
A/A |
A/A |
A/A |
A/Gd |
A/A |
215944957 (-) |
CAACCA/GTCTCA |
V/Ic |
0.01 |
|
rs1250259 |
T/T |
eA/T |
eA/T |
T/T |
T/T |
T/T |
216008727 (-) |
CGTCCA/TGTGCC |
L/Qc |
0.08 |
|
rs1053238 |
C/A |
C/C |
C/A |
A/A |
A/A |
A/A |
215977454 (-) |
TACCCA/CCTGAG |
P/P |
0.10 |
|
rs7584505 |
A/T |
A/A |
A/A |
A/A |
A/A |
T/T |
215951162 (-) |
CAGGGT/AGTTGT |
G/G |
0.39 |
|
rs13652 |
A/G |
A/A |
A/A |
A/A |
G/G |
A/A |
215957832 (-) |
GGAGAA/GACAGG |
E/E |
0.10 |
|
rs7596677 |
T/T |
T/T |
T/T |
T/T |
T/T |
A/A |
215981152 (-) |
GCCCCT/ACCTGA |
P/P |
0.48 |
|
rs2289202 |
C/T |
C/C |
C/C |
C/C |
C/C |
C/C |
216006329 (-) |
TGCATT/CGGGGC |
I/I |
0.18 |
|
rs7589580 |
A/C |
C/C |
A/C |
A/A |
A/A |
C/C |
215977499 (-) |
AGAGGA/CCAGCC |
G/G |
0.48 |
|
rs11651 |
T/T |
T/C |
T/C |
T/T |
C/C |
T/C |
215937937 (-) |
TGTTAT/CGATGA |
Y/Y |
0.24 |
|
IVS_23-37f |
C/C |
eC/T |
eC/T |
C/C |
C/C |
C/C |
215967724 (-) |
CAGATC/TCTCTG |
intron |
0.12 |
|
IVS_35+78 f |
G/G |
G/G |
G/G |
G/G |
G/G |
gG/T |
216068325 (-) |
GTTCAG/TTGGCT |
intron |
<0.01 |
aminor allele highlighted in red, major allele in black; bhttp://genome.ucsc.edu, freeze May 2006; cnon-synonymous coding SNP; dnot segregating with disease; esegregating with disease; funknown SNPs; gsegregation unknown, mutation de novo.
SI Text
Clinical data from pedigree 233
The index case (subject 717) is a boy, now 14 years old, in whom proteinuria was first discovered in July 2004. Renal function and blood pressure were normal. He underwent a renal biopsy, which showed a picture of glomerulopathy compatible with GFND. No therapy was started. In March 2005, the boy was referred to our Department of Nephrology, because proteinuria persisted in a nephrotic range. Blood pressure was persistently over the 95th percentile, serum creatinine 0.56-0.7 mg/dl, serum albumin 2.3-3.1 g/dl, and urinary protein excretion rate 7.46 g/24h. A multidrug treatment titrated against urinary protein excretion was attempted to achieve renoprotection. Chronic treatment with an angiotensin-converting enzyme (ACE) inhibitor (ramipril 1.25 mg/day) was started. A low-sodium diet was recommended and the ramipril dose was progressively increased to 5 mg/day. Sodium bicarbonate supplementation and a diuretic therapy (hydrochlorothiazide 12.5 mg/day) were also added to control metabolic acidosis and hyperkalemia. In September 2005, the urinary protein excretion rate was decreased to 3.2 g/24h, serum creatinine was stable but blood pressure persisted over the 95th percentile. An angiotensin II receptor antagonist (losartan 12.5 mg/day) was added to his antihypertensive/antiproteinuric regimen and was up-titrated to 25 mg over the following 3 months. At the last observation, after 2 years of multidrug antiproteinuric treatment, urinary protein excretion rate was decreased to 2.3 g/24h, serum albumin and serum creatinine were stable (respectively 3.4 g/dl and 0.7 mg/dl), and blood pressure was normal.
These results suggest that the above multidrug approach could be of value in reducing intrarenal adaptive changes leading to proteinuria and renal disease progression once FN deposition in the glomeruli has occurred.
Methods
DNA analysis
DNA was prepared from peripheral blood according to standard procedures (Nucleon BACC2 kit, Amersham Pharmacia). Microsatellites flanking the candidate genes, the allele frequencies, the marker heterozygosity and the sequence-specific primers for the amplification of each microsatellites were retrieved from the Human Genome Data Base (www.gdb.org). Markers analyzed were: D1S240, D1S412, D1S2816, D1S413, D1S456, D1S249, D1S2636, D1S2735, D1S2796 and D1S2692 for the RCA cluster from CFH to MCP; D19S886, D19S878, D19S216, D19S912 for CFD and C3; D11S914, D11S935 and D11S4102 for CD59; D2S2167, D2S2387, D2S2289, D2S128, D2S2361, D2S2244, D2S2359 and D2S2297 for FN1. Primers were synthesized by Sigma Genesis LTD (Sigma-Aldrich).
PCRs were done in 20-ml total volume containing 100 ng of DNA, 17 pmol of each primer, 16 nmol dNTPs, 1.5 mM MgCl2, 1 U Taq polymerase (Taq Gold, Applied Biosystems) and PCR buffer. After a 10 min denaturation at 94°C, 35 cycles were performed (94°C for 45 s, 55°C for 30 s, 72°C for 45 s) followed by a final 10 min extension at 72°C. Samples were mixed with 20 ml of loading buffer, denatured at 75°C for 5 min and electrophoresed on a denaturing 40% acrylamide gel in Tris Borate EDTA buffer at 55W for 2-4 h. Gels were visualized by silver staining.
Haplotypes were reconstructed using the GENEHUNTER package (Version 1.2). Autosomal dominant transmission with age-related penetrance was assumed on the basis of clinical and pedigree data (1). Liability classes were assigned as follows: affected subjects with GFND and unaffected subjects of the first and second generations were assigned liability class 1, with penetrance vector {0.0, 0.99, 0.99}. Unaffected individuals in the third generation (all <35 years of age) were assigned liability class 2, with penetrance vector {0.0, 0.50, 0.75}. The disease gene frequency in the general population was set at 0.0001 (1). Two-point and multipoint linkage analyses were performed by GENEHUNTER using both the affecteds-only and liability classes models. SLink simulations were done by the FASTLINK package.
We sequenced the exons and the flanking intronic regions of FN1 (NC_000002, gi:51511462). The gene has three regions subjected to alternative splicing (EDI, EDII and IIICS), with the potential to produce 20 different transcript variants. We chose variant 1 that represents the longest transcript and encodes the longest isoform (NM_212482).
Fibronectin exons were amplified using primers located in the flanking introns. Primers (SI Table 2) were synthesized by Sigma Genosys LTD (Sigma-Aldrich). PCR conditions were the same as for linkage analysis. The amplified products were purified and directly sequenced using the 3130 xl Sequencer (Applied Biosystems).
Baculovirus constructs
Two micrograms total RNA from human liver (Stratagene) were reverse-transcribed with the SuperScript First-Strand synthesis system (Invitrogen) using random primers according to the manufacturer's instructions. The obtained cDNA was subjected to PCR amplifying a human fibronectin fragment encoding region encompassing repeats III12-14 (forward primer: 5' -ggggacaagtttgtacaaaaaagcaggcttcaccatggctattcctgcaccaactgacctg- 3', reverse primer: 5' -ggggaccactttgtacaagaaagctgggtctgtctttttccttccaatcagggg- 3'). The PCR was carried out by using Pfx polymerase (Invitrogen) with the following cycle profile: 2 min at 94°C followed by 30 cycles of 94°C for 15 s, 55°C for 30 s and 68°C for 55 s. The resulting PCR product was recombined with plasmid pDONR201 and BP clonase to generate an entry clone according to the manufacturer's instructions (Gateway cloning technology, Invitrogen). To create the 1925R and the 1974R mutants, single nucleotide point mutations were introduced by the QuikChange site-directed mutagenesis technique (Stratagene). Wild type rFN III12-14 in pDONR201 entry vector was used as the template. The accuracy of plasmids was confirmed by DNA sequencing.
Recombinant baculoviruses were obtained by recombination of entry clones with the BaculoDirect C-Term Linear DNA and LR clonase (Invitrogen). Baculovirus stocks were made and amplified in Spodoptera frugiperda Sf9 cells.
Production and analysis of recombinant proteins
The WT and mutant III12-14 fragments were expressed as His-tagged fusion proteins in Sf9 cells. The cells were maintained at 27°C in Sf-900 II medium (Invitrogen) supplemented with 10% FCS and transfected using Cellfectin reagent (Invitrogen) following the manufacturer's instructions. Virus stocks were added at a multiplicity of infection of 5, and cultures were incubated for 96 h.
Media were incubated overnight with Chelating Sepharose Fast Flow (Amersham Pharmacia Biosciences) charged with copper. Proteins were eluted with 20 mM Na2HPO4, 500 mM NaCl, 500 mM imidazole, pH 7.4. Fractions were pooled, subsequently concentrated and dialyzed against 20 mM Na2HPO4/150 mM NaCl pH 7.4 by using Centripep YM-10 (Amicon). The protein concentration was determined by the Bradford assay with the Bio-Rad protein assay reagent.
Recombinant proteins (5 mg each) were separated by 12% SDS/PAGE and visualized by Coomassie (as control for loading) or transferred to a poly(vinylidene difluoride) membrane (Bio-Rad). After blocking with 3% nonfat dry milk, the membranes were incubated either with an anti-His (C-term) mouse monoclonal antibody (dilution 1:2,500; Invitrogen) or with a mouse monoclonal antibody against Hep-II domain of fibronectin (Abcam) diluted to 1:1,000 and then with peroxidase-labeled goat anti-mouse IgG (dilution 1:2,000; Zymed). Membranes were developed using an enhanced chemiluminescence detection system (Pierce/Celbio) (Fig. 2).
Binding to heparin by ELISA
Polymeric heparin sodium salt (100 mg per well, Fluka) diluted in bicarbonate coating buffer (Sigma) was immobilized onto microtiter well (Nunc Maxisorb, Nalge Nunc). After coating overnight at 4°C, wells were washed four times with PBS-T and unspecific binding sites were blocked by 3% BSA/PBS-T for 15 min at RT. Wild type and mutant recombinant proteins (0.2 mg/ml) were added to individual wells. For detection of bound FN fragments, anti-His (C-term) mouse monoclonal antibody followed by a horseradish peroxidase (HRP)-conjugated rabbit anti-mouse antiserum, OPD (Dako) and H2O2 were added. The color reaction was stopped by addition of 3 M sulfuric acid after 2.5 min. The optical density was measured photometrically (MR 600, Dynatech) (2). Results were expressed as optical density after subtracting values recorded with addition of buffer alone (blank).
Endothelial cells and podocytes
HMEC (SV-40 transfected human dermal microvascular endothelial cells line) were grown in MCDB 131 medium (GIBCO-Invitrogen) containing 10% FCS, hydrocortisone (1 mg/ml), bovine brain extract and antibiotics, at 37°C in 5% CO2-95% air (3). These cells constitutively express PAI-1, tPA, VWF and thrombomodulin (4).
Immortalized mouse podocytes (from Peter Mundel, Mount Sinai School of Medicine, New York) were cultured under growth-permissive conditions on rat tail collagen type I-coated plastic dishes (BD Biosciences), at 33°C in RPMI 1640 medium supplemented with 10% FCS, 10 units/ml mouse recombinant g- IFN (Sigma), and antibiotics. To induce differentiation, podocytes were maintained in nonpermissive conditions at 37°C without g-IFN for 14 days and used for the experiments. In this culture conditions, cells stopped proliferating and were identified as differentiated podocytes by their arboring morphology and the presence of high levels of synaptopodin (5).
Human umbilical vein endothelial cells (HUVEC; American Type Culture Collection) were grown at 37°C and 5% CO2 in DMEM medium (Invitrogen), supplemented with 10% FCS, antibiotics and L-glutamine.
FACS analyses
After incubation in serum-free medium for 24 h, HMEC, HUVEC and mouse podocytes were removed from the growth surface, washed twice with PBS, and 5 ´ 105 cells were transferred into plastic tubes. Nonspecific binding sites were saturated in blocking solution (1% BSA/0.5x PBS) for 30 min at RT before incubation with purified wild type III12-14, and mutant III12-14W1925R and III12-14L1974R recombinant proteins, diluted in 0.5x PBS to a final concentration of 10 mg/ml, for 1 h at 4°C with gentle rocking (6). Control experiments were performed in the absence of recombinant proteins. Cells were thoroughly washed in 0.5x PBS, then an anti-His (C-term) mouse monoclonal antibody (dilution 1:200; Invitrogen) was added and the cells were incubated on ice for 30 min followed by 30 min on ice with the secondary antibody (FITC-conjugated goat anti-mouse IgG, dilution 1:100; Jackson ImmunoResearch for HMEC and podocytes and Alexa fluor 488-conjugated goat anti-mouse antiserum, Molecular Probes for HUVEC). Cells were examined by fluorescence-activated cell sorter (FACSAria, Becton Dickinson).
Fluorescence confocal microscopy
Cells grown on glass coverslips (coated with collagen type I for podocytes) were kept in serum-free medium for 24 h. At the end of incubation, the cells were washed with PBS and nonspecific binding sites were saturated in blocking solution (2% FBS, 2% BSA, 0.2% bovine gelatin in PBS) for 30 min at RT. Binding studies were performed incubating cells for 1 h at RT with purified wild type III12-14, and mutant III12-14W1925R and III12-14L1974R recombinant proteins (10 mg/ml). Negative controls were performed in the absence of recombinant proteins. Cells were washed with PBS, and incubated with an anti-His (C-term) mouse monoclonal antibody (dilution 1:100; Invitrogen) for 1 h at RT followed by Cy3-conjugated donkey anti-mouse IgG (dilution 1:100; Jackson ImmunoResearch) for HMEC and podocytes and by Alexa fluor 488-conjugated goat anti-mouse antiserum for HUVEC. After 1 h, cells were washed with PBS, and mounted in fluorescent mounting medium (DAKO). Fluorescence staining was visualized using inverted confocal laser microscopy (LSM 510 meta; Zeiss) (6).
Spreading assay
HMEC cells serum-starved for 24 h were harvested, washed, and resuspended in MCDB 131 medium (Invitrogen) containing 2 mM L-glutamine and antibiotics. Spreading assays were carried out on glass coverslips previously coated overnight at RT with 6 mg/ml (0.05 mM) of human 120-kDa fibronectin alpha-chymotryptic fragment lacking the Hep-II domain (Chemicon International) diluted in PBS. Cells (5 ´ 104) were then plated and incubated for 3 h at 37°C with or without purified wild type III12-14, and mutant III12-14W1925R and III12-14L1974R recombinant proteins at a final concentration of 15 mg/ml. As positive control, cells were seeded on glass coverslips coated with intact fibronectin (10 mg/ml; Roche). HMEC cells were washed with PBS, fixed with 3% paraformaldehyde plus 2% sucrose/PBS at 37°C for 15 min, permeabilized for 3 min with 0.1% Triton X-100/PBS and blocked with 1% BSA/PBS for 1 h at RT (7). The F-actin filaments were stained with rhodamine-phalloidin (5 units/ml) in 0.1% BSA/PBS for 1 h (Molecular Probes) (5). Coverslips were washed and mounted in fluorescent mounting medium (DAKO) and examined using inverted confocal laser microscopy (LSM 510 meta; Zeiss).
1. Vollmer M, Jung M, Ruschendorf F, Ruf R, Wienker T, Reis A, Krapf R, Hildebrandt F (1998) Am J Hum Genet 63:1724-1731.
2. Opperman M, Manuelian T, Jozsi M, Brandt E, Jokiranta TS, Heinen S, Meri S, Skerka C, Gotze O, Zipfel PF (2006) Clin Exp Immunol 144:342-352.
3. Ruiz-Torres MP, Casiraghi F, Galbusera M, Macconi D, Gastoldi S, Todeschini M, Porrati F, Belotti D, Pogliani EM, Noris M, et al. (2005) Thomb Haemost 93:443-452
4. Ribeiro MJA, Philips DJ, Benson JM (1995) Thromb Res 79:153-161
5. Morigi M, Buelli S, Angioletti S, Zanchi C, Longaretti L, Zoja C, Galbusera M, Gastoldi S, Mundel P, Remuzzi G, et al. (2005) Am J Pathol 166:1309-1320
6. Manuelian T, Hellwage J, Meri S, Caprioli J, Noris M, Heinen S, Jozsi M, Neumann HPH, Remuzzi G, Zipfel PF (2003) J Clin Invest 111: 1181-1190
7. Peterson JA, Sheibani N, David G, Garcia-Pardo A, Peters DM (2005) J Biol Chem 280:6915-6922.