Stafflinger et al. 10.1073/pnas.0710897105.
Fig. 6. cDNA and deduced amino acid sequence of the inotocin preprohormone from Tribolium. Nucleotides are numbered from 5' to 3' end. Amino acid residues are numbered starting with the first ATG codon in the ORF. The translation termination codon is indicated by an asterisk. Exon-intron-boundaries are highlighted in gray, the signal sequence in red, the inotocin sequence in blue, and the dibasic cleavage site following the inotocin sequence in brown. The start codon is preceded by several in-frame stop codons (underlined). The putative polyadenylation signal in the 3' untranslated region is underlined twice.
Fig. 7. cDNA and deduced amino acid sequence of the inotocin receptor from Tribolium. The seven transmembrane regions are boxed and labeled TMI-VII. Putative glycosylation sites in the extracellular N terminus are indicated by triangles. Other sequences are indicated as in SI Fig. 6.
Fig. 8. Phylogenetic tree analysis of the cloned T. castaneum inotocin receptor (GenBank accession no. EU128495), the annotated N. vitripennis inotocin receptor (GenBank accession no. XP_001600203), the annotated D. pulex oxytocin/vasopressin-like peptide receptor, the cloned mouse oxytocin receptor ( = MmOTR from Fig. 2; GenBank accession No. NP_001074616), the cloned mouse vasopressin V1a receptor ( = MmVPR from Fig. 2; NP_058543), the cloned Drosophila AKH (adipokinetic hormone) receptor CG11325 (AAC61523), the cloned Drosophila corazonin receptor CG16698 (AAM21341), the cloned Drosophila CCAP (crustacean cardioactive peptide) receptor CG6111 (AAO66429), and four annotated T. castaneum receptors that are orthologues of CG6111 (Tc 43 and Tc 44) and CG11325 (Tc 46 and Tc 47) (1). The tree is rooted by the Drosophila metabotropic glutamate receptor CG11144 (AAF59402). The analysis shows that the Tribolium inotocin receptor is more related to the two mammalian oxytocin/vasopressin receptors than its most closely related Tribolium AKH-like (Tc 46 and Tc 47) and CCAP-like (Tc 43 and Tc 44) receptors. The analysis also shows that Tribolium does not have a corazonin receptor.
1. Hauser F, et al. (2008). A genome-wide inventory of neurohormone GPCRs in the red flour beetle Tribolium castaneum. Front Neuroendocrinol 29:142-165.
Table 2. Nucleotide differences between the oxytocin/vasopressin receptor cDNA of SI Fig. 7 and the corresponding genomic sequence from the Tribolium castaneum Genome Project
|
Position of the nucleotide in the cDNA |
Type of nucleotide in the gene |
Type of nucleotide in the cDNA |
Change in amino acid |
|
51 |
T |
C |
- |
|
65 |
A |
G |
HisàArg |
SI Materials and Methods
T. castaneum (strain GA-1) was a kind gift from Prof. Martin Klingler (University of Erlangen-Nürnberg, Germany) and kept on full-grain-flour at 29°C. For PCR, total RNA was isolated using Trizol reagent (Invitrogen) or the NucleoSpin RNAII kit (Macherey-Nagel). cDNA was synthesized and amplified using the SMART RACE cDNA amplification kit (CLONTECH) or, for 5'RACE, the FirstChoice RLM-RACE kit (Ambion).
The coding sequence of the inotocin preprohormone was amplified using the sense primer 5'-CAACACAACCAACCACTGCACC-3' (corresponding to nucleotide positions -14 to -35 of SI Fig. 6) and the antisense primer 5'-CAATTGCTCAAAAGTTCTTCACACAC-3' (corresponding to nucleotide positions 501 to 526 of SI Fig. 6). 3'RACE was made with the sense primer 5'-GTGCGCTTTCGACGGGATTTG-3' (corresponding to the nucleotide positions 309 to 329 of SI Fig. 6) followed by the nested sense primer 5'-GACGGGATTTGTTGCAGTCAAG-3' (corresponding to nucleotide positions 319 to 340 of SI Fig. 6). 5'RACE of the inotocin preprohormone was made with the antisense primer 5'-GGCAAACTTGCTCCGTTTGCC-3' (corresponding to nucleotide positions 88 to 108 of SI Fig. 6), followed by the nested antisense primer 5'-CGAGGACAGTTGGTAATGAGAC-3' (corresponding to nucleotide positions 62 to 83 of SI Fig. 6).
The coding sequence of the inotocin receptor was amplified using the sense primer 5'-CCGCTAGCCCGCCGATGTACACCCCGAAAC-3' (the underlined nucleotides correspond to nucleotide positions 1 to 16 of SI Fig. 7) and the antisense primer 5'-CCGCTAGCTCAGGTGGTCGTCGTGACGATC-3' (the underlined nucleotides correspond to nucleotide positions 1191 to 1212 of SI Fig. 7). 3'RACE of the inotocin receptor was made with the sense primer 5'-CGGGAGTTGCCGCGCCTCCTGC-3' (corresponding to the nucleotide positions 970 to 991 of SI Fig. 7) followed by the nested sense primer 5'-CCGTCACTACACGGCTTCCAGCAAG-3' (corresponding to nucleotide positions 993 to 1016 of SI Fig. 7) using the SMART RACE cDNA amplification kit (CLONTECH). 5'RACE of the inotocin receptor was made with the antisense primer 5'-GCCAGTAATACTGTGCTGTTCCCGATG-3' (corresponding to nucleotide positions 150 to 176 of SI Fig. 7), followed by the nested antisense primer 5'-GGGTGGCAACCTCCACGCGGGC-3' (corresponding to nucleotide positions 103 to 124 of SI Fig. 7) using the FirstChoice RLM-RACE kit (Ambion).
For qPCR, samples with defined age were collected. Therefore, adults were transferred to presieved white flour and allowed to lay eggs for a period of 24 h. After removal of the adults, the eggs were incubated at 29° and samples were collected by sieving as described by Bucher (http://wwwuser.gwdg.de/~gbucher1/beetle-book1.pdf). Adult body parts were dissected in PBS and immediately transferred into buffer RA1 of the Nucleospin RNAII extraction kit (Macherey-Nagel). Total RNA was isolated using the Nucleospin RNAII extraction kit (Macherey-Nagel). mRNA was isolated using the mMACS mRNA isolation kit (Miltenyi Biotec). cDNA was synthesized with the SuperscriptIII First-Strand Synthesis System (Stratagene). qPCR was performed with the Mx3000P qPCR System (Stratagene) using the SYBR Green Mix (Stratagene). The obtained data were analyzed with the MxPro qPCR Software (Stratagene). Two different reference genes, the ribosomal proteins rpL32 (GenBank accession number XM_964471) and rps3 (GenBank accession number XM_965494), were used with similar results. qPCR reactions were run as technical triplets and each experiment was repeated at least twice.
qPCR for the inotocin preprohormone was made with the sense primer 5'-CGTCAAACCGTGTGTGAGTT-3' (corresponding to nucleotide positions 123 to 142 of SI Fig. 6) and the antisense primer 5'-TTTATCCGCATGGCAAGAGT-3' (corresponding to nucleotide positions 141 to 160 of SI Fig. 6). qPCR for the inotocin receptor was made with the sense primer 5'-ACAGCTGACGATCTTCACATACA-3' (corresponding to nucleotide positions 519 to 541 of SI Fig. 7) and the antisense primer 5'-TTTCCCAGGTGCTGATTTCT (corresponding to nucleotide positions 731 to 750 of SI Fig. 7). qPCR for rpL32 was made with the sense primer 5'-GGCACCAGTCTGACCGTTAT-3' (corresponding to nucleotide positions 134 to 153 of XM_964471) and the antisense primer 5'- ATCAACAACACTTCCAGTTCCTT-3' (corresponding to nucleotide positions 316 to338 of XM_964471). qPCR for rps3 was made with the sense primer 5'- TGTGGCGCTAAAGGGTGT -3' (corresponding to nucleotide positions 396 to 413 of XM_965494) and the antisense primer 5'- TTGTCAGGCAGAGGCTTTTT -3' (corresponding to nucleotide positions 612 to 631 of XM_965494).
DNA sequence comparisons were done using Vector NTI (Invitrogen). Protein sequence alignments were carried out using ClustalW (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page = npsa_clustalw.html). Phylogenetic tree analyses were performed using Lasergene (DNASTAR). Prediction of transmembrane helices of the receptor proteins was done using the TMHMM server (http://www.cbs.dtu.dk/services/TMHMM/). EC50 values were calculated using Prism software.