The human sex-reversing ATRX gene has a homologue on the marsupial Y chromosome, ATRY: Implications for the evolution of mammalian sex determination
- *Department of Genetics and Evolution, La Trobe University, Melbourne 3083, Australia; and ‡Department of Zoology, The University of Melbourne, Melbourne 3010, Australia
-
Communicated by Neal L. First, University of Wisconsin, Madison, WI (received for review July 13, 1999)
Abstract
Mutations in the ATRX gene on the human X chromosome cause X-linked α-thalassemia and mental retardation. XY patients with deletions or mutations in this gene display varying degrees of sex reversal, implicating ATRX in the development of the human testis. To explore further the role of ATRX in mammalian sex differentiation, the homologous gene was cloned and characterized in a marsupial. Surprisingly, active homologues of ATRX were detected on the marsupial Y as well as the X chromosome. The Y-borne copy (ATRY) displays testis-specific expression. This, as well as the sex reversal of ATRX patients, suggests that ATRY is involved in testis development in marsupials and may represent an ancestral testis-determining mechanism that predated the evolution of SRY as the primary mammalian male sex-determining gene. There is no evidence for a Y-borne ATRX homologue in mouse or human, implying that this gene has been lost in eutherians and its role supplanted by the evolution of SRY from SOX3 as the dominant determiner of male differentiation.
The primary mammalian sex-determining event is the development of the testis, which results in the expression of hormones that lead to the masculinization of the developing embryo (1). In eutherian mammals, the SRY gene on the Y chromosome (2) has been demonstrated by mutation analysis and transgenesis to be the key switch gene in the sex-determining cascade (3), at least in humans and mice. There is an SRY gene on the Y chromosome of marsupial mammals (4), although there is no direct evidence that it is sex determining. So far, no SRY homologue has been detected in the more distantly related monotreme mammals (A.P. and P. Kirby, unpublished data), implying that another sex-determining gene must operate in this mammal group.
The existence of other genes in the male-determining pathway is also attested by eutherian species that have lost SRY, suggesting that another gene or genes can control male sex differentiation (5, 6). In addition, most sex-reversed XY human females have a normal SRY gene and therefore must harbor mutations elsewhere in the sex-determining pathway (7). Normal male development in the absence of SRY in human XX males, in addition to two rodent species that lack Sry, suggests that the SRY gene acts only as a male switch and contributes little or nothing to male development itself. Several sex-reversing genes have been isolated from the human X (8, 9) and autosomes (10–13) and are proposed to lie in the sex-determining pathway (14, 15). Comparisons of such genes between distantly related mammals and other vertebrates have proved valuable to our understanding of the function, as well as the evolution, of genes in a conserved vertebrate sex-determining pathway (16).
Many genes on the human and mouse Y chromosome have homologues on the X. Even SRY shares homology with the X-borne SOX3 gene (17). The presence of these X–Y shared genes, as well as the several genes on the two pseudoautosomal regions (PAR1 and PAR2) shared by the X and Y, supports the hypothesis that mammalian sex chromosomes evolved from a homologous autosome pair (18). The Y chromosome originally contained copies of all of the genes on the X (including ATRX) but became degraded as mutations and deletions accumulated in a region in which recombination was suppressed between a sex-determining allele and other male-specific genes (19). Different sets of active genes survive on the Y chromosome in different species; for instance, a homologue of RPS4X is present on the Y in all eutherians except rodents, and an active copy of STS is present on the Y in rodents but not in primates. The UBE1X gene provides examples of every stage of the decline and fall of a Y-borne gene, from a pseudoautosomal gene in monotremes to degraded and deleted fragments in primates (20). Ancient homology explains the origin of the PAR and at least 10 genes and pseudogenes on the human Y chromosome, including at least two (the sex-determining gene SRY and the candidate spermatogenesis gene RBMY) with male-specific functions (21), although some other male-specific genes may have been recruited from autosomes (22).
Five genes on the human and/or mouse X and Y chromosomes (SRY/SOX3, RBMX/Y, SMCX/Y, RPS4X/Y, and UBE1X/Y) are also present on the X and Y chromosomes in marsupials. Thus, the Y is monophyletic in all therian mammals. However, several human X–Y shared genes (such as ZFY/X, AMELY/X, STS/STSP, and the pseudoautosomal genes) are autosomal in marsupials (23) and colocalize with other genes from the short arm of the human X distal to Xp11.23 (24). These genes are also autosomal in monotremes. As marsupials and monotremes diverged independently of eutherian mammals 130 million and 180 million years ago, respectively, this implies that these regions were added recently to the eutherian X and Y chromosomes, presumably by translocation to an ancient PAR (25).
We now show that the sex-reversing gene, ATRX, on the human and mouse X chromosome, has an active homologue on the Y chromosome in marsupials, which is expressed specifically in testis. ATRX (α-thalassemia and mental retardation associated with the X chromosome; ref. 9), is a member of a helicase superfamily subgroup that contains genes involved in DNA recombination, repair, and regulation of transcription (26). A highly homologous ATRX gene has been identified on the mouse X chromosome (27).
Mutations in human ATRX cause severe psychomotor retardation, characteristic facial features, α-thalassemia, genital abnormalities, and several other congenital irregularities (9). The level of gonadal dysgenesis in affected individuals is variable, in some cases leading to complete male to female sex reversal and female gender assignment (28). Histological analysis of sex-reversed patients reveals streak gonads, but the absence of Mullerian ducts indicates that AMH (anti-Mullerian hormone) is expressed, confirming the development of Sertoli cells in the gonad (29). The development of the gonad has therefore been interrupted at a stage before testis organization but after the testis-determining signal from SRY and the differentiation of Sertoli and Leydig cells. ATRX in eutherian mammals therefore functions downstream of SRY SOX9 and AMH in the male development pathway. However, in birds and reptiles, SOX9 appears to act later in testis differentiation, and the position of ATRX in the pathway is unknown (30–32).
The location of the human ATRX gene at Xq 13.3 (33) places it within the conserved region of the X chromosome present on the X in all mammalian species. This suggests that it may have had a role (perhaps dosage-regulated) in gonad development in an ancestral mammal. To confirm that ATRX was on the X chromosome in an ancestral mammal, the gene was cloned and mapped in the model marsupial, the tammar wallaby. Surprisingly, active homologues of ATRX were found to be present, not only on the X but also on the Y chromosome in marsupials.
Materials and Methods
Materials.
Tissue and blood samples were collected from the marsupial species Macropus eugenii (the tammar wallaby) under Animal Experimentation Ethics Committee permit number LSB96/4.
Southern Hybridization.
The 600-bp partial human ATRX cDNA clone containing the functional zinc finger domain was kindly supplied by Douglas Higgs (MRC Molecular Hematology Unit, Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, UK). Genomic DNA extractions and Southern blotting were carried out according to standard procedures (34). Probes were randomly primed with [32P]dCTP and hybridized to membranes at 55°C in 6× SSPE/0.5% SDS/5× Denhardts/10 mg/ml salmon sperm DNA. Membranes were washed under low stringency conditions of 2× SSC at 55°C.
Isolation of Genomic and cDNA Clones.
A λ EMBL 3 genomic library was constructed from DNA extracted from male M. eugenii liver. The genomic DNA was partially digested with Sau 3A and size selected through a 10–40% glycerol gradient. Fractions were taken, and partially digested DNA in the 15- to 20-kb size range was ligated to λ EMBL 3 arms. The ligation reaction was packaged with Giga-pack gold (Stratagene). The library was titred and plated on four plates at a density of 120,000 plaque-forming units per 22 × 22-cm Nunc plate.
Sequence was obtained by using the Fmol DNA sequencing kit (Promega) and the Bluescript plasmid primers T3 and T7 (35).
Reverse Transcription–PCR (RT-PCR).
RNA was isolated from 0.1 g of tissue by using the TRI-Pure RNA isolation kit (Boehringer Mannheim) according to the manufacturer's instructions. Extracted RNA was then treated with 4 units of DNase1 (Boehringer Mannheim) at 37°C for 1 h to remove any contaminating DNA. Before RT-PCR, an aliquot was removed and RNA was reverse-transcribed by using reverse transcriptase (Boehringer Mannheim) at 42°C for 90 min. RT-PCR conditions were as follows: 94°C for 2 min followed by 35 cycles of 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min. Samples were analyzed on 1.5% agarose gel (GIBCO/BRL). Primers are shown 5′-3′ as follows. ATRY primers, ATRY(f)ATTTGTTGTGACTCTTGCCAT and ATRY(r)GCCTTTACCTTCTGTTGCTTT; ATRX primers, ATRX(f)CAATAATGGATGAAAACAGCC and ATRX(r)TGCCTGCTTCAAAAATCTTAC. All primers were synthesized by Bresatec (Adelaide, Australia).
Northern Hybridization.
RNA from adult female brain and adult testis was extracted and DNase1-treated as described above. Aliquots of 40 μg of RNA were freeze-dried and stored at −80°C. Samples were hydrated in 4.5 μl of di-ethyl-pyrocarbonate-treated water and 16 μl of NorthernMAX loading buffer (Ambion, Sydney). RNA samples were electrophoresed through a 1% agarose/6% formaldehyde gel in 1× 4-morpholinepropanesulfonic acid at 90 V for 5 h. The sizes of hybridizing fragments were determined by running 10 μg of RNA ladder according to manufacturer's instructions (New England Biolabs, Sydney) and poststaining gel with ethidium bromide. Blotting of the gel was carried out according to standard procedures (34). Northern blots were hybridized at 60°C for 24 h in NorthernMAX prehybridized/hybridized solution (Ambion) and washed twice in 0.5× SSC at 60°C.
32P-labeled antisense riboprobes for Northern hybridization were synthesized from tammar wallaby-derived ATRX and ATRY RT-PCR fragments, according to the manufacturer's instructions (MAXIscript T7/SP6 kit, Ambion).
Cytological Methods.
Air-dried chromosome preparations were made from peripheral blood according to standard methods with minor modifications (36).
Chromosome in situ suppression hybridization of the genomic λ probes was performed, with minor modifications (37). Digoxygenin-labeled probes were detected with anti-DIG-mouse antibodies (Serva), followed by tetramethylrhodamine isothiocyanate-conjugated goat anti-mouse antibodies (Serva). After chromosome in situ suppression hybridization, the chromosome preparations were stained with 4,6-diamidino-2-phenylindole to visualize the chromosomes. Images were collected on a Leitz microscope with a liquid-cooled Photometrics charge-coupled device camera.
Results
Southern Blot Analysis.
The human ATRX cDNA was used to probe a Southern blot containing EcoRI-digested total genomic DNA from male and female M. eugenii (tammar wallaby) and Trichosurus vulpecula (brushtailed possum). The probe detected weak bands shared between the sexes, suggesting the location of an ATRX-like sequence on the marsupial X chromosome or autosomes. Unexpectedly, strongly hybridizing male-specific bands were detected in both marsupial species, indicating that sequences homologous to ATRX were located on the marsupial Y chromosome (Fig. 1).
Southern blot analysis. Detection of ATRX homologues in marsupials. Total genomic DNA was extracted from male and female M. eugenii (tammar wallaby) and T. vulpecula (brushtailed possum) liver tissue and digested with EcoRI. The blot was hybridized with a partial human ATRX cDNA probe. Unfilled arrows indicate the male-specific bands present in both marsupial species. Filled arrows indicate shared bands between male and female lanes.
Cloning and Characterizing Marsupial ATRX Homologues.
The human cDNA probe was used to screen the wallaby adult liver genomic λ phage library. Two clones were isolated with overlapping restriction fragments. Restriction analysis revealed hybridizing EcoRI fragments of sizes identical to the male-specific bands detected on Southern blots. Each fragment was subcloned and sequenced (Fig. 2 a). The sequence displayed very high homology (80% identity at the nucleotide level and 86–90% similarity at the amino acid level) to human ATRX over exon 7 and part of exon 9. This male-specific ATRX homologue was named ATRY.
ATRX/Y sequence analysis. (a) Amino acid alignment of human ATRX cDNA sequence (39) with tammar wallaby ATRX cDNA clone (MeATRX) and ATRY genomic sequence of exons 7 (MeATRY7) and 9 (MeATRY9). Shaded regions denote identity. Solid arrows indicate the position of introns in the human gene, and numbers indicate exon number. Underlined amino acids indicate cysteines located in potential zinc fingers (39). (b) Sequence alignment of ATRX cDNA clone (ATRXc) with ATRX genomic sequence (ATRXg) and ATRY genomic sequence (ATRYg). Shaded regions denote identity. (c) Restriction enzyme maps of the ATRX and ATRY genomic clones. Black boxes indicate regions of homology to the human ATRX probe.
The human cDNA probe was also used to screen a combined male/female pouch young cDNA λ phage library. One clone was isolated and fully sequenced. This cDNA clone spanned human ATRX exons 6–9, displaying 80% sequence identity and 82% amino acid similarity to human ATRX (Fig. 2 a). Alignment of the wallaby cDNA clone with the genomic ATRY sequence revealed several nucleotide differences, implying that this clone represented an additional ATRX homologue in the wallaby genome. This wallaby cDNA clone was used to rescreen the wallaby genomic λ libraries, yielding one new clone. A hybridizing region of the clone was partially sequenced and showed 100% sequence identity to the wallaby cDNA clone over exon 7, indicating that the two clones represented the same gene (Fig. 2 b). Restriction mapping of this clone showed no overlap with the genomic ATRY clone (Fig. 2 c), and sequencing showed a number of nucleotide differences from ATRY. This gene was named ATRX.
Mapping Marsupial ATRX and ATRY.
Fluorescence in situ hybridization localized the wallaby ATRY genomic clone unambiguously to the Y chromosome in this species, confirming the result of the Southern blot analysis (Fig. 3 a). Fluorescence in situ hybridization mapping of the ATRX genomic clone localized it to the wallaby X chromosome (Fig. 3 b), consistent with its location within the conserved region of the X chromosome in humans.
Fluorescence in situ hybridization of the ATRX/Y genomic clones in cells from a male tammar wallaby. (a) The male-specific clone (ATRY) produced strong signals on the Y and no signals on the X. (b) The clone showing shared female and male bands on the Southern analysis (ATRX) hybridized to the X chromosome and showed no cross-hybridization with the Y.
Expression Analysis.
Primers were designed specifically to distinguish the marsupial ATRY and ATRX sequences. RT-PCR was performed, using these primers, to determine the expression pattern of the two genes in tissues from a developing male embryo, adult male and adult female wallaby. The integrity of each RNA extraction was determined by using primers for PGK (phosphoglycerate kinase), which is ubiquitously expressed in the wallaby (38). ATRX showed a wide range of expression, being detected in every tissue sampled with the exception of the developing male gonad. However, ATRY expression was confined to the developing male gonad and adult testis, with weak expression in the prostate and epididymis (Fig. 4 a).
Expression analysis of ATRX and ATRY. (a) RT-PCR using primers to ATRX (I), ATRY (II), and a control PGK (III) to confirm the integrity of the RNA. Lanes 1–3, male pouch young tissue at day 15 after birth (1, adrenal gland; 2, mesonephros; 3, developing testis). Lanes 4–7, adult male tissues (4, epididymus; 5, prostate; 6, spleen; 7, testis). Lanes 8–10, adult female tissues (8, brain; 9, kidney; 10, lung). Lane 11 represents a control PCR in which template DNA was omitted. The DNA marker φX-174-HinfI (Boehringer Mannheim) is represented in the lanes marked φ. ATRX transcripts were detected in every tissue sampled with the exception of the developing testis (I). ATRY expression was detected only in the developing and adult testis and was absent in all other tissues (II). (b) Northern blot of adult female brain RNA (B) and adult testis RNA (T) probed with the ATRY riboprobe. In both brain and testis, a single hybridization band of approximately 7.5 kb was detected. The positions of RNA marker size standards (New England Biolabs) are indicated by arrows.
Northern Blot Analysis.
ATRX and ATRY antisense riboprobes were hybridized to a Northern blot containing total RNA from adult female brain and adult testis. A single hybridization band (approximately 7.5 kb in size) was detected in both tissues (Fig. 4 b).
Discussion
We demonstrate here that the sex-reversing human ATRX gene has a marsupial homologue, not only on the X but also on the Y chromosome. The demonstration of an ATRX homologue on the marsupial X chromosome implies the presence of this gene on the X in the common therian ancestor more than 130 million years ago. As for the mouse Atrx, high sequence homology was observed between human and partial wallaby ATRX throughout exons 7, 8, and the first part of exon 9, corresponding to the zinc finger domain of the ATRX protein (27, 39).
The surprising finding was that ATRX also has a Y-borne homologue ATRY in marsupials, although there is no Y homologue in the human or mouse genome. Southern blot analysis implied a male-specific copy, and this was confirmed by isolating and characterizing ATRY and mapping it to the marsupial Y chromosome. Although the male-specific bands on the Southern blot are completely accounted for by the restriction analysis of the gene, we cannot distinguish between a single or multiple copies of ATRY on the Y chromosome. The ATRX and ATRY genomic clones isolated from the tammar wallaby represent two different loci, producing distinct, although similar proteins. The sequence of ATRY had about 80% homology to marsupial and human ATRX, containing conserved intron–exon boundaries and an ORF. This suggests that ATRY represents an actively transcribed Y-linked copy of the gene. Although complete sequence of the tammar wallaby ATRX and ATRY genes is yet to be determined, both appeared to have a transcript length similar to human and mouse ATRX genes (7,479 bp; refs. 27 and 39). This was demonstrated by the single hybridization band seen in Northern blots of adult testis RNA, where both ATRX and ATRY have been shown by RT-PCR to be expressed.
Despite the similarities in their transcripts, marsupial ATRX and ATRY were shown to have completely different and complementary expression patterns in the wallaby. ATRX is transcribed everywhere except the developing male gonad, whereas ATRY is expressed predominantly in the testis. The ATRX expression pattern observed in humans appears to be a combination of the patterns of marsupial ATRX and ATRY, being detected in a wide range of adult and embryonic tissues including the testis (9, 39).
The most parsimonious explanation for the presence of a Y-borne copy in marsupials is that ATRX/Y was present on the ancestral proto-X/Y. The X- and Y-borne copies differentiated as the Y was progressively degraded, and the Y-borne copy in marsupials (and perhaps ancestral eutherians) retained a selectable function. However, ATRY was degraded and lost from the Y early in eutherian evolution. This demonstrates loss of a gene from the Y early in eutherian evolution, although there are examples of more recent loss from the Y in the primate lineage (e.g., UBE1Y) and the rodent lineage (e.g., RPS4Y).
The evolutionary history of ATRX/ ATRY does not conform to a model for the evolution of male-specific genes on the Y chromosome recently put forward by Lahn and Page (22), in which genes on the human Y chromosome were proposed to represent two classes with different evolutionary histories. Class I comprises genes shared between the X and the Y, which were derived from the ancient homologous proto-X/Y and show widespread expression. Class II comprises Y-specific multicopy genes that were derived by transposition from other chromosomes. These are expressed exclusively in the testis and have functions in male-specific development, such as testis determination and spermatogenesis. Clearly, ATRX/ ATRY violates this distinction, being present on both the X and Y chromosomes in marsupials, yet showing testis-specific expression. In this, it is not the only exception. The candidate spermatogenesis gene RBMY is present in multiple copies and testis specific, although it has now been shown to have a homologue RBMX on the X (21), and even the eutherian testis determining factor SRY also has a homologue, SOX3, on the X (17), which is expressed in the central nervous system. Thus, it appears that most or all of the genes on the mammalian Y chromosome, including those with male-specific functions, are relics of ancient X–Y homology. Differential degradation of the Y in different lineages means that spermatogenesis, and even testis determination, may be controlled by different genes in different species.
The retention of ATRY on the Y in marsupials is particularly interesting in view of the involvement of human ATRX in male sex differentiation. ATRX apparently functions in the eutherian sexual development pathway downstream of SRY, SOX9, and AMH, possibly acting at the level of testis organization. Marsupial ATRY is expressed in the developing testis, suggesting a role in testis determination and/or differentiation, although weak expression in prostate and epididymis could suggest a wider role in development of the whole male urogenital system. It would be interesting to discover whether ATRX is expressed before SOX9 in nonmammalian vertebrates, consistent with a more direct role in testis determination, which may have been retained by ATRY in marsupials.
The complementary expression patterns of marsupial ATRX and ATRY are unique for X- and Y-borne copies of genes. The most parsimonious explanation is that the ancestral ATR gene had a general role in the development of several organs (including testis) in the ancestor to both groups. On differentiation from its X-borne homologue in marsupials, ATRY acquired a male-specific, dominant role in testis differentiation and/or determination, and ATRX lost this function. This led to conservation of ATRY on the Y chromosome in the marsupial lineage, in which it still fulfils a critical function in testis development. In fact, ATRY, being testis-specific, may be a better candidate sex-determining gene in this mammal group than SRY, which is poorly conserved and ubiquitously expressed in marsupials (40). Perhaps ATRY has functions in sex determination as well as sex differentiation in marsupials in the same way that many other genes in the eutherian sex-determining pathway work at multiple levels (14, 15). Localization of ATR homologues in monotremes will be of great interest, as these mammals appear to have no Y-borne SRY gene and may still determine sex through the action of the ATRX/Y locus.
ATR homologues appear to have a conserved role in the development of the mammalian testis that is independent of their location in the genome. There is no evidence that ATRY has been retained in any eutherian mammal. When and why was it lost? One possibility is that continued expression of ATRX in the testis may have led to a redundancy of ATRY function, which permitted the loss of ATRY from the eutherian Y chromosome (41). Another possibility is that ATRY originally had a testis-determining function in eutherians as well as marsupials, but this function was supplanted by the differentiation of SRY, and ATRY was lost in a manner analogous to the loss of the SRY gene from mole voles and spiny rats (5, 6).
Acknowledgments
We thank Professor Douglas Higgs (MRC Molecular Hematology Unit, Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, UK) for supplying the ATRX probe, Iole Barbieri for the chromosome preparations, Maria Papoulis for assistance with the Northern blot, and Dr. Geoff Shaw (Department of Zoology, The University of Melbourne) for collection of some of the tammar wallaby tissues. This work was supported by grants (to J.A.M.G. and M.B.R.) from the Australian Research Council and the National Health and Medical Research Council of Australia.
Footnotes
-
↵ † To whom reprint requests should be addressed. E-mail: a.pask{at}zoology.unimelb.edu.au.
-
Data deposition: The sequences reported in this paper has been deposited in the GenBank database (accession no. AF303445).
-
Article published online before print: Proc. Natl. Acad. Sci. USA, 10.1073/pnas.230424497.
-
Article and publication date are at www.pnas.org/cgi/doi/10.1073/pnas.230424497
- Abbreviations:
- ATRX,
- α-thalassemia and mental retardation associated with the X chromosome;
- ATRY,
- α-thalassemia and mental retardation-like gene on the Y chromosome;
- SRY,
- sex-determining region on the Y chromosome;
- SOX3,
- SRY-like HMG box containing gene 3;
- PAR,
- pseudoautosomal region;
- RT-PCR,
- reverse transcription–PCR
- Copyright © 2000, The National Academy of Sciences














