Table S4.

qPCR primer pairs (related to Fig. 1 and Fig. S2)

SpeciesGene categoryGene namePrimer forward 5′-3′/primer reverse 5′-3′
RatFPR genesFpr1CCTGGCCAAGAAGGTAATCA/TGTTTTCCCTGGTCCAAGTC
Fpr-rs2CGCTGTCAAGATCCACAGAA/AGCTCTTTGAACCAGATTGTACC
Fpr-rs1TGGTCTGATTCTCAGTTTGCA/ACCCCAGGATGGAAAGTAGT
Fpr-rs3GTCCTTCATTGCCATTTGC/ATTGCTACAGCACTGAGAACA
Fpr-rs4AATGCCTCGAAATGGATCAG/GGTTATACAGAGAACCACTAG
Fpr-rs6GGCTTCAGCATACCCATGAT/GCTACAGCAGTGAGGACACG
VR genesV1r8TCCAAACTCATGCTTCCCCT/TTACCCACCAACTGGGATCA
V2r10TCCTATCTGCACCCTGATCC/CAGTACAGCGTGGAAAGCAA
Normalization genesTBPTGCCACACCAGCCTCTGA/CCAAGATTCACGGTGGATACAA
β-actinCGTGAAAAGATGACCCAGATCA/CACAGCCTGGATGGCTACGTA
Eef1CGCCAACTCGTCCAACTGA/CCAATGCCGCCAATTTTATAGA
Chinese hamsterFPR genesFpr1TCCATTGTTGCCATTTGCTA/AGCCACGACAAAAGAGAGGA
Fpr-rs2TCTTCCTGATCGCGCTCATTGCC/TAGCCAGGCTCACAGTGCGGT
Fpr-rs3AACCTTTGTCCTTGGTGTGC/CCCAAAGCCAGGTTCAGATA
VR genesV2ru4GGACCCCCTGGGGATGTCTCTC/AGCCTTGACAATCGGGGTGTCTCT
V1ru10CCCCTGAATCCAGAGCCACACAG/GCCTTGCAAAATGGAGGAGATGGTG
Normalization genesβ-actinCGTGAAAAGATGACCCAGATCA/AGGGACAGCACAGCCTGAAT
GapdhTTCTAGAGACAGCCGCATCTTTC/GCCGACCTTCACCATTGC
TubGGGAAATCGTGCACATCCA/TGATCACCTCCCAGAACTTAGCA
Guinea pigFPR genesFpr-ps1TGCAGTCACCTTTGTCCTGGGC/AGGGTGGTGACGGTGCGTTT
Fpr2TCCAGCTGGTTGCACTTCTAAGCA/GGGAGCTTGTTGGATTGACCAGGA
Fpr3TTCAACAGCTGCCTCAACCCAGT/ACTGGAGGCTGTGTCACGGG
Fpr4TCTGCTGGTTCCCCTATCGTCTGA/GGCCAGGGACACAGTTAGAGGG
Fpr-ps5TACTGGGTGGGGTCCTAACT/TCATTGAGCCCTGAAGCTGA
Fpr6CATGTTCTGGGGATCAACCG/GGGCATGCTGAAGCCAATAA
VR genesV1rx1GACCAGGAGGGATGATAGGC/TGGTAGAGTTGTGGCCATGT
V1rx-ps2CTGATTCTTACCCGCATGGC/TCCCAGAGTGGGTGTTACTC
V1rx-ps3GCTGTGGCCAACTTCTTGAT/GACAAGTTTGCACCCCATGT
V1r632GACTCTGGAGAAGATGCAAGGCTGA/TCCTGTACAAGCACAGGCAGCAG
V2r26likeGGGGAGGAACGTGACCCACAC/CTGGGCTCCTTGGCCATGCT
Normalization genesGapdhGGTTTCTCCAGGCGGCAGGT/ACTGGTGCTGCCAAGGCTGT
HprtCCCCTTGAGGACGCAGAGAGC/TGGACAGGACTGAAAGGCTTGCT
AlasCCGCGGCACTGTCGGGTAAT/CCACTGCCCCAGCCACATCA
Rps9TCGCAGGAGAGCGTTGCCTT/TTTGCGGAACAAGCGCGAGG