Edited by Cynthia J. Kenyon, University of California, San Francisco, CA (received for review August 6, 2004)
Characterization of expression of dilp2, dilp3, and dilp5 in adult female Drosophila. Gene expression of dilp2, dilp3, and dilp5 was determined in 5-day-old adult female brains by RNA in situ hybridization and quantitative RT-PCR of the control genotype (UAS-rpr/+). (A) Exemplar in situ hybridization using a dilp2 DIG-labeled RNA probe and alkaline phosphatase-conjugated anti-DIG Ab. Cells containing the target gene constitute the median neurosecretory cells (mNSCs) in the pars intercerebralis of the adult brain. (Scale bars, 80 μm.) (B) Separate RNA extracts from heads and bodies of adult female flies were assayed for the presence of dilp2, dilp3, and dilp5 transcripts by RT-PCR. Data are shown as mean copy number ± SEM. Double in situ hybridizations were performed by using a FITC-labeled dilp5 probe and DIG-labeled dilp2 and 3 probes, followed by alkaline phosphatase-conjugated anti-DIG and anti-FITC Abs. (C) Double staining for dilp2 (visualized with fast red) and dilp5 probes (visualized with BCIP/NBT) revealed their colocalization. n = 7. (D) Likewise, double staining using DIG-labeled dilp3 (fast red) and FITC-labeled dilp5 (BCIP/NBT) probes revealed their colocalization (n = 8). (E) Fluorescent in situ hybridization was used to quantify dilp-expressing mNSCs. This example shows a fluorescent dilp3 probe localized to six pairs of mNSCs. (Scale bar, 10 μm.) Seven brains were examined by using the dilp2 probe, 12 brains were examined by using the dilp3 probe, and 11 brains were examined by using the dilp5 probe.
The mNSC-specific expression of the dilp2-GAL driver in the adult brain and the effect of mNSC ablation on dilp expression. (A and B) Confocal image (z-stack projection) of dilp2-GAL-driven expression of UAS-GFP in control (UAS-GFP/+;dilp2GAL/+) (A) and ablated (UAS-rpr/+;UAS-GFP/+;dilp2GAL/+)(B) adult female brains. (C–E) RNA in situ hybridizations were performed by using DIG-labeled probes and an alkaline phosphatase-conjugated anti-DIG Ab to UAS-rpr/+; dilp2GAL/+ adult female brains. (C) dilp2. (D) dilp3. (E) dilp5. (F) The effect of mNSC ablation on dilp expression measured by RT-PCR. Data are mean fold differences in expression between the ablated genotype (UAS-rpr/+; dilp2GAL/+) and the control (UAS-rpr/+) ± SEM. (G–I) Adult mNSCs immunostained with an Ab against DILP2 in a control brain (UAS-rpr/+; n = 5) (G), and ablated brains (UAS-rpr/+; dilp2-GAL/+) (H and I). For sample sizes and residual mNSC numbers, see Table 2, which is published as supporting information on the PNAS web site.
mNSC-ablated flies are long-lived and females show reduced fecundity. (A) Survival of UAS-rpr/+; dilp2-GAL/+ virgin females (red), and dilp2-GAL/+ (brown), UAS-rpr/+ (blue), and w (green) controls. Median lifespans are as follows: UAS-rpr/+; dilp2-GAL/+, 64 days (18.5% increase over UAS-rpr/+ control, P < 0.0001; n = 173); dilp2GAL/+, 47 days (n = 187); UAS-rpr/+, 54 days (n = 232); and w, 47 days (n = 202). (B) Survival of UAS-rpr/+; dilp2-GAL/+ mated females (red), and dilp2-GAL/+ (brown), UAS-rpr/+ (blue), and w (green) controls. Median lifespans are as follows: UAS-rpr/+; dilp2-GAL/+, 56 days (33.5% increase over UAS-rpr control, P < 0.0001; n = 93); dilp2-GAL/+, 32 days (n = 115); UAS-rpr/+, 42 days (n = 88); and w, 35 days (n = 112). (C) Survival of UAS-rpr/+; dilp2-GAL/+ males (red), and dilp2-GAL/+ (brown), UAS-rpr/+ (blue), and w (green) controls. Median lifespans are as follows: UAS-rpr/+; dilp2-GAL/+, 41 days (10.5% increase over dilp2-GAL/+ control, P < 0.0001; n = 140); dilp2-GAL/+, 37 days (n = 150); UAS-rpr/+, 35 days (n = 128); and w, 34 days (n = 195). (D and E) Fecundity of females from experiment shown in A (D) and B (E). Data are given as mean number of eggs laid per female per day ± SEM. *, P < 0.05, compared with controls. (F) Age-specific mortality analysis of UAS-rpr/+ (n = 1,186) and dilp2-GAL4/UAS-rpr (n = 1,143) mated females. Natural log of the mortality rate (μx) is plotted.
The effect of mNSC ablation on hemolymph glucose and trehalose levels, and whole-body trehalose, glycogen, and lipid content. (A) Hemolymph glucose concentration in UAS-rpr/+ and UAS-rpr/+; dilp2-GAL/+ flies. (B) Hemolymph trehalose concentration in UAS-rpr/+ and UAS-rpr/+; dilp2-GAL/+ flies (n = 8). (C) Whole-fly trehalose content in UAS-rpr/+ and UAS-rpr/+; dilp2-GAL/+ flies per mg of fly (fresh weight) (n = 10). (D) Glycogen content of UAS-rpr/+ and UAS-rpr/+; dilp2-GAL/+ flies per mg of fly (fresh weight) (n = 21). (E) Lipid content of UAS-rpr/+ and UAS-rpr/+; dilp2-GAL/+ flies per mg of fly (fresh weight) (n = 17). Data are shown as means ± SEM. *, P < 0.05, compared with control.
Long-lived mNSC-ablated adults are resistant to oxidative stress and starvation but show reduced thermotolerance. (A) Survival of 10-day-old adult female flies on 20 mM paraquat added to standard food. Sample sizes were n = 100 for each genotype in the first experiment and n = 85 for each genotype in second. (B) Survival of females during starvation (1% agar). n = 144 for dilp2GAL/UAS-rpr; n = 150 for UAS-rpr/+ in experiment 1; n = 182 for dilp2GAL/UAS-rpr; and n = 154 for UAS-rpr/+ in experiment 2. For both experiments, the median lifespans were as follows: dilp2GAL/UAS-rpr, 12 days; and UAS-rpr/+, 10 days. (C) Survival of 6-day-old females with 38.5°C heat. n = 20 for each genotype/experiment. (A–C) Data are shown as mean survival for each time point over two experiments ± SEM. P < 0.05, compared with control. (D) Mean time to recover from cold treatment of 9-day-old females ± SEM (n = 50 for each genotype).
|
Broughton et al. 10.1073/pnas.0405995102. |
Supporting Materials and Methods
Quantitative RT-PCR. Live flies were snap frozen in liquid nitrogen and stored at –80ºC. Total RNA from 20 frozen heads and bodies of each genotype was extracted, and three independent RNA extractions of heads and bodies of each genotype were performed. The dilp primers were as follows: dilp2F, TCTGCAGTGAAAAGCTCAACGA; dilp2R, TCGGCACCGGGCATG; dilp3F, AGAGAACTTTGGACCCCGTGAA; dilp3R, TGAACCGAACTATCACTCAACAGTCT; dilp5F, GAGGCACCTTGGGCCTATTC; and dilp5R, CATGTGGTGAGATTCGGAGCTA. Endogenous control primers were as follows: actin5C, CACACCAAATCTTACAAAATGTGTGA (forward); and actin5C, AATCCGGCCTTGCACATG (reverse). Primers were optimized (Advanced Biosystems procedures), and relative quantities of dilp transcripts were determined (relative standard curve method) and normalized to actin5C. Fold-change calculations were calculated between UAS-rpr/+; dilp2-GAL/+ fly extracts and control UAS-rpr/+ fly extracts (Applied Biosystems). For absolute quantification, copy numbers of each dilp transcript per fly head or body were estimated by using standard curve method and dilp cDNA templates of known concentration (Applied Biosystems). Because of possible variations in efficiency and amplification of reverse transcription, this method provides only an estimate of mRNA copy number, but it allows precise determination of the relative contributions of each dilp to the total pool of dilp transcripts.
Lifespan. UAS-rpr/+; dilp2-GAL/+, dilp2-GAL/+, UAS-rpr/+ and wDah flies were reared at standard larval density. Eclosing adults were collected over a period of 8 hours. Lifespan was measured in flies (10 flies per vial) on standard food medium, transferred to new food twice weekly by CO2 anaesthesia, and randomly sorted to maintain a density of 10 flies per vial. For mortality analysis, an otherwise similar experiment was done with flies maintained at a density of 100 files per bottle on standard food. Deaths were scored five or six times every 7 days.
Trehalose and Glucose Measurement. Glucose was measured by using Infinity Glucose Reagent (ThermoElectron). The reaction was complete within 3 minutes at 37ºC, and A340 was measured to determine total glucose in the samples. To measure trehalose in the samples, trehalase was added (final concentration of 0.05 units·ml-1), the solution returned to 37ºC overnight, followed by a second reading of A340. The amount of trehalose is equal to the final absorbance reading minus that of the first reading. Final glucose and trehalose concentrations were determined by reference to standard curves.
Table 2. Data for Fig. 2
|
Effect of mNSC ablation on dilp expression |
Fig. 2C dilp2 expression |
Fig. 2D dilp3 expression |
Fig. 2E dilp5 expression |
Fig. 2 H and I DILP2 immunostaining |
|
Total no. of examined brains |
6 |
7 |
5 |
17 |
|
No. of Residual mNSCs in brains of the ablated genotype (UAS-rpr/+; dilp2GAL/+) |
0 mNSCs in 2 brains
1 mNSC in 3 brains
3 mNSCs in 1 brain
|
0 mNSCs in 3 brains
1 mNSC in 3 brains.
3 mNSCs in 1 brain
|
0 mNSCs in 1 brains
1 mNSC in 3 brains
5 mNSCs in 1 brain
|
0 mNSCs in 2 brains
1 mNSCs in 2 brains
2 mNSCs in 5 brains
3 mNSCs in 5 brains
4 mNSCs in 2 brains
5 mNSCs in 1 brains
|
