Research Article

Essential role of TAK1 in thymocyte development and activation

Hong-Hsing Liu, Min Xie, Michael D. Schneider, and Zhijian J. Chen
PNAS August 1, 2006 103 (31) 11677-11682; https://doi.org/10.1073/pnas.0603089103

  1. Edited by Eric N. Olson, University of Texas Southwestern Medical Center, Dallas, TX, and approved June 9, 2006 (received for review April 15, 2006)

Abstract

The protein kinase TAK1 mediates the activation of NF-κB in response to stimulation by proinflammatory cytokines and microbial pathogens in the innate immunity pathways. However, the physiological function of TAK1 in the adaptive immunity pathways is unclear. By engineering mice lacking TAK1 in T cells, here, we show that TAK1 is essential for thymocyte development and activation in vivo. Deletion of TAK1 prevented the maturation of single-positive thymocytes displaying CD4 or CD8, leading to reduction of T cells in the peripheral tissues. Thymocytes lacking TAK1 failed to activate NF-κB and JNK and were prone to apoptosis upon stimulation. Our results provide the genetic evidence that TAK1 is required for the activation of NF-κB in thymocytes and suggest that TAK1 plays a central role in both innate and adaptive immunity.

The Rel/NF-κB family of transcription factors regulates the expression of a plethora of genes involved in inflammation, immunity, and apoptosis (1, 2). NF-κB is normally sequestered in the cytoplasm of unstimulated cells through its association with the IκB family of inhibitory proteins. Stimulation of cells with a variety of agents leads to the rapid phosphorylation and subsequent degradation of IκB by the ubiquitin–proteasome pathway, thus allowing NF-κB to enter the nucleus to turn on various target genes.

Phosphorylation of IκB is catalyzed by a large kinase complex consisting of IκB kinase (IKK)α, IKKβ, and NEMO (also known as IKKγ or IKKAP). The IKK complex integrates signals from diverse pathways, including those emanating from the receptors for TNFα and IL-1β, Toll-like receptors (TLRs), and T cell receptors (TCRs) (3–6). Stimulation of IL-1R and some TLRs leads to the recruitment of several proteins, including the adaptor MyD88, the kinases IRAK4 and IRAK1, and the ubiquitin ligase TRAF6. TRAF6 functions in conjunction with the ubiquitin-conjugating enzyme (E2) complex Ubc13–Uev1A to catalyze the synthesis of Lys-63-linked polyubiquitin chains on certain protein targets, including TRAF6 itself (7, 8). Polyubiquitinated TRAF6 activates a protein kinase complex consisting of the TAK1 kinase and the adaptor proteins TAB1 and TAB2 (8, 9). The activation of TAK1 by TRAF6 requires the binding between the K63 polyubiquitin chains and a conserved novel zinc finger (NZF) domain of TAB2 or its homologue TAB3 (10). After TAK1 is activated, it phosphorylates IKKβ within the activation loop, resulting in the activation of IKK. TAK1 also phosphorylates and activates MKK6 and MKK7, leading to the activation of p38 and JNK kinase pathways.

Recent studies have shown that TRAF-mediated polyubiquitination and the TAK1 kinase complex also play an important role in NF-κB activation in T cells (11). Stimulation of TCR by an antigenic peptide and its cognate MHC activates a tyrosine kinase phosphorylation cascade, which, in turn, leads to the activation of protein kinase (PK)Cθ. PKCθ then triggers the recruitment of the CARD domain proteins CARMA1 and BCL10 and the paracaspase MALT1 to lipid rafts (12–14). MALT1 binds to TRAF6 and promotes TRAF6 oligomerization, which activates its ubiquitin ligase activity (11). TRAF6-mediated polyubiquitination then leads to the activation of TAK1 and subsequent activation of IKK. This T cell signaling pathway from BCL10 to IKK activation can be reconstituted in vitro by using purified recombinant proteins, including Ubc13–Uev1A (E2), TRAF6 (E3), and the TAK1 kinase complex (11). Furthermore, RNAi-mediated silencing of TAK1, TRAF2, and TRAF6 inhibits IKK activation and IL-2 production in Jurkat T cells. However, it has been shown that MALT1 can function as a ubiquitin ligase that binds directly to Ubc13–Uev1A and promotes the polyubiquitination of NEMO, thereby leading to IKK activation (15). According to this model, TRAF proteins and TAK1 are not required for IKK activation by TCR.

The role of TAK1 in NF-κB activation by receptors of the innate immunity pathways, including TNFR, IL-1R, and TLR, has been validated in vivo through the isolation of Drosophila TAK1 mutants (16) and the generation of TAK1-knockout mice (17, 18). However, conditional deletion of TAK1 in B cells by using Cd19-Cre did not abolish NF-κB activation by B cell receptors (BCRs) (17), which also signal through the CARMA1–BCL10–MALT1 complex (19). This result is discordant with another recent study that used homologous recombination in chicken DT40 cells to delete TAK1 and showed that the complete absence of TAK1 abolished IKK and NF-κB activation by BCRs (20).

In this report, we investigated the role of TAK1 in T cell development and activation by engineering a mouse model in which TAK1 was conditionally deleted in T cells. We showed that thymocytes lacking TAK1 failed to survive during the progression from double-positive (DP) (CD4+CD8+) to single-positive (SP) (CD4+ or CD8+) stages, resulting in significant reduction of naïve T cells in the peripheral tissues. The loss of TAK1 in the thymocytes prevented the activation of IKK, NF-κB, and JNK and sensitized the mutant cells to activation-induced apoptosis. Our results provide the genetic evidence that TAK1 is essential for thymocyte development and activation.

Results

Conditional Knockout of TAK1 in T Cells.

To engineer conditional alleles of Tak1 in mice, we constructed a targeting vector in which exon 1 of Tak1 was flanked between a loxP site before the transcriptional initiation site and another loxP site within intron 1 (Fig. 1 A). The FRT-neo-FRT selection cassette was inserted before the intronic loxP site. The 5′ and 3′ homologous regions were 2.5 and 3.0 kb, respectively. ES cell targeting and the generation of heterologous floxed Tak1 mice (Tak1 +/flox) were carried out by using standard protocols. The Tak1flox/flox mice were born and lived normally, and they expressed TAK1 protein as expected (data not shown). To delete the Tak1 allele specifically in T cells, we crossed Tak1flox/flox mice with the Lck-Cre transgenic mice, which express the Cre recombinase under the control of the T cell-specific Lck promoter (21). Southern blotting and PCR showed that the floxed Tak1 alleles were excised in thymocytes, but not in the tail (Fig. 1 B and C). Western blotting confirmed that TAK1 was not detectable in the thymocytes of Lck-Cre/Tak1flox/flox mice, but its expression level in splenocytes was similar to that in control littermates (Fig. 1 D). Surprisingly, the lymph node T cells from Lck-Cre/Tak1flox/flox mice had normal levels of TAK1 but lacked the expression of Cre, whereas the cells from Lck-Cre/Tak1 +/+ mice still had high levels of Cre expression (Fig. 1 D). Genomic PCR confirmed the presence of the floxed Tak1 allele in T cells derived from lymph nodes and blood (data not shown), indicating that these cells have escaped from Cre-mediated recombination. Thus, the loss of Cre expression and the retention of the floxed Tak1 alleles in Lck-Cre/Tak1flox/flox mice likely resulted from counterselection during T cell development in the thymus (see below and Discussion). For the control groups, we observed no phenotypic difference among Tak1floxed/floxed , Lck-Cre/Tak1 +/+, and Lck-Cre/Tak1 floxed/+, indicating that one copy of the Cre transgene did not have any confounding effect on the functional analyses of the mice. For simplicity, the Lck-Cre/Tak1flox/flox mice with deletion of the Tak1 alleles are herein referred to as Tak1D or knockout, whereas the control mice still containing the floxed Tak1 allele are referred to as Tak1FL or control.

Fig. 1.
Fig. 1.

Conditional deletion of Tak1 in mouse thymocytes. (A) Strategies for the generation and deletion of floxed Tak1 alleles. (B) Southern blotting of genomic DNA after digestion with NheI. (C) PCR of genomic DNA isolated from the tails or thymocytes of the mice, as indicated. (D) Western blotting of whole-cell lysates from splenocytes, thymocytes, and lymph node T cells. Lysates from 1.6 × 106 cells were loaded on each lane. In lane 6, lymph node T cells for Lck-Cre/Tak1flox/flox were pooled from three mice. The expression of TAK1 and loss of expression of Cre in these cells likely resulted from the selective expansion of TAK1-expressing cells that escaped from Cre-mediated excision.

Reduction of Peripheral T Cells in TAK1 Conditional Knockout Mice.

We analyzed peripheral B (B220+) and T cells (CD3+) in Tak1D and Tak1FL by FACS. Although the percentage of B cells was similar in both genotypes, the percentage of T cells in the peripheral lymphoid organs, including lymph nodes, spleens, and blood, was significantly lower in Tak1D mice as compared with controls (Fig. 2 A). This decrease of T cell percentage was not due to an increase of B cell number, because the number of splenocytes was similar in the knockout and control mice (4.0 ± 1.0 × 108 in Tak1D vs. 4.1 ± 0.8 × 108 in Tak1FL ; n = 5). The decrease of T cell number was not observed in various control animals, including floxed mice without the Lck-Cre transgene and the Lck-Cre mice without the floxed Tak1 allele. The percentage of T cells in the blood of Tak1D mice was about one-fourth that of the control mice (Fig. 2 B; 5.9 ± 1.1% in Tak1D vs. 26.4 ± 1.6% in Tak1FL ; n = 13). The relative abundance of helper (CD4+) vs. cytotoxic (CD8+) T cells in the blood was similar for both Tak1D and Tak1FL mice (CD4+/CD8+ ratio, 1.2 ± 0.2 in Tak1D vs. 1.3 ± 0.2 in Tak1FL ; n = 6).

Fig. 2.
Fig. 2.

Reduction of peripheral T cells in Tak1D mice. (A) Suspension cells from lymph nodes, spleens, and blood were analyzed by FACS using antibodies against CD3 and B220, respectively. (B) The percentages of CD3+ T cells in the blood from the TAK1-knockout (Tak1D ) mice and their control littermates (n = 13).

TAK1 Is Required for the Development and Maturation of Single-Positive Thymocytes.

The reduction of T cells in the peripheral lymphoid organs of Tak1D mice may be due to defective T cell development in the thymus. Intrathymic T cell precursors develop through several stages before entering the peripheral mature T cell pool (2, 22). The most immature cells transit from the double-negative (DN) stage CD4−CD8− into the DP stage (CD4+CD8+) after completion of β-selection. DP thymocytes go through further selections before committing to SP cells (CD4+ or CD8+). To determine whether TAK1 is required for thymocyte development, we analyzed the expression of CD4 and CD8 by FACS. As shown in Fig. 3 A and Table 1, both CD4+ and CD8+ SP thymocytes in Tak1D mice were reduced by ≈50% as compared with the Tak1FL mice. In contrast, there was no significant difference in the number of CD4+CD8+ DP thymocytes between Tak1D and Tak1FL mice. We also analyzed the CD24highCD4−CD8− thymocytes to examine the transition of thymocytes from DN1 to DN4 (DN1, CD44+CD25−; DN2, CD44+CD25+; DN3, CD44−CD25+; and DN4, CD44−CD25−). No apparent defect was observed in any of these developmental stages in Tak1D mice (Fig. 3 B), consistent with normal TAK1 protein expression in DN thymocytes in which Lck-Cre was not turned on until the later stages of DN thymocyte development (data not shown) (23).

Fig. 3.
Fig. 3.

Defective development of CD4+ and CD8+ SP thymocytes in Tak1D mice. (A) Thymocytes from Tak1D (knockout) and wild-type (control) littermates were analyzed by FACS using antibodies against CD4 and CD8. (Insets) The percentages of thymocytes at different stages. The absolute number of each type of thymocytes is shown in Table 1. (B) CD24high CD4− CD8− DN thymocytes were analyzed by FACS using antibodies against CD25 and CD44. Different developmental stages of thymocytes (DN1–4) are indicated in key to the right of B. (C) SP and DP thymocytes were analyzed for CD69 expression. Percentages of CD69+ populations were 89% in Tak1D vs. 87% in Tak1FL for CD4+ SP, 60% in Tak1D vs. 64% in Tak1FL for CD8+ SP, and 11% in Tak1D vs. 10% in Tak1FL for CD4+CD8+ DP. (D) FACS analysis of CD24 expression in CD4+ or CD8+ SP thymocytes. High expression of CD24 is inversely correlated with the maturation of SP thymocytes. The results are normalized for the total numbers of thymocytes.

View this table:
Table 1.

Comparison of thymocyte numbers in Tak1 (knockout) mice and control littermates

To investigate the mechanism underlying the reduction of SP thymocytes in Tak1D mice, we analyzed the CD69 surface marker, which is expressed on positively selected cells (24). As shown in Fig. 3 C, although Tak1D mice contained fewer CD4+ and CD8+ SP thymocytes, the percentages of CD69+ thymocytes were comparable to those in the wild-type mice, indicating that loss of TAK1 did not compromise the positive selection of thymocytes. To determine whether the maturation of SP thymocytes is affected by the loss of TAK1, we used FACS to examine the expression of CD24, a surface marker that is gradually down-regulated during maturation of SP thymocytes (25). As shown in Fig. 3 D, the number of CD24low and CD24intermediate CD4+ or CD8+ SP cells was significantly less in Tak1D than in Tak1FL mice, indicating that the maturation of SP cells was impaired in Tak1D thymocytes.

Loss of TAK1 Sensitizes SP Thymocytes to Apoptosis.

The reduction in the number of SP thymocytes could be due to survival disadvantages in Tak1D thymocytes. To investigate this possibility, we carried out an in vitro survival assay for thymocytes at DP or SP stages. These cells were sorted by FACS and cultured in vitro with or without anti-CD3ε stimulation. At indicated time points, nonsurviving cells were stained by Annexin-V and analyzed by FACS (Fig. 4). After stimulation with anti-CD3ε for 40 h, both CD4+ and CD8+ SP thymocytes from Tak1D mice had a significant increase in apoptosis as compared with thymocytes from the control littermates, as shown by enhanced Annexin-V staining (Table 2). In the absence of stimulation, the SP thymocytes from Tak1D mice also displayed increased Annexin-V staining compared with those from the control mice (Fig. 4). In contrast to SP thymocytes, the Tak1D DP thymocytes were surviving as well as control DP thymocytes in the absence of anti-CD3ε stimulation. After stimulation, the number of Annexin-V-positive DP thymocytes in Tak1D mice was slightly less than that of control mice, suggesting that TAK1 might facilitate the apoptosis of DP thymocytes. Cell cycle analysis by 7-amino-actinomycin D (7-AAD) staining (26) showed that Tak1D SP thymocytes did not have proliferation defects (data not shown), indicating that the decrease in SP thymocytes was primarily due to enhanced apoptosis.

Fig. 4.
Fig. 4.

Survival disadvantage of CD4+ and CD8+ SP thymocytes in Tak1D mice. SP and DP thymocytes from Tak1D mice (knockout) or control littermates were purified and sorted by FACS and then cultured in 96-well plates coated with an anti-CD3ε antibody or PBS buffer (as a control). Cells were harvested at indicated time points, incubated with Annexin-V, and analyzed by FACS. At least 4,000 events were analyzed for each sample. Probabilities shown in the diagrams represent samples stimulated with anti-CD3ε for 40 h. (Inset Lower Right) is a typical FACS diagram from CD4+ thymocytes stimulated with anti-CD3ε for 40 h.

View this table:
Table 2.

Percentage of Annexin-V-positive cells

TAK1 Is Required for the Activation of NF-κB and JNK in Thymocytes.

The defective SP thymocyte development observed in Tak1D mice is reminiscent of the phenotypes observed in mice lacking NEMO or expressing a dominant-negative mutant of IKKβ in T cells (27). Because in vitro and ex vivo studies have suggested that TAK1 is required for NF-κB activation in T cells (11), we used EMSA to determine whether NF-κB activation was impaired in Tak1D thymocytes (Fig. 5 A). As reported (28), NF-κB is active in CD4+ or CD8+ SP thymocytes of wild-type mice. In contrast, the NF-κB activity was greatly diminished in the SP thymocytes of Tak1D mice. The DP thymocytes from wild-type mice also exhibited weak NF-κB activity; this activity was not detectable in the DP thymocytes of Tak1D mice. The loss of TAK1 did not affect the DNA binding of the control transcription factor Oct-1. Thus, TAK1 is required for NF-κB activation during the normal development of mouse thymocytes.

Fig. 5.
Fig. 5.

TAK1 is required for the activation of NF-κB and JNK in thymocytes. (A) (Upper) EMSAs for NF-κB DNA-binding activity using whole-cell extracts from SP or DP thymocytes isolated from Tak1D mice (lanes 1, 3, and 5) or control littermates (lanes 2, 4, and 6). (Lower) The same extracts were assayed for DNA binding of the constitutive transcription factor Oct-1. (B) Thymocytes were stimulated with phorbol 12-myristate 13-acetate (100 ng/ml) and ionomycin (200 ng/ml) for the indicated time periods, and cell lysates were harvested for analysis by immunoblotting using antibodies specific for IκBα, JNK, phosphorylated JNK or ERK, or tubulin (as a loading control). (C) Thymocytes were stimulated with PMA and ionomycin as described above, and the IKK complex was immunoprecipitated by using a NEMO-specific antibody. IKK activity was measured by using GST-IκBα-NT (N terminus) and γ-32P-ATP as the substrates. Aliquots of the immunoprecipitated complexes were subject to immunoblotting using an antibody against IKKβ. (D) Thymocytes were stimulated with TNFα for the indicated time periods, and cell lysates were harvested for analysis by immunoblotting using antibodies specific for TAK1, IκBα, JNK, phosphorylated JNK, or tubulin. (E) Thymocytes were incubated with PBS or plate-bound anti-CD3ε for 16 h, and whole-cell extracts were prepared for analyses of NF-κ B or OCT-1 DNA binding by EMSA. The same extracts were also subjected to immunoblotting with an antibody against p65. (F) Thymocytes from Tak1D mice or control littermates were incubated with PBS or plate-bound anti-CD3ε for 20 h before total RNA was extracted for real-time PCR analyses. Two mice were used in each group. The c-myc expression levels were normalized to the levels of β-actin. The error bars indicate standard errors.

To determine whether TAK1 is required for the activation of IKK and JNK, we stimulated thymocytes with phorbol ester (phorbol 12-myristate 13-acetate) and ionomycin, which mimic the stimulation of TCR in T cells (Fig. 5 B and C), or with TNFα (Fig. 5 D). In both cases, the degradation of IκBα and activation of IKK and JNK were severely impaired in thymocytes derived from Tak1D mice, whereas the activation of ERK occurred normally in these cells. We also examined NF-κB activation after stimulation of thymocytes with an antibody against CD3ε, which cross-links TCR. As shown in Fig. 5 E, NF-κB activation was impaired in thymocytes from Tak1D mice. Finally, we used real-time PCR to measure the expression of c-myc, an NF-κB-dependent gene required for the survival of thymocytes (29–31). When thymocytes were stimulated with anti-CD3ε, c-myc was induced by ≈4-fold in the wild-type cells but not in Tak1D cells (Fig. 5 F). Collectively, these results indicate that TAK1 is essential for the activation of NF-κB and JNK in thymocytes.

Discussion

In this report, we showed that specific deletion of TAK1 in T cells prevented the development of CD4+ and CD8+ SP thymocytes, resulting in significant reduction of T cells in the peripheral tissues, including lymph nodes, spleens, and blood. The defective development of SP thymocytes was due, at least in part, to the increased apoptosis of these cells, especially under conditions of anti-CD3 stimulation. We further showed that TAK1 was essential for the activation of IKK, NF-κB, and JNK, demonstrating the role of TAK1 in T cell development and activation. Thus, TAK1 is an essential IKK kinase in both innate and adaptive immunity.

The defective thymocyte development observed in the conditional Tak1D mice is similar to the phenotypes of mice lacking NEMO or expressing a kinase-dead mutant of IKKβ in T cells (27), further supporting the role of TAK1 in IKK activation. However, knockouts of some components of the TCR signaling pathway, such as CARMA1, BCL10, and MALT1, which affect IKK activation in mature T cells, do not severely affect T cell development in the thymus (32–37). Thus, TAK1 and IKK may be activated by a TCR-independent signaling pathway in thymocytes. Indeed, NF-κB is constitutively active during intrathymic development at both DN and SP stages. The constitutive activation of NF-κB in DN thymocytes is thought to be mediated by pre-TCR, which is assembled after the rearrangement of TCR β-chain during the transition from DN3 to DN4 stages. Pre-TCR signaling is ligand-independent and may be initiated by the autonomous oligomerization of pre-TCR α-chain (38). However, the mechanism underlying the constitutive activation of NF-κB at the SP stage is currently unknown. Because our studies of Tak1D mice have now shown that TAK1 is required for IKK and NF-κB activation in SP thymocytes, further studies should be directed toward understanding how TAK1 is activated in these cells.

Previous studies using transgenic mice expressing an IκBα superrepressor under the control of the Cd2 promoter have demonstrated that NF-κB is required for the positive selection of CD8+ thymocytes (39). Furthermore, it was found that the IκBα transgenic mice exhibited a developmental block in the transition from DN3 to DN4 thymocytes (28). However, we did not observe any obvious developmental defect in the DN thymocytes of Tak1D mice (Fig. 3 B). A possible explanation for these distinct phenotypes is that, in the IκBα transgenic mice, IκBα can immediately inhibit NF-κB once it is synthesized, whereas, in the Tak1D mice, the TAK1 protein remains in the DN thymocytes until the endogenous TAK1 is degraded after the induction of Cre and the deletion of the floxed Tak1 locus. Indeed, immunoblotting experiments showed that TAK1 is present in the DN thymocytes of Tak1D mice (data not shown). Thus, the role of TAK1 in the early stages of thymocyte development remains to be determined.

A recent study using Cd19-Cre to delete Tak1 in B cells showed that TAK1 is required for JNK, but not NF-κB, activation in response to B cell receptor (BCR) stimulation (17). However, another recent study using chicken DT40 cells to completely remove Tak1 demonstrated that TAK1 is required for both IKK and JNK activation after BCR stimulation (20). It is not clear whether these different results reflect the difference of cells (chicken vs. mouse) or the knockout strategies used in the studies. It is possible that the Cd19-Cre-mediated deletion may not be very efficient, resulting in a low level of TAK1 activity that is sufficient for IKK activation but insufficient for JNK activation. Our current study shows clearly that TAK1 is required for IKK, NF-κB, and JNK activation, at least in thymocytes.

The defective T cell development in Tak1D mice results in a significant decrease of mature T cells in the peripheral tissues. In fact, when T cells isolated from the lymph nodes of Tak1D mice were analyzed, they were found to express TAK1 and lack the expression of Cre (Fig. 1 D), implying that only T cells that escape from Cre-mediated excision were able to emigrate from the thymus and populate the peripheral tissues. The requirement of TAK1 for the development of mature T cells precludes the analysis of the role of TAK1 in the activation of these cells. Conditional deletion of TAK1 specifically in mature T cells, such as the use of a tamoxifen-inducible Cre, will be required to examine the function of TAK1 in these cells.

In sum, our results provide the genetic evidence that TAK1 is required for the activation of IKK, NF-κB, and JNK in mouse thymocytes and that TAK1 plays an essential role in thymocyte development and activation. These results extend the pivotal role of TAK1 in the innate immune system to the adaptive immune system.

Materials and Methods

Gene Targeting and Genotyping of Mice.

AB2.2 mouse ES cells were targeted by a construct containing one loxP site before the transcription initiation site of Tak1 and the other loxP site in intron 1. The targeting construct also contained a FRT-neo-FRT selection cassette before the intronic loxP site. The 5′ and 3′ homologous regions spanned 2.5 and 3.0 kb, respectively. Targeted ES cells were screened by Southern blotting with both 5′ and 3′ probes (Fig. 1) after digestion with EcoRV and NheI, respectively. Blastocyst injection was performed at Baylor College of Medicine. Lck-Cre transgenic mice were obtained from The Jackson Laboratory (21). Floxed Tak1 mice were crossed to Lck-Cre mice at University of Texas Southwestern Medical Center. Mice were genotyped by PCR using the following primer pairs: GCACAGAAAATGCACAGTGCTC and GCTTGGGACAGGCTGGTAAAG (for the wild-type allele), GCACAGAAAATGCACAGTGCTC and CTTACAAGCCGAATTCCAGCA (for the floxed allele), and GCACAGAAAATGCACAGTGCTC and CTCCTCCACTCCGCCCCTAC (for the excised allele). The PCR conditions were 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min; 35 cycles. The mice used in this study were 5–10 weeks old. All mice were housed in conventional animal facilities at University of Texas Southwestern Medical Center or Baylor College of Medicine.

FACS.

Spleens, thymi, and lymph nodes were mechanically disrupted by a syringe pump and filtered through cell strainers (100 μm; BD Biosciences) to obtain suspension cells. Blood cells were isolated by following the online protocol at The Jackson Laboratory (www.jax.org/imr/facs.html), except FACS buffer was replaced by 5% FBS in PBS. Cells were stained with a monoclonal antibody for 15 min on ice and washed once before FACS analysis. In the event when staining with a secondary antibody was required, cells were stained with the antibody for another 15 min on ice, followed by another wash step. Data were collected by FACSCalibur or FACScan (Becton Dickinson) flow cytometers and analyzed by using CellQuest software. Primary antibodies against B220 (RA3-6B2), CD3 (17A2), CD24 (M1/69), CD4 (GK1.5), CD8a (53-6.7), and CD69 (H1.2F3) were from BD Biosciences; these antibodies are conjugated with different markers, such as FITC, phycoerythrin (PE), allophycocyanin (APC), or biotin. Streptavidin coupled to peridinin chlorophyll protein (BD Biosciences) was used as a secondary antibody.

Isolation and Purification of Thymocytes and Lymph Node T Cells.

CD4+ SP and CD4+CD8+ DP thymocytes were directly sorted by FACSVantage SE (with DIVA upgrade) after CD4 and CD8 staining. CD8+ SP thymocytes were purified by depleting CD4+ cells with a magnetic column, followed by FACS sorting for CD8+ cells. Briefly, thymocytes were incubated with anti-CD4-PE and anti-PE magnetic beads (Miltenyi Biotec) before applying to a magnetic column. The unbound materials were incubated with anti-CD8a-FITC and then sorted for the CD8+ SP thymocytes by FACS. The purity of the sorted cells was at least 95%. Lymph node T cells were purified by using a Pan T Cell Isolation kit (Miltenyi Biotec) from a pool of popliteal, axillary, and mesentery lymph nodes. The purity of the sorted CD3+ cells was at least 96%.

Annexin-V Cell Death Assay.

Purified thymocytes at various stages were pelleted and resuspended in complete media (RPMI medium 1640, 10% FBS, penicillin/streptomycin, and 50 μM β-mercaptoethanol) at a density of 5 × 105 per ml. Aliquots of the cells (5 × 104 cells per well) were grown in 96-well plates precoated with either PBS or 10 μg/ml anti-CD3ε (145-2C11; BD Biosciences). At indicated times, cells were incubated with Annexin-V-APC (BD Biosciences) in staining buffer (10 mM Hepes, pH 7.4, 140 mM NaCl, and 2.5 mM CaCl2) for 15 min at room temperature and analyzed by FACS. At least 4,000 events were recorded for each sample.

Biochemical Analyses.

Immunoblotting was carried out by using standard procedures. In Fig. 1 D, cells (1.6 × 106) were lysed directly in SDS sample buffer supplemented with 25 units of Benzonase (Novagen), which digests genomic DNA to reduce viscosity. After incubation at 4°C for 30 min, the samples were boiled and subjected to SDS/PAGE and Western transfer. In Fig. 5 B and C, cells were lysed in 200 μl of kinase assay buffer per 107 cells [20 mM Tris·HCl, pH 7.5, 100 mM NaCl, 25 mM β-glycerophosphate, 1 mM sodium vanadate, 10% glycerol, 0.02% Nonidet P-40, and proteinase inhibitor (Roche)]. The antibodies against phospho-ERK and JNK were from Cell Signaling Technology, and the antibody against phospho-JNK was from BioSource International, Camarillo, CA. Antibodies for TAK1 (M579), Iκ Bα (C21), and NEMO (FL-419) were from Santa Cruz Biotechnology. Antibodies for tubulin and Cre were from Sigma and Novagen, respectively.

For EMSA, whole-cell extracts [3–4 μg of protein in 20 mM Tris, pH 7.5, 10% glycerol, 0.4 M KCl, 1 mM DTT, 1 mM EDTA, 0.1% Nonidet P-40, and proteinase inhibitor (Roche)] were incubated with radiolabeled DNA probes containing the consensus NF-κB- or Oct-1-binding sites (Promega). After incubation at room temperature for 15 min, the DNA–protein complexes were resolved by electrophoresis on 5% polyacrylamide gel and analyzed by PhosphorImaging.

For NF-κB and JNK activity assays, thymocytes were prepared at a density of 2 × 107 per ml in complete media (RPMI medium 1640, 10% FBS, penicillin/streptomycin, and 50 μM β-mercaptoethanol) and stimulated with phorbol 12-myristate 13-acetate (100 ng/ml) and ionomycin (200 ng/ml) or mouse TNFα (25 ng/ml; Chemicon) for the indicated time periods. The IKK kinase assay was carried out as described (11). For plate-bound anti-CD3ε stimulation, 106 per 100 μl thymocytes in complete media were stimulated for 16 h at 37°C in 96-well plates that had been coated by either PBS or 10 μg/ml anti-CD3ε.

Real-Time PCR.

Thymocytes were stimulated with anti-CD3ε for 20 h as described above, and total RNA was extracted by using the Qiagen RNeasy Mini kit. First-strand cDNA was synthesized by using SuperScript III SuperMix for quantitative RT-PCR (Invitrogen). Real-time PCR was performed in duplicates in the iQ5 multicolor detection system using SYBR green supermix (Bio-Rad). c-myc primers were GCCCAAATCCTGTACCTCGTC and TGCCTCTTCTCCACAGACACC. β-actin primers were TGACGTTGACATCCGTAAAGACC and AAGGGTGTAAAACGCAGCTCA. The PCR conditions were 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s; 40 cycles. The expression of c-myc was normalized by using β-actin as an internal control.

Statistics and Graph Preparation.

Student’s t tests were used for statistical analysis. Data are presented as average ± SE. Graphs, except FACS analyses, were prepared by using the programs gnuplot (www.gnuplot.info), Adobe Photoshop, or Microsoft Excel.

Acknowledgments

We thank Gabriel Pineda for help with the IKK kinase assay. This work was supported by National Institutes of Health Grant R01-AI60919, American Cancer Society Grant RSG0219501TBE, and Welch Foundation Grant I-1389. Z.J.C. is an Investigator of the Howard Hughes Medical Institute and a Burroughs Wellcome Fund Investigator in Pathogenesis of Infectious Diseases.

Footnotes

  • §To whom correspondence should be addressed. E-mail: zhijian.chen{at}utsouthwestern.edu

  • Author contributions: H.-H.L. and Z.J.C. designed research; H.-H.L. performed research; M.X. and M.D.S. contributed new reagents/analytic tools; H.-H.L. and Z.J.C. analyzed data; and H.-H.L. and Z.J.C. wrote the paper.

  • Conflict of interest statement: No conflicts declared.

  • This paper was submitted directly (Track II) to the PNAS office.

  • Abbreviations:
    DN,
    double-negative;
    DP,
    double-positive;
    IKK,
    IκB kinase;
    SP,
    single-positive;
    TCR,
    T cell receptor.
Back to top
Article Alerts
Email Article
Citation Tools
Request Permissions
Essential role of TAK1 in thymocyte development and activation
Hong-Hsing Liu, Min Xie, Michael D. Schneider, Zhijian J. Chen
Proceedings of the National Academy of Sciences Aug 2006, 103 (31) 11677-11682; DOI: 10.1073/pnas.0603089103
Digg logo Reddit logo Twitter logo Facebook logo Google logo Mendeley logo
Proceedings of the National Academy of Sciences: 103 (31)
Table of Contents

Submit

Jump to section

You May Also be Interested in

Multi-color molecular model
Enzymatic breakdown of PET plastic
A study demonstrates how two enzymes—MHETase and PETase—work synergistically to depolymerize the plastic pollutant PET.
Image credit: Aaron McGeehan (artist).

Similar Articles