Suicidal [PSI+] is a lethal yeast prion

Ryan P. McGlinchey; Dmitry Kryndushkin; Reed B. Wickner

doi:10.1073/pnas.1102762108

Contributed by Reed B. Wickner, February 17, 2011 (sent for review January 28, 2011)

Abstract

[PSI⁺] is a prion of the essential translation termination factor Sup35p. Although mammalian prion infections are uniformly fatal, commonly studied [PSI⁺] variants do not impair growth, leading to suggestions that [PSI⁺] may protect against stress conditions. We report here that over half of [PSI⁺] variants are sick or lethal. These “killer [PSI⁺]s” are compatible with cell growth only when also expressing minimal Sup35C, lacking the N-terminal prion domain. The severe detriment of killer [PSI⁺] results in rapid selection of nonkiller [PSI⁺] variants or loss of the prion. We also report variants of [URE3], a prion of the nitrogen regulation protein Ure2p, that grow much slower than ure2Δ cells. Our findings give a more realistic picture of the impact of the prion change than does focus on “mild” prion variants.

Although mammalian prions cause a devastating and uniformly fatal spongiform encephalopathy (reviewed in ref. 1), yeast and fungal prions, as described so far, are compatible with indefinite growth, often at normal or near-normal rates. This apparent contrast has led to proposals that the yeast and fungal prions may benefit their hosts, even though prion formation may decrease the activity of the protein as a result of the aggregate/amyloid formation that is the prion change. The [Het-s] prion of Podospora anserina is necessary for proper heterokaryon incompatibility of het-s with het-S strains (2), so it was proposed that this is a prion benefiting the host (3). However, [Het-s] is also part of a meiotic drive system, promoting inheritance of het-s by cheating on meiosis (4), so the beneficial prion suggestion may be wrong. [PSI⁺] is an amyloid prion of the Saccharomyces cerevisiae Sup35p (5–7), and was suggested to protect against stress (8) or to promote evolution by protecting against stress (9). All these tests of stress resistance were done using the usual [PSI⁺] variants, which were selected to be compatible with vigorous cell growth (10).

Sup35p is an essential subunit, with Sup45p, of the translation termination factor. Like the mammalian prion “strains” (11, 12), [PSI⁺] has “variants,” several different stably propagated biologically and structurally different forms of the same prion protein (13, 14). In the usual [PSI⁺] variants, much of the Sup35p is tied up in amyloid filaments and is unavailable for translation termination, but enough is free to keep the cells alive. The shortage of Sup35p increases the misreading of nonsense codons, which provides the basis for the genetic assay of [PSI⁺].

Ure2p is a regulator of nitrogen catabolism that can convert to an amyloid prion called [URE3] (5, 15, 16). Variants of [URE3] have also been described (16, 17).

Here, we show that more than half of [PSI⁺] variants are lethal or highly pathogenic, unlike the variants usually studied. Similarly, we describe abundant [URE3] variants that slow cell growth dramatically in a background in which deletion of the URE2 gene has no effect on growth. These results show that acquisition of a yeast prion may be disastrous for yeast.

Results

Sup35p has two domains, the N-terminal (NM) domain, which is necessary and sufficient for prion formation (and has physiological function as well, as discussed below) but is dispensable for growth, and the C-terminal C domain, which is essential for translation termination, and can perform this function without the NM domain. In [PSI⁺] cells, most of the Sup35p is in filaments, and is inactive. Readthrough of premature termination codons in ade1-14 or ade2-1 is then sufficiently frequent that the cells are Ade⁺ (grow without adenine and are white) instead of Ade⁻ (and red). A [PSI⁺] variant that efficiently inactivated all Sup35p (“killer [PSI⁺]”) would be lethal. As a permissive condition for killer [PSI⁺], we express a full-length chromosomal SUP35 gene, and, on a plasmid, SUP35C encoding only the essential part but lacking the NM prion domain. This truncated Sup35C cannot be converted to the [PSI⁺] prion form because it lacks the N domain that is essential for prion formation (18) and forms the core of the in-register parallel β-sheet amyloid structure that constitutes the prion form (19, 20). To detect killer [PSI⁺], the plasmid-borne SUP35C must be expressed only enough to keep cells alive but not enough for efficient termination, which would make them Ade⁻ (Fig. S1). With a tetracycline-repressible promoter (Ptet^rep) (21), 10 μg/mL doxycycline sufficiently repressed the plasmid-encoded Sup35C expression that cells lacking a chromosomal SUP35 were Ade⁺ (white) but could grow slowly (Fig. S2). Doxycycline at these levels does not detectably slow growth of normal cells. The tet^rep-SUP35C gene was on a URA3 CEN (centromere-containing) vector whose loss could be selected by growth on plates with 5-fluorouracil (FOA; kills URA3 cells but not ura3 mutants) (22).

Using strains 74-D694 or GT159 carrying P_GAL1-SUP35NM and URA3 Ptet^rep-SUP35C plasmids, we induced [PSI⁺] formation by overexpression of Sup35NM on galactose media and selected Ade⁺ clones on plates with 10 μg/mL doxycycline. Artificially overproducing Sup35NM (the prion domain) can produce lethality because all Sup35p is drawn into the filaments (23); thus, we repressed expression of Sup35NM by over 30 generations of growth on glucose to dilute out the Sup35NM before looking for colonies that grew poorly or not at all on FOA medium (loss of Sup35C).

We found that of 313 Ade⁺ guanidine-curable clones from 74-D694, 144 showed slow growth on FOA (“sick [PSI⁺]”) and 24 did not grow at all (killer [PSI⁺]) (Fig. 1). Similar proportions of sick and killer [PSI⁺] were isolated from strain GT159 (Fig. S3). Cells with killer [PSI⁺] grew very poorly after several days on ½YPD containing 10 μg/mL doxycycline, confirming that failure to grow on FOA is attributable to lack of Sup35C (Fig. 2A) and not, for example, a variant that never loses the URA3 plasmid. Most of the colonies that did grow were pink/red and proved to have lost [PSI⁺]. On ½YPD lacking doxycycline, killer [PSI⁺] cells were red and grew well because of an abundant supply of Sup35C (Fig. 2B).

Fig. 1.

Screening of Ade⁺ colonies for killer [PSI⁺]. Isolated Ade⁺ colonies were restreaked three times on −Ade −Ura + 10 μg/mL doxycycline before being stamped on FOA. Circled colonies have killer [PSI⁺]. The fractions of isolates with mild, sick, and killer [PSI⁺] are shown below.

Fig. 2.

Killer [PSI⁺] strains are sick because of Sup35p deficiency. Cells carrying killer [PSI⁺], a nontoxic [PSI⁺], and a [psi⁻] control were streaked on ½YPD with (A) or without (B) doxycycline (10 μg/mL).

The instability of sick and killer [PSI⁺] is shown in Fig. 3. [PSI⁺] isolates were streaked on both FOA (Fig. 3A, Left) and ½YPD without doxycycline (Fig. 3A, Center). After several days on ½YPD, sick and killer cells grew more normally when streaked to FOA (Fig. 3A, Right), showing that toxic [PSI⁺] variants are not stable, even in the presence of excess Sup35C. This suggests that toxicity is not limited to undersupply of active Sup35p and/or that the toxic [PSI⁺] variants are inherently unstable. Streaking sick [PSI⁺] isolates on ½YPD after selection on FOA showed a mixture of small white (Ade⁺ Ura⁻) and large pink/red (Ade⁻ Ura⁻) colonies (Fig. 3B, Upper). These small, white, poorly growing colonies, on restreaking on ½YPD, formed a mixture of small and larger white Ade⁺ colonies and pink/red Ade⁻ colonies, with the latter having lost [PSI⁺] (Fig. 3B, Lower). Thus, selection for prion loss or alteration attributable to prion toxicity, and likely inherent prion instability, makes isolation of stable killer [PSI⁺] apparently impossible.

Fig. 3.

Toxicity and instability of [PSI⁺] isolates. (A) Sick and killer [PSI⁺] candidates were streaked on ½YPD and on FOA plates. After 2 d of growth on ½YPD, strains were restreaked on FOA plates. (B–D) Individual sick [PSI⁺] and nontoxic [PSI⁺] colonies were streaked on ½YPD from FOA. (Lower) Single colonies restreaked on ½YPD are indicated.

Growth of sick [PSI⁺] isolates with 3 mM guanidine (which cures [PSI⁺]) (24) cured the prion, as shown by cells becoming Ade⁻ on the −Ade −Ura + 10 μg/mL doxycycline plates. Once cured of killer [PSI⁺], these cells could grow well on FOA plates or on ½YPD with doxycycline, similar to those shown in Fig. 3A. This shows that the toxicity is indeed attributable to a variant of [PSI⁺]. Transformation of presumed [PSI⁺] cells with a plasmid expressing Sup35NM-GFP confirmed the presence of prion aggregates (Fig. 4). An apparent correlation between [PSI⁺] toxicity and the number of Sup35NM-GFP aggregates was noted (Fig. 4), but the instability of the killer [PSI⁺] makes this conclusion tentative.

Fig. 4.

Multiple Sup35NM-GFP foci for killer [PSI⁺] and single foci for benign [PSI⁺]. (A) Newly induced 74-D694 [PSI⁺] colonies that could not grow on FOA plates (killer [PSI⁺]) were transformed with the pSupNM-GFP plasmid directly from −Ade −Ura + doxycycline plates. Transformants were selected only for the presence of pSupNM-GFP and were highly heterogeneous by color. White and sectoring transformants appeared as a result of the loss of the Sup35C plasmid, and their [PSI⁺] has become benign. Red transformants still carry the Sup35C-expressing plasmid and contained [PSI⁺] (probably killer [PSI⁺]), as was shown by fluorescent microscopy analysis. (B and C) Red transformants from A of two independent killer [PSI⁺] variants contain [PSI⁺] and show cells with multiple Sup35NM-GFP foci. (D) Typical white transformants from A and benign 74-D694 [PSI⁺] isolates show cells with mostly single Sup35NM-GFP foci. Six benign [PSI⁺] and four killer [PSI⁺] isolates were transformed as described in A. Transformants of both [PSI⁺] types that tend to retain the Sup35C plasmid were compared, and about 2,000 individual cells containing [PSI⁺] were analyzed for the presence of multiple Sup35NM-GFP foci per cell by fluorescent microscopy analysis. About 50% of putative killer [PSI⁺] cells had multiple foci, compared with only about 10% of benign [PSI⁺] cells under these conditions.

Cytoduction (cytoplasmic transfer) of killer [PSI⁺] into a strain not expressing Sup35C is expected to be lethal. In fact, “nontoxic [PSI⁺]” and sick [PSI⁺] produced [PSI⁺] cytoductants, whereas their guanidine-cured derivatives produced mostly [psi-] cytoductants (Table S1). The killer [PSI⁺] donors were clearly unstable, with the prion being lost or changing to a mild form (Table S1).

In contrast to [PSI⁺], toxicity associated with the [URE3] prion (of Ure2p) can be observed directly on isolation of spontaneous prion clones. Strain BY241 [ure-o] [PIN⁺] carries ADE2 under control of the DAL5 promoter to monitor activity of Ure2p, thus allowing detection of the prion state based on the color of yeast colonies (16). Strain BY241 was transformed with the LEU2 centromeric plasmid pVTG12 expressing Ure2N-GFP (a fusion of the Ure2p prion domain with GFP) under control of the native URE2 promoter. Low-level expression of Ure2N-GFP does not induce or cure [URE3] (25) but does allow distinguishing true prion isolates from chromosomal mutants by the colocalization of Ure2N-GFP with Ure2p prion aggregates, forming fluorescent foci in [URE3] cells. Strain BY241/pVTG12 spread on −Ade −Leu plates was grown for 5 d at 30 °C. Colonies were analyzed for the presence of [URE3] prion by fluorescent microscopy and by curing on medium with 5 mM GuHCl. Confirmed [URE3] isolates were then streaked on ½YPD for growth comparison, together with the same strain before prion induction (Fig. 5). Surprisingly, most spontaneous [URE3] variants were strikingly smaller compared with the parent strain, with colonies that lost [URE3], or with the parent strain with its URE2 gene deleted (Fig. 5). This shows that the markedly slow growth of these [URE3] variants is not a result of functional inactivation of Ure2p but, rather, was attributable to some toxic action of the prion form. These slow-growing prion variants were all unstable, producing subclones that had lost the prion as well as less toxic variants (Fig. 5 G and H), perhaps as a result of selection for loss of toxicity.

Fig. 5.

Spontaneously formed [URE3] clones with dramatically slowed growth and mitotic instability. BY241 (A), BY241 Δure2::TRP1 (B), BY241 individual spontaneously formed [URE3] colonies (C–F), and second streaks of small BY241 [URE3] colonies (G and H) from E and F. All strains were grown on ½YPD for 3 d before the pictures were taken.

Discussion

We constructed a screen to detect lethal variants of [PSI⁺] specifically avoiding the overexpression of Sup35p. [PSI⁺] is known to be lethal in cells overexpressing full-length Sup35p or Sup35NM (the prion domain) (13, 26). In [PSI⁺] cells overexpressing full-length Sup35p, most of the other translation termination factor subunit, Sup45p, is drawn into the aggregates because it interacts with the nonamyloid part of Sup35p, the C-terminal domain. If Sup35NM is overexpressed, the normal (lower) amount of full-length Sup35p is entirely drawn into the amyloid filaments and the cells suffer or die (23). Our screen was specifically designed to avoid these artificial situations to determine if there were lethal variants of [PSI⁺] at normal Sup35p expression levels. Full-length Sup35p was expressed from the chromosome with the normal SUP35 promoter and context. Sup35NM was overproduced from a GAL1 promoter to induce the appearance of [PSI⁺] at high frequency, but cells grew on dextrose, repressing the GAL1 promoter, for over 30 generations before they were tested for requiring the Sup35C expressed from the tet promoter. Thus, little or no Sup35NM was expressed, and full-length Sup35p was just normally expressed at the point that lethality was observed.

Our screen for killer [PSI⁺] was specifically designed to detect one kind of toxicity, namely, that attributable to sequestration of nearly all the Sup35p in the amyloid filaments so that translation termination is unduly impaired. The fact that expression of Sup35C allows the killer [PSI⁺] cells to grow indicates that limitation of translation termination is at least part of the toxicity. It is possible, however, that there exist other [PSI⁺] variants with toxicity on another basis, and therefore not detected in our screen. Part of the killer [PSI⁺] toxicity may be attributable to adsorption of another protein by the Sup35p amyloid. Mild [PSI⁺] amyloid is known to adsorb Hsp70s and other chaperones (27).

Our finding that more than half of [PSI⁺] variants are sick or lethal highlights the danger to the cell of acquisition of a prion. Although [PSI⁺] has been reported to be advantageous under certain growth conditions (8, 9), reproducing these results has been problematic (28). Moreover, the absence of [PSI⁺] in wild strains (29–31) shows that it is not advantageous overall. Because the Sup35 prion domain in yeast and the corresponding N-terminal part of human Sup35p are important for normal mRNA degradation (32, 33) and another function (34), it is likely conserved for these purposes and prion formation in yeast may be viewed as a rare molecular degenerative disease. Moreover, yeast cells apparently view [PSI⁺] and [URE3] as stress conditions, because they induce heat-shock proteins when infected (35, 36).

Why is [PSI⁺] usually nontoxic in laboratory strains? First, the most toxic variants would not be recovered without a special selection scheme. Second, the toxicity of these killer variants (and their possible inherent instability) results in frequent selection of more benign variants and cells that have lost the prion.

We find that [URE3] can dramatically slow cell growth in a strain whose growth is not slowed by deletion of the URE2 gene. [URE3] has also been suggested to be an advantage to yeast (37). [URE3] is also not found in wild strains (31), however, and the Ure2p prion domain is important for Ure2p function in stabilizing the protein against degradation in vivo (38). Taken together with our work, these results show that [URE3] is also a rare molecular degenerative disease.

There may be prions that are beneficial to yeast or other organisms, as we first suggested for [Het-s] (3). There may indeed be variants of [PSI⁺] or [URE3] that aid yeast in some way. Such variants should be found in the wild under the condition in which they are a benefit (39). Our findings also raise the question of whether there are benign variants of the mammalian prion disease.

Methods

Strains and Media.

Strains 74-D694 (MATa ade1-14 ura3-52 leu2-2 his3-200 trp1-289 [psi⁻] [PIN⁺]) and GT159 (MATa ade1-14 his3-Δ200 leu2-3,112 lys2 trp1−Δ ura2-52 [psi⁻] [PIN⁺]), carrying pH952 (CEN TRP1 P_GAL1-SUP35NM) and pRPM02 (CEN URA3 Ptet^rep-SUP35C), were used for selecting killer [PSI⁺] and sick [PSI⁺] variants. Strain 4755 (MATα lys2 leu2 ura3 kar1 ade2-1 SUQ5 ρ^o [psi⁻]) was used as a cytoduction recipient. BY241 (MATa leu2 trp1 ura3 P_DAL5ADE2 P_DAL5CAN1 kar1) was used for studies of [URE3].

Synthetic dextrose (SD) medium contains 6.7 g/L Yeast Nitrogen Base without amino acids (Difco), 20 g/L dextrose, and 20 g/L agar. Adenine-limiting medium (½YPD) has 0.5 g/L yeast extract, 20 g/L peptone, 20 g/L dextrose and 20 g/L agar. Plates for selection were SD plates to which were added the strain’s other required components (e.g., amino acids). FOA plates were prepared as described (40). Prion curing was carried out by streaking to single colonies on rich plates containing 3 mM guanidine HCl.

Construction of Plasmids.

Sup35C was amplified using oligos forward (5′ GGGGGATCCAACAATGTTTGGTGGTAAAGATCACG 3′) and reverse (5′ GGGGTTTAAACTTTACTCGGCAATTTTAACAATTTTAC 3′), cut with BamHI and PmeI, and inserted into pCM189 (21) cut with the same enzymes. This CEN URA3 plasmid (pRPM02) has the structure: tet^rep promoter-BamHI-ATG-SUP35C-ter-PmeI. The CEN TRP2 plasmid pH952 contains SUP35NM under the control of a GAL promoter (gift from Herman Edskes, National Institutes of Health, Bethesda, MD). For detection of prion aggregates in vivo, centromeric plasmids pVTG12 expressing Ure2N-GFP fusion under control of the native URE2 promoter (25) and pH126 Sup35NM-GFP (31) were used.

Induction of [PSI⁺] Formation.

Strain 74-D694 or strain GT159 was transformed with pRPM02 and pH952 and selected on −Ura −Trp media. Induction was performed in liquid media containing 2% (wt/vol) galactose and 1% raffinose and grown for 2–3 d. Cells (∼10⁶) were plated on synthetic complete −Ade −Ura + 10 μg/mL doxycycline. Ade⁺ colonies appearing after 5 d were restreaked on the same media and left to grow for 4 d. Colonies were streaked or replica-plated to FOA and incubated for 3–4 d.

Aggregation of Sup35NM and Ure2N Fusion Proteins.

Several clones containing killer [PSI⁺] or “benign [PSI⁺]” were transformed with centromeric pSup35NM-GFP directly from selection plates (−Ade −Ura + doxycycline). The transformants on the selection plate (−Leu with limiting adenine) were very heterogeneous by color as a result of partial loss of the Sup35C plasmid. White and red transformants were compared by fluorescent microscopy analysis.

Cytoduction.

Transfer of [PSI⁺] by cytoplasmic mixing was carried out as previously described (41). Donor and recipient cells were mixed and grown on yeast extract-peptone-adenine-dextrose agar at 30 °C for 7 h. The incubated mixture was then streaked on media selecting against the donor.

Acknowledgments

We thank Herman Edskes for pH952, our colleagues for critical reading of the manuscript, and Frank Shewmaker for fruitful discussions. This work was supported by the Intramural Program of the National Institute of Diabetes Digestive and Kidney Diseases.

Footnotes

↵¹To whom correspondence should be addressed. E-mail: wickner{at}helix.nih.gov.

Author contributions: R.P.M., D.K., and R.B.W. designed research, performed research, contributed new reagents/analytic tools, and wrote the paper.
The authors declare no conflict of interest.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1102762108/-/DCSupplemental.

References

↵
1. Aguzzi A,
2. Baumann F,
3. Bremer J
(2008) The prion’s elusive reason for being. Annu Rev Neurosci 31:439–477.
OpenUrl CrossRef PubMed
↵
1. Coustou V,
2. Deleu C,
3. Saupe S,
4. Begueret J
(1997) The protein product of the het-s heterokaryon incompatibility gene of the fungus Podospora anserina behaves as a prion analog. Proc Natl Acad Sci USA 94:9773–9778.
OpenUrl Abstract/FREE Full Text
↵
1. Wickner RB
(1997) A new prion controls fungal cell fusion incompatibility. Proc Natl Acad Sci USA 94:10012–10014.
OpenUrl FREE Full Text
↵
1. Dalstra HJP,
2. Swart K,
3. Debets AJM,
4. Saupe SJ,
5. Hoekstra RF
(2003) Sexual transmission of the [Het-S] prion leads to meiotic drive in Podospora anserina. Proc Natl Acad Sci USA 100:6616–6621.
OpenUrl Abstract/FREE Full Text
↵
1. Wickner RB
(1994) [URE3] as an altered URE2 protein: Evidence for a prion analog in Saccharomyces cerevisiae. Science 264:566–569.
OpenUrl Abstract/FREE Full Text
↵
1. Tanaka M,
2. Chien P,
3. Naber N,
4. Cooke R,
5. Weissman JS
(2004) Conformational variations in an infectious protein determine prion strain differences. Nature 428:323–328.
OpenUrl CrossRef PubMed
↵
1. King CY,
2. Diaz-Avalos R
(2004) Protein-only transmission of three yeast prion strains. Nature 428:319–323.
OpenUrl CrossRef PubMed
↵
1. Eaglestone SS,
2. Cox BS,
3. Tuite MF
(1999) Translation termination efficiency can be regulated in Saccharomyces cerevisiae by environmental stress through a prion-mediated mechanism. EMBO J 18:1974–1981.
OpenUrl CrossRef PubMed
↵
1. True HL,
2. Lindquist SL
(2000) A yeast prion provides a mechanism for genetic variation and phenotypic diversity. Nature 407:477–483.
OpenUrl CrossRef PubMed
↵
1. Cox BS
(1965) PSI, a cytoplasmic suppressor of super-suppressor in yeast. Heredity 20:505–521.
OpenUrl CrossRef
↵
1. Bruce ME,
2. Fraser H
(1991) Scrapie strain variation and its implications. Curr Top Microbiol Immunol 172:125–138.
OpenUrl PubMed
↵
1. Bessen RA,
2. Marsh RF
(1994) Distinct PrP properties suggest the molecular basis of strain variation in transmissible mink encephalopathy. J Virol 68:7859–7868.
OpenUrl Abstract/FREE Full Text
↵
1. Derkatch IL,
2. Chernoff YO,
3. Kushnirov VV,
4. Inge-Vechtomov SG,
5. Liebman SW
(1996) Genesis and variability of [PSI] prion factors in Saccharomyces cerevisiae. Genetics 144:1375–1386.
OpenUrl PubMed
↵
1. Toyama BH,
2. Kelly MJ,
3. Gross JD,
4. Weissman JS
(2007) The structural basis of yeast prion strain variants. Nature 449:233–237.
OpenUrl CrossRef PubMed
↵
1. Masison DC,
2. Wickner RB
(1995) Prion-inducing domain of yeast Ure2p and protease resistance of Ure2p in prion-containing cells. Science 270:93–95.
OpenUrl Abstract/FREE Full Text
↵
1. Brachmann A,
2. Baxa U,
3. Wickner RB
(2005) Prion generation in vitro: Amyloid of Ure2p is infectious. EMBO J 24:3082–3092.
OpenUrl CrossRef PubMed
↵
1. Schlumpberger M,
2. Prusiner SB,
3. Herskowitz I
(2001) Induction of distinct [URE3] yeast prion strains. Mol Cell Biol 21:7035–7046.
OpenUrl Abstract/FREE Full Text
↵
1. Ter-Avanesyan MD,
2. Dagkesamanskaya AR,
3. Kushnirov VV,
4. Smirnov VN
(1994) The SUP35 omnipotent suppressor gene is involved in the maintenance of the non-Mendelian determinant [psi+] in the yeast Saccharomyces cerevisiae. Genetics 137:671–676.
OpenUrl PubMed
↵
1. King C-Y,
2. et al.
(1997) Prion-inducing domain 2-114 of yeast Sup35 protein transforms in vitro into amyloid-like filaments. Proc Natl Acad Sci USA 94:6618–6622.
OpenUrl Abstract/FREE Full Text
↵
1. Shewmaker F,
2. Wickner RB,
3. Tycko R
(2006) Amyloid of the prion domain of Sup35p has an in-register parallel β-sheet structure. Proc Natl Acad Sci USA 103:19754–19759.
OpenUrl Abstract/FREE Full Text
↵
1. Garí E,
2. Piedrafita L,
3. Aldea M,
4. Herrero E
(1997) A set of vectors with a tetracycline-regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae. Yeast 13:837–848.
OpenUrl CrossRef PubMed
↵
1. Boeke JD,
2. LaCroute F,
3. Fink GR
(1984) A positive selection for mutants lacking orotidine-5′-phosphate decarboxylase activity in yeast: 5-Fluoro-orotic acid resistance. Mol Gen Genet 197:345–346.
OpenUrl CrossRef PubMed
↵
1. Vishveshwara N,
2. Bradley ME,
3. Liebman SW
(2009) Sequestration of essential proteins causes prion associated toxicity in yeast. Mol Microbiol 73:1101–1114.
OpenUrl CrossRef PubMed
↵
1. Tuite MF,
2. Mundy CR,
3. Cox BS
(1981) Agents that cause a high frequency of genetic change from [psi+] to [psi−] in Saccharomyces cerevisiae. Genetics 98:691–711.
OpenUrl PubMed
↵
1. Edskes HK,
2. Gray VT,
3. Wickner RB
(1999) The [URE3] prion is an aggregated form of Ure2p that can be cured by overexpression of Ure2p fragments. Proc Natl Acad Sci USA 96:1498–1503.
OpenUrl Abstract/FREE Full Text
↵
1. Dagkesamanskaya AR,
2. Ter-Avanesyan MD
(1991) Interaction of the yeast omnipotent suppressors SUP1(SUP45) and SUP2(SUP35) with non-mendelian factors. Genetics 128:513–520.
OpenUrl PubMed
↵
1. Bagriantsev SN,
2. Gracheva EO,
3. Richmond JE,
4. Liebman SW
(2008) Variant-specific [PSI+] infection is transmitted by Sup35 polymers within [PSI+] aggregates with heterogeneous protein composition. Mol Biol Cell 19:2433–2443.
OpenUrl Abstract/FREE Full Text
↵
1. Namy O,
2. et al.
(2008) Epigenetic control of polyamines by the prion [PSI+] Nat Cell Biol 10:1069–1075.
OpenUrl CrossRef PubMed
↵
1. Chernoff YO,
2. et al.
(2000) Evolutionary conservation of prion-forming abilities of the yeast Sup35 protein. Mol Microbiol 35:865–876.
OpenUrl CrossRef PubMed
↵
1. Resende CG,
2. Outeiro TF,
3. Sands L,
4. Lindquist S,
5. Tuite MF
(2003) Prion protein gene polymorphisms in Saccharomyces cerevisiae. Mol Microbiol 49:1005–1017.
OpenUrl CrossRef PubMed
↵
1. Nakayashiki T,
2. Kurtzman CP,
3. Edskes HK,
4. Wickner RB
(2005) Yeast prions [URE3] and [PSI⁺] are diseases. Proc Natl Acad Sci USA 102:10575–10580.
OpenUrl Abstract/FREE Full Text
↵
1. Hoshino S,
2. Imai M,
3. Kobayashi T,
4. Uchida N,
5. Katada T
(1999) The eukaryotic polypeptide chain releasing factor (eRF3/GSPT) carrying the translation termination signal to the 3′-Poly(A) tail of mRNA. Direct association of erf3/GSPT with polyadenylate-binding protein. J Biol Chem 274:16677–16680.
OpenUrl Abstract/FREE Full Text
↵
1. Hosoda N,
2. et al.
(2003) Translation termination factor eRF3 mediates mRNA decay through the regulation of deadenylation. J Biol Chem 278:38287–38291.
OpenUrl Abstract/FREE Full Text
↵
1. Urakov VN,
2. et al.
(2006) N-terminal region of Saccharomyces cerevisiae eRF3 is essential for the functioning of the eRF1/eRF3 complex beyond translation termination. BMC Mol Biol 7:34–46.
OpenUrl CrossRef PubMed
↵
1. Jung G,
2. Jones G,
3. Wegrzyn RD,
4. Masison DC
(2000) A role for cytosolic hsp70 in yeast [PSI(+)] prion propagation and [PSI(+)] as a cellular stress. Genetics 156:559–570.
OpenUrl PubMed
↵
1. Schwimmer C,
2. Masison DC
(2002) Antagonistic interactions between yeast [PSI(+)] and [URE3] prions and curing of [URE3] by Hsp70 protein chaperone Ssa1p but not by Ssa2p. Mol Cell Biol 22:3590–3598.
OpenUrl Abstract/FREE Full Text
↵
1. Shorter J,
2. Lindquist S
(2005) Prions as adaptive conduits of memory and inheritance. Nat Rev Genet 6:435–450.
OpenUrl PubMed
↵
1. Shewmaker F,
2. Mull L,
3. Nakayashiki T,
4. Masison DC,
5. Wickner RB
(2007) Ure2p function is enhanced by its prion domain in Saccharomyces cerevisiae. Genetics 176:1557–1565.
OpenUrl CrossRef PubMed
↵
1. Partridge L,
2. Barton NH
(2000) Evolving evolvability. Nature 407:457–458.
OpenUrl CrossRef PubMed
↵
1. Boeke JD,
2. Trueheart J,
3. Natsoulis G,
4. Fink GR
(1987) 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol 154:164–175.
OpenUrl PubMed
↵
1. Conde J,
2. Fink GR
(1976) A mutant of Saccharomyces cerevisiae defective for nuclear fusion. Proc Natl Acad Sci USA 73:3651–3655.
OpenUrl Abstract/FREE Full Text

Article Alerts

Email Article

Citation Tools

Request Permissions

Article Classifications

Biological Sciences
Genetics

Proceedings of the National Academy of Sciences: 108 (13)

Table of Contents

Submit

[1] ↵
Aguzzi A,
Baumann F,
Bremer J
(2008) The prion’s elusive reason for being. Annu Rev Neurosci 31:439–477.
OpenUrl CrossRef PubMed

[2] Aguzzi A,

[3] Baumann F,

[4] Bremer J

[5] ↵
Coustou V,
Deleu C,
Saupe S,
Begueret J
(1997) The protein product of the het-s heterokaryon incompatibility gene of the fungus Podospora anserina behaves as a prion analog. Proc Natl Acad Sci USA 94:9773–9778.
OpenUrl Abstract/FREE Full Text

[6] Coustou V,

[7] Deleu C,

[8] Saupe S,

[9] Begueret J

[10] ↵
Wickner RB
(1997) A new prion controls fungal cell fusion incompatibility. Proc Natl Acad Sci USA 94:10012–10014.
OpenUrl FREE Full Text

[11] Wickner RB

[12] ↵
Dalstra HJP,
Swart K,
Debets AJM,
Saupe SJ,
Hoekstra RF
(2003) Sexual transmission of the [Het-S] prion leads to meiotic drive in Podospora anserina. Proc Natl Acad Sci USA 100:6616–6621.
OpenUrl Abstract/FREE Full Text

[13] Dalstra HJP,

[14] Swart K,

[15] Debets AJM,

[16] Saupe SJ,

[17] Hoekstra RF

[18] ↵
Wickner RB
(1994) [URE3] as an altered URE2 protein: Evidence for a prion analog in Saccharomyces cerevisiae. Science 264:566–569.
OpenUrl Abstract/FREE Full Text

[19] Wickner RB

[20] ↵
Tanaka M,
Chien P,
Naber N,
Cooke R,
Weissman JS
(2004) Conformational variations in an infectious protein determine prion strain differences. Nature 428:323–328.
OpenUrl CrossRef PubMed

[21] Tanaka M,

[22] Chien P,

[23] Naber N,

[24] Cooke R,

[25] Weissman JS

[26] ↵
King CY,
Diaz-Avalos R
(2004) Protein-only transmission of three yeast prion strains. Nature 428:319–323.
OpenUrl CrossRef PubMed

[27] King CY,

[28] Diaz-Avalos R

[29] ↵
Eaglestone SS,
Cox BS,
Tuite MF
(1999) Translation termination efficiency can be regulated in Saccharomyces cerevisiae by environmental stress through a prion-mediated mechanism. EMBO J 18:1974–1981.
OpenUrl CrossRef PubMed

[30] Eaglestone SS,

[31] Cox BS,

[32] Tuite MF

[33] ↵
True HL,
Lindquist SL
(2000) A yeast prion provides a mechanism for genetic variation and phenotypic diversity. Nature 407:477–483.
OpenUrl CrossRef PubMed

[34] True HL,

[35] Lindquist SL

[36] ↵
Cox BS
(1965) PSI, a cytoplasmic suppressor of super-suppressor in yeast. Heredity 20:505–521.
OpenUrl CrossRef

[37] Cox BS

[38] ↵
Bruce ME,
Fraser H
(1991) Scrapie strain variation and its implications. Curr Top Microbiol Immunol 172:125–138.
OpenUrl PubMed

[39] Bruce ME,

[40] Fraser H

[41] ↵
Bessen RA,
Marsh RF
(1994) Distinct PrP properties suggest the molecular basis of strain variation in transmissible mink encephalopathy. J Virol 68:7859–7868.
OpenUrl Abstract/FREE Full Text

[42] Bessen RA,

[43] Marsh RF

[44] ↵
Derkatch IL,
Chernoff YO,
Kushnirov VV,
Inge-Vechtomov SG,
Liebman SW
(1996) Genesis and variability of [PSI] prion factors in Saccharomyces cerevisiae. Genetics 144:1375–1386.
OpenUrl PubMed

[45] Derkatch IL,

[46] Chernoff YO,

[47] Kushnirov VV,

[48] Inge-Vechtomov SG,

[49] Liebman SW

[50] ↵
Toyama BH,
Kelly MJ,
Gross JD,
Weissman JS
(2007) The structural basis of yeast prion strain variants. Nature 449:233–237.
OpenUrl CrossRef PubMed

[51] Toyama BH,

[52] Kelly MJ,

[53] Gross JD,

[54] Weissman JS

[55] ↵
Masison DC,
Wickner RB
(1995) Prion-inducing domain of yeast Ure2p and protease resistance of Ure2p in prion-containing cells. Science 270:93–95.
OpenUrl Abstract/FREE Full Text

[56] Masison DC,

[57] Wickner RB

[58] ↵
Brachmann A,
Baxa U,
Wickner RB
(2005) Prion generation in vitro: Amyloid of Ure2p is infectious. EMBO J 24:3082–3092.
OpenUrl CrossRef PubMed

[59] Brachmann A,

[60] Baxa U,

[61] Wickner RB

[62] ↵
Schlumpberger M,
Prusiner SB,
Herskowitz I
(2001) Induction of distinct [URE3] yeast prion strains. Mol Cell Biol 21:7035–7046.
OpenUrl Abstract/FREE Full Text

[63] Schlumpberger M,

[64] Prusiner SB,

[65] Herskowitz I

[66] ↵
Ter-Avanesyan MD,
Dagkesamanskaya AR,
Kushnirov VV,
Smirnov VN
(1994) The SUP35 omnipotent suppressor gene is involved in the maintenance of the non-Mendelian determinant [psi+] in the yeast Saccharomyces cerevisiae. Genetics 137:671–676.
OpenUrl PubMed

[67] Ter-Avanesyan MD,

[68] Dagkesamanskaya AR,

[69] Kushnirov VV,

[70] Smirnov VN

[71] ↵
King C-Y,
et al.
(1997) Prion-inducing domain 2-114 of yeast Sup35 protein transforms in vitro into amyloid-like filaments. Proc Natl Acad Sci USA 94:6618–6622.
OpenUrl Abstract/FREE Full Text

[72] King C-Y,

[73] et al.

[74] ↵
Shewmaker F,
Wickner RB,
Tycko R
(2006) Amyloid of the prion domain of Sup35p has an in-register parallel β-sheet structure. Proc Natl Acad Sci USA 103:19754–19759.
OpenUrl Abstract/FREE Full Text

[75] Shewmaker F,

[76] Wickner RB,

[77] Tycko R

[78] ↵
Garí E,
Piedrafita L,
Aldea M,
Herrero E
(1997) A set of vectors with a tetracycline-regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae. Yeast 13:837–848.
OpenUrl CrossRef PubMed

[79] Garí E,

[80] Piedrafita L,

[81] Aldea M,

[82] Herrero E

[83] ↵
Boeke JD,
LaCroute F,
Fink GR
(1984) A positive selection for mutants lacking orotidine-5′-phosphate decarboxylase activity in yeast: 5-Fluoro-orotic acid resistance. Mol Gen Genet 197:345–346.
OpenUrl CrossRef PubMed

[84] Boeke JD,

[85] LaCroute F,

[86] Fink GR

[87] ↵
Vishveshwara N,
Bradley ME,
Liebman SW
(2009) Sequestration of essential proteins causes prion associated toxicity in yeast. Mol Microbiol 73:1101–1114.
OpenUrl CrossRef PubMed

[88] Vishveshwara N,

[89] Bradley ME,

[90] Liebman SW

[91] ↵
Tuite MF,
Mundy CR,
Cox BS
(1981) Agents that cause a high frequency of genetic change from [psi+] to [psi−] in Saccharomyces cerevisiae. Genetics 98:691–711.
OpenUrl PubMed

[92] Tuite MF,

[93] Mundy CR,

[94] Cox BS

[95] ↵
Edskes HK,
Gray VT,
Wickner RB
(1999) The [URE3] prion is an aggregated form of Ure2p that can be cured by overexpression of Ure2p fragments. Proc Natl Acad Sci USA 96:1498–1503.
OpenUrl Abstract/FREE Full Text

[96] Edskes HK,

[97] Gray VT,

[98] Wickner RB

[99] ↵
Dagkesamanskaya AR,
Ter-Avanesyan MD
(1991) Interaction of the yeast omnipotent suppressors SUP1(SUP45) and SUP2(SUP35) with non-mendelian factors. Genetics 128:513–520.
OpenUrl PubMed

[100] Dagkesamanskaya AR,

[101] Ter-Avanesyan MD

[102] ↵
Bagriantsev SN,
Gracheva EO,
Richmond JE,
Liebman SW
(2008) Variant-specific [PSI+] infection is transmitted by Sup35 polymers within [PSI+] aggregates with heterogeneous protein composition. Mol Biol Cell 19:2433–2443.
OpenUrl Abstract/FREE Full Text

[103] Bagriantsev SN,

[104] Gracheva EO,

[105] Richmond JE,

[106] Liebman SW

[107] ↵
Namy O,
et al.
(2008) Epigenetic control of polyamines by the prion [PSI+] Nat Cell Biol 10:1069–1075.
OpenUrl CrossRef PubMed

[108] Namy O,

[109] et al.

[110] ↵
Chernoff YO,
et al.
(2000) Evolutionary conservation of prion-forming abilities of the yeast Sup35 protein. Mol Microbiol 35:865–876.
OpenUrl CrossRef PubMed

[111] Chernoff YO,

[112] et al.

[113] ↵
Resende CG,
Outeiro TF,
Sands L,
Lindquist S,
Tuite MF
(2003) Prion protein gene polymorphisms in Saccharomyces cerevisiae. Mol Microbiol 49:1005–1017.
OpenUrl CrossRef PubMed

[114] Resende CG,

[115] Outeiro TF,

[116] Sands L,

[117] Lindquist S,

[118] Tuite MF

[119] ↵
Nakayashiki T,
Kurtzman CP,
Edskes HK,
Wickner RB
(2005) Yeast prions [URE3] and [PSI⁺] are diseases. Proc Natl Acad Sci USA 102:10575–10580.
OpenUrl Abstract/FREE Full Text

[120] Nakayashiki T,

[121] Kurtzman CP,

[122] Edskes HK,

[123] Wickner RB

[124] ↵
Hoshino S,
Imai M,
Kobayashi T,
Uchida N,
Katada T
(1999) The eukaryotic polypeptide chain releasing factor (eRF3/GSPT) carrying the translation termination signal to the 3′-Poly(A) tail of mRNA. Direct association of erf3/GSPT with polyadenylate-binding protein. J Biol Chem 274:16677–16680.
OpenUrl Abstract/FREE Full Text

[125] Hoshino S,

[126] Imai M,

[127] Kobayashi T,

[128] Uchida N,

[129] Katada T

[130] ↵
Hosoda N,
et al.
(2003) Translation termination factor eRF3 mediates mRNA decay through the regulation of deadenylation. J Biol Chem 278:38287–38291.
OpenUrl Abstract/FREE Full Text

[131] Hosoda N,

[132] et al.

[133] ↵
Urakov VN,
et al.
(2006) N-terminal region of Saccharomyces cerevisiae eRF3 is essential for the functioning of the eRF1/eRF3 complex beyond translation termination. BMC Mol Biol 7:34–46.
OpenUrl CrossRef PubMed

[134] Urakov VN,

[135] et al.

[136] ↵
Jung G,
Jones G,
Wegrzyn RD,
Masison DC
(2000) A role for cytosolic hsp70 in yeast [PSI(+)] prion propagation and [PSI(+)] as a cellular stress. Genetics 156:559–570.
OpenUrl PubMed

[137] Jung G,

[138] Jones G,

[139] Wegrzyn RD,

[140] Masison DC

[141] ↵
Schwimmer C,
Masison DC
(2002) Antagonistic interactions between yeast [PSI(+)] and [URE3] prions and curing of [URE3] by Hsp70 protein chaperone Ssa1p but not by Ssa2p. Mol Cell Biol 22:3590–3598.
OpenUrl Abstract/FREE Full Text

[142] Schwimmer C,

[143] Masison DC

[144] ↵
Shorter J,
Lindquist S
(2005) Prions as adaptive conduits of memory and inheritance. Nat Rev Genet 6:435–450.
OpenUrl PubMed

[145] Shorter J,

[146] Lindquist S

[147] ↵
Shewmaker F,
Mull L,
Nakayashiki T,
Masison DC,
Wickner RB
(2007) Ure2p function is enhanced by its prion domain in Saccharomyces cerevisiae. Genetics 176:1557–1565.
OpenUrl CrossRef PubMed

[148] Shewmaker F,

[149] Mull L,

[150] Nakayashiki T,

[151] Masison DC,

[152] Wickner RB

[153] ↵
Partridge L,
Barton NH
(2000) Evolving evolvability. Nature 407:457–458.
OpenUrl CrossRef PubMed

[154] Partridge L,

[155] Barton NH

[156] ↵
Boeke JD,
Trueheart J,
Natsoulis G,
Fink GR
(1987) 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol 154:164–175.
OpenUrl PubMed

[157] Boeke JD,

[158] Trueheart J,

[159] Natsoulis G,

[160] Fink GR

[161] ↵
Conde J,
Fink GR
(1976) A mutant of Saccharomyces cerevisiae defective for nuclear fusion. Proc Natl Acad Sci USA 73:3651–3655.
OpenUrl Abstract/FREE Full Text

[162] Conde J,

[163] Fink GR

Main menu

User menu

Search

Suicidal [PSI⁺] is a lethal yeast prion

Abstract

Results

Discussion

Methods

Strains and Media.

Construction of Plasmids.

Induction of [PSI⁺] Formation.

Aggregation of Sup35NM and Ure2N Fusion Proteins.

Cytoduction.

Acknowledgments

Footnotes

References

Citation Manager Formats

Article Classifications

You May Also be Interested in

Similar Articles

Articles

PNAS Portals

Information

Main menu

User menu

Search

Abstract

Results

Discussion

Methods

Strains and Media.

Construction of Plasmids.

Induction of [PSI+] Formation.

Aggregation of Sup35NM and Ure2N Fusion Proteins.

Cytoduction.

Acknowledgments

Footnotes

References

Citation Manager Formats

Article Classifications

Sign up for Article Alerts

Jump to section

You May Also be Interested in

Similar Articles

Articles

PNAS Portals

Information

Induction of [PSI⁺] Formation.