Enhancing potency of siRNA targeting fusion genes by optimization outside of target sequence

Kseniya Gavrilov; Young-Eun Seo; Gregory T. Tietjen; Jiajia Cui; Christopher J. Cheng; W. Mark Saltzman

doi:10.1073/pnas.1517039112

Edited by Robert Langer, Massachusetts Institute of Technology, Cambridge, MA, and approved October 20, 2015 (received for review September 2, 2015)

Significance

Potency is a key parameter in development of siRNAs for clinical use. However, current design and optimization approaches are concentrated on determining best target sequences within the entire mRNA sequence of interest. This methodology falls short when the available region of the target mRNA becomes restricted, as when targeting the junction site of a fusion oncogene. Here we demonstrate alternative optimization strategies for further improving silencing performance when the targetable region of the mRNA is confined. We apply this approach for siRNA against fusion genes BCR-ABL and TMPRSS2-ERG. We further demonstrate the importance of concurrent development of siRNA design and delivery strategies for more effective siRNA therapeutics and draw attention to the implications of target protein half-life and nonspecific vehicle toxicity.

Abstract

Canonical siRNA design algorithms have become remarkably effective at predicting favorable binding regions within a target mRNA, but in some cases (e.g., a fusion junction site) region choice is restricted. In these instances, alternative approaches are necessary to obtain a highly potent silencing molecule. Here we focus on strategies for rational optimization of two siRNAs that target the junction sites of fusion oncogenes BCR-ABL and TMPRSS2-ERG. We demonstrate that modifying the termini of these siRNAs with a terminal G-U wobble pair or a carefully selected pair of terminal asymmetry-enhancing mismatches can result in an increase in potency at low doses. Importantly, we observed that improvements in silencing at the mRNA level do not necessarily translate to reductions in protein level and/or cell death. Decline in protein level is also heavily influenced by targeted protein half-life, and delivery vehicle toxicity can confound measures of cell death due to silencing. Therefore, for BCR-ABL, which has a long protein half-life that is difficult to overcome using siRNA, we also developed a nontoxic transfection vector: poly(lactic-coglycolic acid) nanoparticles that release siRNA over many days. We show that this system can achieve effective killing of leukemic cells. These findings provide insights into the implications of siRNA sequence for potency and suggest strategies for the design of more effective therapeutic siRNA molecules. Furthermore, this work points to the importance of integrating studies of siRNA design and delivery, while heeding and addressing potential limitations such as restricted targetable mRNA regions, long protein half-lives, and nonspecific toxicities.

Since its discovery, RNAi using siRNAs has emerged not only as a useful tool for the study of gene function, but also as a promising therapeutic modality for a multitude of human diseases ranging from viral infections to cancer (1, 2). However, despite considerable potential, the advancement of RNAi therapeutics into the clinic has been slowed by several challenges that reduce in vivo efficacy (2 ⇓–4). One such challenge is the identification of highly potent siRNA sequences. Currently, siRNA design and optimization schemes focus on selecting the best 21-nt sequence from within the entire target mRNA sequence. Although this has been an effective strategy for many gene targets, in some applications mRNA target sequence selection is drastically limited by a requirement to target a restricted region of mRNA. Aberrant fusion genes that drive malignant growth in certain cancers (e.g., TMPRSS2-ERG in prostate cancer and BCR-ABL in chronic myeloid leukemia, hereafter referred to as CML) exemplify an important class of restricted sequence targets where the fusion site represents the only specific targetable sequence.

Despite the inability to optimize sequence by standard approaches, knockdown of BCR-ABL and TMPRSS2-ERG with siRNAs that target their fusion junction sites has been shown to suppress tumorigenicity to some degree (5 ⇓–7). This strategy has therapeutic potential because it is relatively simple to adapt (by adjusting the siRNA sequence) to counteract any escape mutations that may arise, which is often a problem with small molecule inhibitors. Moreover, the fusion junction site is a cancer-specific target that will not appear in normal tissues (5). Thus, an siRNA-based therapy could potentially be designed to treat CML or prostate cancer with high specificity for cancerous cells and thereby minimal off-target toxicity. However, any design criteria for such an siRNA based therapy will need to account for the extremely high levels of activity typically characteristic of fusion oncogenes. Even trace amounts of these dangerous chimeric proteins may be sufficient to drive aberrant growth (8).

The pathological potency of fusion oncogenes such as BCR-ABL or TMPRSS2-ERG makes it necessary to design equally potent siRNA therapeutics capable of mediating complete or near-complete knockdown. It is important to note that administration of large, saturating doses of siRNA to achieve these high levels of knockdown is not a viable strategy with current technology. Most standard transfection vectors possess significant toxicity on their own (9), which eliminates the value of having a highly cancer-specific siRNA sequence. Clearing these hurdles ultimately mandates a dual approach: (i) new strategies for the design of siRNA capable of hyperefficient silencing under restricted targetable sequence conditions and (ii) development of nontoxic carriers with the capacity to deliver high doses of siRNA.

Motivated by the need for this dual focus, in this paper we first use mechanistic knowledge of RNAi principles, RNA structure, and the thermodynamics of RNA duplexes to rationally design nucleic acid-based modifications that significantly enhance the potency of siRNA directed against either BCR-ABL or TMPRSS2-ERG. Importantly, BCR-ABL and TMPRSS2-ERG demonstrate starkly different protein half-lives (∼40 h for BCR-ABL versus ∼1 h for TMPRSS2-ERG), which provides two distinct platforms for testing the ability to further improve siRNA efficacy via terminal base manipulation. A specific response at the level of cell death is more difficult to achieve with lipofectamine-delivered siRNA in the BCR-ABL system due to the longevity of the protein and toxicity of the vehicle. We then demonstrate the ability to retain the specificity and enhance the effect of the siRNA therapeutic at higher doses in the BCR-ABL system via delivery in a nontoxic poly(lactic-coglycolic acid) (PLGA) nanoparticle (NP) delivery platform.

Results

Theoretical Basis for Rational Design.

We began with previously identified active and specific junction sequence siRNA against BCR-ABL: 5′-GCAGAGUUCAAAAGCCCUU-3′ (Fig. 1A) (5, 6). The current potency of this junction-targeted sequence is not enough to be therapeutically useful. Inspired by the robust potency enhancement conferred to siRNAs by the addition of 3′ dinucleotide overhangs, which help tether the siRNA guide strand to the RNA-induced silencing complex (RISC) by tucking deep into a hydrophobic pocket of the protein Argonaute (core of the RISC and chief executor of siRNA-mediated silencing), we designed additional terminal features to further increase the efficiency of our junction sequence siRNA.

Fig. 1.

Two modifications to enhance BCR-ABL fusion junction site-targeted siRNA. (A) Fusion junction site of BCR-ABL target mRNA and antisense strand of previously identified active siRNA. (B) BCR-ABL siRNA shown with 3′ UU overhangs and each of two newly designed modifications: wobble pair and terminal asymmetry.

In one approach, we examine the effect of incorporating a G-U wobble pair at the 5′ end of the siRNA guide strand (Fig. 1B). G-U wobble pairs are critical features in many cases of RNA-protein recognition (10, 11). This non-Watson–Crick pairing creates a distinctive protruding functional group with two hydrogens available for hydrogen bonding that have the potential to facilitate interaction with Argonaute. It is important to note this modification is not destabilizing to the duplex (two stable internal hydrogen bonds form in the G-U wobble and this pairing usually stacks efficiently). Rather, this feature lends a novel structural aspect to the duplex that we hypothesized may aid in recognition and interaction with RISC (Fig. 1B) (10, 11).

The second approach focuses on enhancing guide-strand selection. Thermodynamic data indicate that Argonaute selects whichever strand has its 5′ end at the less thermodynamically stable end of the duplex to be the guide strand (12). When there is no appreciable duplex terminal asymmetry, Argonaute is unable to discriminate between strands and selects either strand with equal probability, leading to inefficiency and off-target effects (12). Based on calculations described in Methods, we introduced destabilizing tandem A:A mismatches at the 3′ end of the sense strand (see Methods for calculations). Importantly, unlike many mismatches, which can often be rather stable, A:A mismatches are always highly destabilizing (13, 14).

Rational Modifications Improve BCR-ABL mRNA and Protein Knockdown.

The siRNA for the BCR-ABL junction sequence that we obtained from the literature was tested at 10 nM with and without our rationally designed modifications using human CML cell line K562. At this dose, all sequences were maximally effective in their suppression of BCR-ABL mRNA (Fig. 2A). To tease out differences, we tested this sequence both with 3′ overhangs as used previously (we chose to use UU overhangs) and with blunt ends (no overhangs). As expected, knockdown of BCR-ABL mRNA was far less efficient using the blunt-ended siRNA junction sequence (Fig. 2B). However, this decrease in activity with the blunt sequence can be partially rescued when the sequence also contains a terminal asymmetry or wobble-pair modification (Fig. 2B). Furthermore, when combined with UU overhangs the terminal asymmetry and wobble-pair modifications exhibit a synergistic effect on silencing efficiency—achieving the same level of mRNA knockdown at a 1 nM dose that required 10 nM of the unmodified junction sequence siRNA with overhangs (Fig. 2C). This figure demonstrates proof of principle: Modification of siRNA sequence terminus can be effective for tuning duplex potency. For all subsequent experiments, all siRNA sequences contain the 3′ UU overhangs.

Fig. 2.

BCR-ABL mRNA knockdown significantly improved with modified siRNA sequences. (A) qPCR detection of relative BCR-ABL knockdown using fusion-junction targeted siRNA at 10 nM shows all sequences are maximally effective at this dose (n = 6 for controls; n = 3 for all other conditions). (B) The efficacy is brought down when UU overhangs are removed (blunt) and then partially rescued when terminal asymmetry and wobble-pair modifications are added (n = 6 for controls; n = 3 for all other conditions). (C) Used in combination with 3′UU overhangs, both the terminal asymmetry and wobble-pair-modified siRNA can mediate strong BCR-ABL mRNA knockdown at a dose of 1 nM, a dose at which the unmodified junction sequence, with overhangs, is not appreciably active (n = 6 for controls; n = 8 for terminal asymmetry; n = 12 for all other conditions). Experiments performed in human CML cell line K562.

We next investigated whether the difference in mRNA knockdown achieved by incorporating the modifications into the junction sequence siRNA produced a difference in BCR-ABL protein expression. Despite the large decrease in mRNA levels upon treatment with the modified sequences at 1 nM, we observed no detectable difference in protein expression at this dose (Fig. 3A). This result can likely be explained by the long half-life (∼40 h) (15, 16) of BCR-ABL and the transient nature of siRNA-mediated mRNA knockdown (typically lasting 48–72 h after lipofectamine-mediated transfection) (17). In other words, the sharp drop in mRNA observed in our quantitative PCR (qPCR) experiments was too brief to have a noticeable effect on the levels of the long-lived protein at this dose. Upon increasing the dose to 5 nM, we observed an improved efficacy in protein suppression with the modified sequences, consistent with what we saw at the mRNA level (Fig. 3B). Band densitometry quantification of Western blots showed that both the wobble-pair and terminal asymmetry modifications increased efficiency of reducing BCR-ABL protein levels at this low dose compared with the unmodified junction sequence siRNA (Fig. 3C).

Fig. 3.

Detection of enhanced BCR-ABL protein suppression with modified siRNA sequences. (A) Representative Western blot upon treatment with BCR-ABL siRNAs at 1 nM. (B) Representative Western blot upon treatment with BCR-ABL siRNAs at 5 nM. (C) Quantification of blots from n = 4 blots at 5 nM siRNA dose using Bio-Rad Quanity One software of normalized BCR-ABL levels relative to α-tubulin. Experiments performed in human CML cell line K562.

Effects Dwindle at the Level of Leukemic Cell Death.

As mentioned above, even trace amounts of BCR-ABL protein could potentially be sufficient to drive aberrant cell growth. Because the ultimate goal of using siRNA targeted to the BCR-ABL fusion junction site is to induce apoptosis in leukemic cells, we assessed whether the increases in efficiency observed in suppressing mRNA and protein expression carried over into increases in efficiency in triggering cell death. In an attempt to achieve pharmacological effects with a low siRNA dose, we first used a single 5 nM treatment and when we did not see an effect (Fig. 4A) we used repeat doses of siRNA at 5nM (one treatment each day for 4 d) and then assessed K562 cell death (Fig. 4B). The results of these experiments were less conclusive. Although a similar trend was observed with improved efficacy in the modified sequences, none of these treatments was significantly different from the control siRNA treatment (Fig. 4C). The siRNA effect was obscured by toxicity associated with repeat dosing of lipofectamine (9), which limits our ability to experimentally determine the effects of the improved siRNA knockdown on siRNA-mediated cell death.

Fig. 4.

Differences among sequences are difficult to detect at the level of leukemic cell death. (A) With a single dose of 5nM siBCR-ABL, no effect at the level of cell death is observed using CellTiterGLO assay (n = 4 for test conditions; n = 5 for untreated). (B) Experimental timeline for repeated dosing: Cells were plated the day before first siRNA treatment then treated with a dose of 5 nM siRNA with each of the sequences plus control for four consecutive days, after which CellTiterGLO assay was performed to quantify differences in cell viability. (C) Results of the CellTiterGLO assay for the experiment describe above, normalized to the untreated (n = 48 for untreated; n = 12 for all other conditions). Experiments performed in human CML cell line K562.

Modifications Applied to Anti-TMPRSS2-ERG and Anti-Luciferase siRNA.

The absence of a significant difference at the level of cell death in the BCR-ABL system does not discount the potential benefit of terminal-end modifications for improving siRNA efficiency, but rather reveals an additional barrier to effectively using siRNAs to target BCR-ABL therapeutically (i.e., its long half-life and the toxicity of common transfection methods) (17). To further assess the benefit of these modifications, we applied them to another recently published siRNA sequence targeting the junction site of a different fusion gene: the most common genetic aberration manifested in prostate cancer TMPRSS2-ERG (type III), whose stable knockdown has similarly been shown to suppress tumor growth (7). In this case, we saw a much more pronounced functional response. With just one treatment of 1 nM siRNA, our modified sequences significantly decreased viability of human prostate cancer cell line VCaP compared with the control treatment, whereas the unmodified junction sequence did not exhibit a significant effect at this low dose (Fig. 5). The stronger response at the level of cell death in this system, compared with BCR-ABL, is likely because this particular fusion involves a transcription factor, a family of proteins which typically have a short protein half-life and mRNA decay rate of less than 1–2 h (17 ⇓⇓–20). Not only does this result substantiate our conclusions about our modifications, it validates our overall approach as an effective strategy for improving design-limited siRNA sequences. Notably, at higher, saturating doses of siRNA, we did not observe a benefit to having the modifications (Fig. S1). This is not surprising given the theoretical basis of the modifications. We would expect advantages stemming from improved trigger recognition or selection to only be apparent under limiting conditions as opposed to conditions wherein siRNA process machinery is saturated. Moreover, these low treatment doses are more therapeutically relevant due to the well-known difficulty of efficient in vivo delivery and high toxicity of some delivery methods (1).

Fig. 5.

Same modifications applied to siRNA sequence against fusion oncogene TMPRSS2-ERG show improvement at low dose. CellTiterGLO viability assay performed 3 d following one 1 nM treatment with each of the siRNAs showed that our two modified sequences brought about greater reduction in cell viability than the unmodified junction sequence (n = 32 for untreated; n = 8 for all other conditions). Experiments performed in human prostate cancer cell line VCaP.

Fig. S1.

Modifications applied to siRNA sequence against fusion oncogene TMPRSS2-ERG do not bring about improvement in potency at higher doses. (A and B) Using the CellTiterGLO viability assay performed three days following 1 10 nM (A) or 100 nM (B) treatment with each of the siRNAs, no enhancement was observed with the modified sequences at saturating doses of 10 nM and 100 nM (n = 32 for untreated; n = 8 for all other conditions). Experiments performed in human prostate cancer cell line VCaP.

To confirm that delivery of the siRNA led to protein silencing we also assessed the TMPRSS2-ERG protein level. There is no antibody specific to TMPRSS2-ERG available (only to ERG) and VCaP cells express both the fusion and wild-type forms of ERG, which are nearly identical in size, so assessing differences in the specific TMPRSS2-ERG protein knockdown by various siRNAs in VCap cells by Western blot is difficult. We instead transiently transfected V5-tagged TMPRSS2-ERG into HEK293T cells and specifically blotted for the fusion using anti-V5 antibody as previously published (7). At the low siRNA dose of 5 nM, we found that the wobble-pair-modified siRNA sequence outperformed the unmodified junction sequence in suppressing TMPRSS2-ERG protein expression (Fig. S2). Interestingly, we did not see an improvement with the terminal asymmetry modification in this system like we did in the VCap cells. This suggests that there are cell-dependent factors in addition to gene-dependent factors that contribute to the observed silencing efficiency.

Fig. S2.

TMPRSS2-ERG protein knockdown improved with wobble-pair-modified siRNA at low dose. Western blot of 293T cells transiently transfected with V5-tagged type III TMPRSS2-ERG (T/E) and treated with 5 nM siRNA for 72 h shows wobble-pair-modified siRNA more efficiently knocks down the fusion gene than the other two T/E siRNAs. Values represent quantification of normalized T/E levels relative to GAPDH. Experiments performed in HEK293T cells transfected with V5-tagged TMPRSS2-ERG.

As a further test case, we examined an siRNA designed for a nonfusion site (i.e., when the full spectrum of available design algorithms could be used in design of the siRNA). We chose to target firefly luciferase stably expressed in human epithelial colon cancer cells (RKO) for the ease of read-out. A highly effective siRNA sequence against this gene was designed using known methods and tested in-house. Modifications similar to those used to enhance the fusion junction site-targeted siRNAs were applied (to preserve more of the sequence of the guide strand, destabilizing C-U mismatches were used instead of A-A) and all sequences were screened for luciferase knockdown (measured by luminescence assay) at a variety of doses, then normalized to the control siRNA treatment at each dose (Fig. S3). No significant difference between sequences was measured at any of the doses tested. These results suggest saturation of RISC activity, which is already reached by effectively designed sequences: In this event, further optimization steps cannot improve potency.

Fig. S3.

siRNA against luciferase, designed without restriction to narrow sequence space is already maximally effective. (A) Sequence of siRNA against luciferase (designed) and our two modified versions of this sequence (modifications shown in red). (B) Luminescence data after treatment with siRNAs at a variety of doses normalized to control siRNA treatment shows that there are no appreciable differences among the three luciferase siRNA sequences (n = 10). Experiments performed in RKO cell line stably transfected with luciferase reporter vector pGL4.15.

Robust and Specific Leukemic Cell Death Can Be Achieved Using a Nontoxic siRNA Delivery Vehicle.

Although our rational design of potency-enhancing modifications for siRNA targeting the BCR-ABL fusion junction was successful (i.e., the modified sequences more effectively suppress BCR-ABL than the unmodified junction sequence), this improvement did not lead to robust killing of leukemic cells. However, these results suggest that the persistent and long-lived BCR-ABL protein could be reduced if sufficient doses of potent siRNA were released slowly over a period of several days by a nontoxic carrier. As proof of concept, we loaded the most effective BCR-ABL siRNA (wobble-pair-modified)(siBCR-ABLwob) into PLGA NPs, which have already been shown to provide controlled release of siRNA and sustained target knockdown (21), as described previously (21 ⇓–23). We verified NP size and morphology (∼150-nm diameter by SEM; spherical) (Fig. 6A), loading (113 ± 46 pmol siBCRABLwob/mg PLGA and 184 ± 67 pmol siCTRL/mg PLGA; not a significant difference), and controlled release (an initial rapid release over the first 24 h is followed by a slow and steady linear release over the next several days) (Fig. 6B). Owing to unavoidable NP batch-to-batch variation and variation that arises during measurement of siRNA release, the cumulative release profiles for siBCR-ABLwob and siCTRL NPs appear slightly different. However, NP treatment is controlled for siRNA loading and the total siRNA payload delivered by the two types of NPs over the course of the experiment (4 d) is the same (same cumulative fraction of the total dose is released). We also measured the hydrodynamic diameter (283 nm) and zeta potential (−23 mV) of the siBCR-ABLwob loaded PLGA particles; these measurements were consistent with previous studies (24).

Fig. 6.

NPs loaded with wobble-pair-modified anti–BCR-ABL siRNA (siBCR-ABLwob) bring about robust K562 cell death and do not cause toxicity to cells whose growth is not driven by BCR-ABL. (A) Representative SEM image of NPs loaded with BCR-ABL siRNA (with wobble-pair modification). (Scale bar, 500 nm.) (B) Controlled-release profile for unmodified NPs loaded with siBCR-ABLwob or Control siRNA (siCTRL) (n = 3). (C) CellTiterGLO assay performed 4 d after treatment with siBCR-ABLwob–loaded PLGA NPs shows robust cell death response with no vehicle toxicity until much higher doses (n = 4). Experiment performed in human CML cell line K562. (D) CellTiterGLO assay performed 4 d after treatment with NPs shows siBCR-ABL wob–loaded NPs do not cause cytotoxicity to a cell line that is not dependent on BCR-ABL for growth. The cytotoxicity profile of siBCR-ABLwob–loaded NPs is not significantly different from that of NPs loaded with DNA mimic, and neither type of NP exhibits any toxicity until extreme doses (n = 4). Experiment performed in human glioblastoma cell line U87-MG.

By assessing leukemic cell viability as a function of siRNA dose, we found that siBCR-ABLwob–loaded PLGA NPs produced robust K562 cell death, whereas control NPs at reasonable doses were nontoxic (Fig. 6C). Nonspecific toxicity does occur at extreme doses of siRNA NPs. It is important to note that the “dose” of siRNA administered is the total dose encapsulated by the NPs incubated with cells; however, as shown, this amount is released slowly over time, meaning the effective dose seen by the cells each day is, in fact, much lower. NPs loaded with siBCR-ABLwob are nontoxic to cells that are not dependent on BCR-ABL for growth (we used human glioblastoma cell line U87-MG) up until extreme doses (Fig. 6D). We do notice a small apparent increase in viability in U87 cells treated with siRNA-loaded NPs compared with untreated cells. We believe this is due to the PLGA NP delivery vehicle, because we sometimes observe an apparent increase in cell viability upon treatment with blank or spermidine-only PLGA NPs (24, 25).

Discussion

Here we have demonstrated an approach for optimization of an siRNA sequence when the standard methods for selection of that sequence are limited, as in the case of silencing a fusion gene or a gene with otherwise limited target accessibility. In such cases, we demonstrate that optimization can be achieved through siRNA sequence design by using knowledge about siRNA–RISC interaction and siRNA duplex thermodynamics and structure. Fusion oncogenes are among the most compelling applications for siRNA therapeutics, but optimization of potency is critically important. Whereas traditional optimizations may be sufficient in the absence of the sequence restrictions present in fusion genes, these methods will likely be inadequate in the case of specifically targeting many fusion oncogenes.

We show that incorporation of carefully designed mismatches or a G-U wobble pair can lead to substantial improvements in siRNA potency. To the best of our knowledge, previous work on the use of mismatches or wobble pairs for siRNA design has been largely inconclusive. We believe this is because these modifications were designed without regard to nearest-neighbor stacking, context-dependent stability, or RNA structure. We emphasize the theoretical basis of our design modifications because these aspects of siRNA duplexes are likely to be relevant, as in the case for micro and other RNAs. There are many non-Watson–Crick pairings in RNA that are stable and incorporating these will not destabilize an RNA duplex. Also, it has been shown that the stability of RNA is due less often to hydrogen bonding than to stacking of nearest-neighbor pairs. We made use of all of this knowledge to design a “terminal asymmetry” modification that is truly destabilizing. Our other modification, the G-U wobble pair, is distinctly different. Forming two stable hydrogen bonds and stacking efficiently, this modification is not at all destabilizing. It is unique structurally for the protruding NH₂ group it offers.

The posttarget-sequence-selection nucleic acid modifications we designed enhanced the performance of the best siRNAs we found in the literature for two different fusion genes: BCR-ABL and TMPRSS2-ERG. We predict these modifications will also be beneficial if applied in similar cases. Additionally, there may be still other effective postselection substitutions that we did not try. For instance, it is becoming increasingly apparent that RNA strain and stability play an important role during binding to RISC, as does duplex stability of the fully paired siRNA guide strand–mRNA duplex. Thus, strategic nucleotide substitutions in the central part of the siRNA, outside of the seed region, might also serve to enhance the activity of a suboptimal sequence.

Our work also reaffirms that some of the most important challenges for siRNA therapies lie outside the realm of nucleic acid design. Sequence selection may be the front line in siRNA therapeutic design, but more work is needed to support the activity of even the most potent siRNA. This is particularly apparent in our work on BCR-ABL. Although our modified siRNA sequences for BCR-ABL demonstrate a marked improvement over the unmodified sequence at the level of BCR-ABL mRNA knockdown, this effect was less prominent at the levels of protein suppression and leukemic cell death: The effect of siRNA silencing was lost due to the long BCR-ABL protein half-life and toxicity of the lipofectamine delivery vehicle. These are problems of siRNA delivery, not siRNA design. An improved functional effect requires a nontoxic delivery vehicle that provides sustained intracellular release of higher doses of BCR-ABL siRNA, to allow time for the BCR-ABL protein level to drop and the functional effect to occur. Polymeric NPs may be a promising delivery system moving forward: These systems have already been shown to provide sustained knockdown by slow release of siRNA in the cell (21, 25 ⇓–27) and here we show the potential of achieving robust killing of leukemic cells using these or similar systems. With our improvements to the potency of the siRNA sequence, some of the demands on this delivery system are mitigated because now less siRNA material must be delivered to produce a desired functional effect.

The improvements that our modifications can confer on siRNA potency are more apparent at a functional level in the TMPRSS2-ERG system. An unanticipated result of our work has been the discovery that siRNA potency can read out differently at various stages from mRNA to protein to cell viability and these differences are correlated to protein longevity. In a way, the TMPRSS2-ERG and BCR-ABL systems represent two opposite paradigms. In the case of the long-lived BCR-ABL protein, the modified sequences displayed an acute improvement in potency when measured at the level of mRNA knockdown, but this improvement dwindled at the level of protein expression and became nearly undetectable at the level of cell viability. However, when applied to siRNA targeting the TMPRSS2-ERG fusion our modifications conferred a robust advantage at the level of cell viability. Therapeutically, cell viability, which provides the cumulative picture, is what matters: mRNA/protein snapshots can be misleading. Taken together, these results provide a method for optimizing the activity of important therapeutic siRNA sequences whose design parameters were previously limited, although the degree to which the improvement is ultimately meaningful is still contingent on the identification of better methods for siRNA delivery.

Methods

ΔΔG Calculations.

Duplex stability is determined not by hydrogen bonding of base pairs, but rather by the free energy of stacking (28 ⇓–30), and the thermodynamic stability of a duplex can be calculated based on sequence using the equationΔG°37(Total)=ΣΔG°37(Stack)+ΔG°37(Initiation)=Σ(ΔG°37’s)NearestNeighbor+3.4kcal/mol,

where ΔG°₃₇ for each nearest-neighbor pair in the sequence can be obtained from the tables of Turner and coworkers (28 ⇓–30) and ΔG°₃₇ (Initiation)—the entropy penalty for forming a duplex—has been determined to be +3.4 kcal/mol (28).

For siRNA duplexes, end asymmetry, as it relates to strand selection, is most dependent on the first two nucleotides at either end (31). Based on this, calculating the ΔG of each end of the unmodified duplex and calculating the ΔΔG between them results in a ΔΔG that is just barely over the recently derived threshold of 2 kcal/mol for preferential incorporation of the antisense strand into RISC (31). With incorporation of destabilizing tandem A:A mismatches at the 3′ end of the sense strand, ΔΔG increases to more than 4kcal/mol.

For the unmodified anti-BCR-ABL junction sequence siRNA duplex:

5′-GCAGAGUUCAAAAGCCCUU-3′
3′-CGUCUCAAGUUUUCGGGAA-5′

the difference in free energy (ΔΔG) between the 5′ end of the sense and antisense strands is given byΔΔG°37=ΔG°37(5′end sense)-ΔG°37(5′end antisense)=[ΔG°37(GC→CG←)+ΔG°37(CA→GU←)]−[ΔG°37(CU→GA←)+ΔG°37(UU→AA←)]=[−3.4+−1.8]28−[−1.7+−0.9]28=2.6 kcal/mol.

For the modified duplex:

5′-GCAGAGUUCAAAAGCCCAA-3′
3′-CGUCUCAAGUUUUCGGGAA-5′

where the two 3′ sense strand Us are replaced with As, ΔΔG becomesΔΔG°37=[ΔG°37(GC→CG←)+ΔG°37(CA→GU←)]−[ΔG°37(CA→GA←)+ΔG°37(AA→AA←)]=[−3.4+−1.8]28−[−1.9+1.0]14=4.3 kcal/mol.

Note that an exact experimental ΔG°₃₇ for tandem A-A mismatches is unavailable. The value used above is an approximation based on work by Christiansen and Znosko (14) on similar tandem mismatches.

Cells.

Human chronic myeloid leukemia cell line K562 was maintained in RPMI (Gibco) supplemented with l-glutamine, penicillin–streptomycin (1%), and FBS (10% vol/vol) in a humidified air atmosphere containing 5% CO₂ held at 37 °C. Human prostate cancer cell line VCap was maintained in DMEM (Gibco) supplemented with l-glutamine, penicillin–streptomycin (1%), and FBS (10%) in a humidified air atmosphere containing 5% CO₂ held at 37 °C. Human embryonic kidney cell line HEK293T was maintained in DMEM (Gibco) supplemented with l-glutamine, penicillin–streptomycin (1%), and FBS (10% vol/vol) in a humidified air atmosphere containing 5% CO₂ held at 37 °C. Human colon carcinoma cell line RKO, stably transfected with luciferase reporter vector pGL4.15[luc2P/Hygro], was maintained in RPMI (Gibco) supplemented with l-glutamine, penicillin–streptomycin (1%), and FBS (10% vol/vol) in a humidified air atmosphere containing 5% CO₂ held at 37 °C. Human glioblastoma cell line U87-MG was maintained in DMEM (Gibco) supplemented with l-glutamine, penicillin–streptomycin (1%), and FBS (10% vol/vol) in a humidified air atmosphere containing 5% CO₂ held at 37 °C.

siRNA.

All siRNAs were synthesized by Dharmacon. The sequences tested were as follows:

siBCR-ABL junction sequence:
5′-GCAGAGUUCAAAAGCCCUU(UU)-3′
3′-(UU)CGUCUCAAGUUUUCGGGAA-5′
siBCR-ABL terminal asymmetry:
5′-GCAGAGUUCAAAAGCCCAA(UU)-3′
3′-(UU)CGUCUCAAGUUUUCGGGAA-5′
siBCR-ABL wobble pair:
5′-GCAGAGUUCAAAAGCCCUUU(UU)-3′
3′-(UU)CGUCUCAAGUUUUCGGGAAG-5′
siTMPRSS2-ERG junction sequence:
5′-CGGCAGGAAGCCUUAUCAGUU(UU)-3′
3′-(UU)GCCGUCCUUCGGAAUAGUCAA-5′
siTMPRSS2-ERG terminal asymmetry:
5′-CGGCAGGAAGCCUUAUCAGAA(UU)-3′
3′-(UU)GCCGUCCUUCGGAAUAGUCAA-5′
siTMPRSS2-ERG wobble pair:
5′-CGGCAGGAAGCCUUAUCAGUUU(UU)-3′
3′-(UU)GCCGUCCUUCGGAAUAGUCAAG-5′
siLuciferase designed sequence:
5′-GCUAUGAAGCGCUAUGGGC(UU)-3′
3′-(UU)CGAUACUUCGCGAUACCCG-5′
siLuciferase terminal asymmetry:
5′-GCUAUGAAGCGCUAUGGUC(UU)-3′
3′-(UU)CGAUACUUCGCGAUACCCU-5′
siLuciferase wobble pair:
5′-GCUAUGAAGCGCUAUGGGU(UU)-3′
3′-(UU)CGAUACUUCGCGAUACCCG-5′

For BCR-ABL qPCR and Western Blot experiments the siRNA control used was scramble sequence 5′-GGCTAATATCGACCACTGA-3′. For all cell death, TMPRSS2-ERG, and luciferase knockdown experiments the siRNA control used was siGENOME RISC-Free Control (Dharmacon), with the exception of the supplemental cell death experiment performed in U-87 cells for which DNA mimic (synthesized by Yale Keck Biotechnology Resource Laboratory) was used as control.

DNA mimic sequence:
5′-GTCCGGTTGCGCTTTCCTTTC-3′
5′-GAAAGGAAAGCGCAACCGGAC-3′

Quantitative RT-PCR.

K562 cells were plated at a cell density of 80,000 cells per well in 2.5 mL media [RPMI, 10% (vol/vol) FBS, and 1% PS] in a six-well plate and incubated at 37 °C overnight. The next day, cells were treated with 0.5 mL of siRNA/X-tremeGENE siRNA transfection reagent (Roche) in OptiMEM to a final siRNA dose of 1–10 nM in each well as indicated. Untreated control cells were treated with 0.5 mL OptiMEM. Plates were incubated at 37 °C for 48 h. Cytoplasmic RNA was extracted using the RNeasy Mini Kit (Qiagen) and quantified using a NanoDrop (Thermo). Using equal amounts of sample RNA, cDNA was synthesized using the iScript cDNA synthesis kit (BioRad) on a BioRad MyiQ Thermal Cycler. The quantitative RT-PCR was then carried out using the iQ SYBR Green Supermix (BioRad) on the MyiQ Thermal Cycler. BCR-ABL b3a2 was measured using the following primers from literature (6) (synthesized by Yale Keck Biotechnology Resource Laboratory): forward primer: 5′ CATCGTCCACTCAGCCACT 3′ and reverse primer: 5′ ACGAGCGGCTTCACTCAG 3′. The signal obtained for BCR-ABL b3a2 was normalized to the signal obtained for Actin, which was measured using the following primers: forward primer 5′ATTGCCGACAGGATGCAGAA3′ and reverse primer 5′GCTGATCCACATCTGCTGGAA3′.

Western Blotting.

K562 cells were plated at a cell density of 80,000 cells per well in 2.5 mL media [RPMI, 10% (vol/vol) FBS, and 1% PS] in a six-well plate and incubated at 37 °C overnight. The next day, cells were treated with 0.5 mL of siRNA/X-tremeGENE siRNA transfection reagent (Roche) in OptiMEM to a final siRNA dose of 1 or 5 nM in each well. Untreated control cells were treated with 0.5 mL OptiMEM. Plates were incubated at 37 °C for 72 h. Cells were then lysed at 4 °C in RIPA buffer (Sigma) containing Halt Protease Inhibitor Mixture and cell debris was removed by centrifugation. Protein concentration was determined using a BCA Protein Assay (Pierce). Each protein sample was mixed with LDS sample buffer (Invitrogen) and denatured by boiling at 95 °C for 5 min. Equal amounts of protein were loaded onto a 3–8% Tris-acetate gel (Invitrogen) alongside a Precision Plus Protein Kaleidoscope ladder (Bio-Rad). Following electrophoresis, samples were transferred onto an Immmobilon-FL membrane (Millipore), blocked with 5% milk in PBS-Tween, and probed with anti-BCR-ABL (Santa Cruz) (1:500) and anti–α-tubulin (Novus Biologicals) primary antibodies overnight at 4 °C. The membrane was then washed three times for 10 min at room temperature in PBS-Tween and stained with anti-rabbit (1:20,000) and anti-mouse (1:15,000) secondary antibodies conjugated to IRDyes (LI-COR) for 1 h at room temperature. The membrane was washed again three times for 10 min in PBS-Tween and visualized using an Odyssey system (LI-COR).

HEK293T cells were plated at a cell density of 6 × 10⁶ cells per 10-cm dish in 10 mL media [DMEM, 10% (vol/vol) FBS, and 1% PS] and incubated at 37 °C overnight. The next day, cells were treated with 1.5 μg pcDNA 3.1/V5-His-Topo-TE3 plasmid DNA (original plasmid generously provided by the Michael Ittman laboratory, Baylor College of Medicine, Houston, TX) using 32 μL lipofectamine 2000 (Invitrogen) and incubated overnight at 37 °C overnight. The transfected cells were then pooled, resuspended in fresh media, and replated at a cell density of 1 × 10⁶ cells per well in 2.5 mL media in a six-well plate and incubated overnight. The next day, cells were treated with 0.5 mL of siRNA/RNAiMAX transfection reagent (Invitrogen) in OptiMEM to a final siRNA dose of 5 nM in each well. Untreated control cells were treated with 0.5 mL OptiMEM. Plates were incubated at 37 °C for 72 h. Cells were then lysed at 4 °C in RIPA buffer (Sigma) containing Halt Protease Inhibitor Mixture and cell debris was removed by centrifugation. Protein concentration was determined using a BCA Protein Assay (Pierce). Each protein sample was mixed with LDS sample buffer (Invitrogen) and denatured by boiling at 95 °C for 5 min. Equal amounts of protein were loaded onto a 4–12% Bis-Tris gel (Invitrogen) alongside a Precision Plus Protein Kaleidoscope ladder (Bio-Rad). Following electrophoresis, samples were transferred onto an Immmobilon-FL membrane (Millipore), blocked with Odyssey Blocking Buffer (LI-COR), and then probed with anti-V5 primary antibody (Invitrogen) (1:5,000) and anti-GAPDH primary antibody (1:2,000) (Abcam) overnight at 4 °C. The membrane was then washed three times for 10 min at room temperature in PBS-Tween and stained with anti-rabbit (1:10,000) and anti-mouse (1:4,000) secondary antibodies conjugated to IRDyes (LI-COR) for 1 h at room temperature. The membrane was washed again twice for 10 min in PBS-Tween and twice for 10 min in PBS and then visualized using an Odyssey system (LI-COR).

Image Analysis.

The intensities of the bands obtained by Western blotting were quantified using the Bio-Rad Quantity One software. Using the rectangular selection tool, boxes of the same dimension were used to select each band of interest, as well as the background above each band. The intensities from within each rectangular selected area were obtained using the software, and the corresponding background intensity was subtracted from each band’s intensity. The intensity of each fusion gene band was then normalized to the intensity of the housekeeping gene band.

Cell Death.

K562 cells were plated at a cell density of 1 × 10³ cells per well in 90 μL of culture media in a 96-well plate and incubated at 37 °C overnight. The next day, cells were transfected with 10 μL of Lipofectamine/siRNA in Opti-MEM to a final siRNA dose of 5 nM in each well. Untreated control cells were treated with 10 μL Opti-MEM. This treatment was repeated once a day for a total of four consecutive days. Plates were incubated at 37 °C between treatments. Four days following the initial treatment, 100 μL CellTiterGLO (Promega) reagent was added to each well and incubated for 10 min. The luminescence was measured using a plate reader. The percentage viability of each test sample was calculated as Luminescence_test/Luminescence_untreated × 100.

VCap cells were plated at a cell density of 1 × 10³ cells per well in 90 μL of culture media in a 96-well plate and incubated at 37 °C overnight. The next day, cells were transfected with 10 μL of Lipofectamine/siRNA in Opti-MEM to a final siRNA dose of 1 nM, 10 nM, or 100 nM in each well. Untreated control cells were treated with 10 μL Opti-MEM. Plates were incubated at 37 °C for 72 h. Then, 100 μL CellTiterGLO (Promega) reagent was added to each well and incubated for 10 min. The luminescence was measured using a plate reader. The percentage viability of each test sample was calculated as Luminescence_test/Luminescence_untreated × 100.

For using NPs, K562 cells were plated at a cell density of 1 × 10³ cells per well in 90 μL of culture media in a 96-well plate and incubated at 37 °C overnight. The next day, cells were transfected with siRNA-loaded NPs in Opti-MEM to a final siRNA concentration in each well as indicated. Untreated cells were given 10 μL Opti-MEM. Plates were incubated at 37 °C. Four days following the treatment, 100 μL CellTiterGLO (Promega) reagent was added to each well and incubated for 10 min. The luminescence was measured using a plate reader. The percentage viability of each test sample was calculated as Luminescence_test/Luminescence_untreated × 100.

U87-MG cells were plated at a cell density of 1 × 10³ cells per well in 100 μL of culture media in a 96-well plate and incubated at 37 °C overnight. The next day, media was removed and cells were transfected with siRNA-loaded NPs in 100 μL DMEM to a final siRNA concentration as indicated. Untreated cells were given 100 μL DMEM. Plates were incubated at 37 °C. Four days following the treatment, 100 μL CellTiterGLO (Promega) reagent was added to each well and incubated for 10 min. The luminescence was measured using a plate reader. The percentage viability of each test sample was calculated as Luminescence_test/Luminescence_untreated × 100.

Cell Luminescence.

RKO-Luc were plated at a cell density of 10 × 10³ cells per well in 90 μL of culture media in a 96-well plate and incubated at 37 °C overnight. The next day, cells were transfected with 10 μL of Lipofectamine/siRNA in Opti-MEM at a varity of doses. Untreated control cells were treated with 10 μL Opti-MEM. Plates were incubated at 37 °C for 48 h. Then cells were washed with PBS and lysed with Passive Lysis Buffer. Luciferase was quantified using the Luciferase Assay System (Promega) and reported as RLU_test/RLU_control × 100.

NP Synthesis.

siRNA-loaded NPs were synthesized with PLGA (ester terminated, 50:50 monomer ratio, 0.55–0.75 dL/g inherent viscosity; Lactel) using a modified water-in-oil-in-water double-emulsion solvent evaporation technique (21, 25). In short, siRNA (100 nmol) was complexed with polycationic agent spermidine in Tris-EDTA (TE) buffer (10 mM Tris⋅HCl, 1 mM EDTA, pH 7.4) at a polyamine nitrogen to nucleotide phosphate (N:P) ratio of 8:1, then added dropwise to PLGA dissolved in dichloromethane (DCM) while vortexing, and then immediately sonicated on ice to generate the first water-in-oil emulsion. This primary emulsion was then added dropwise to 5% (wt/vol) polyvinyl alcohol (PVA) while vortexing, and again sonicated on ice, producing a secondary water-in-oil-in-water emulsion. The resulting secondary emulsion was then promptly transferred to a solution of 0.3% PVA where NPs were left stirring for 3 h to harden (DCM evaporation). This suspension was then centrifuged to collect NPs. The NPs were washed, lyophilized, and stored at −20 °C until use.

NP Characterization.

After synthesis, siRNA-loaded NPs were assessed for size, morphology, loading, and controlled release. SEM (XL30 ESEM; FEI Co.) was used to visualize the size and morphology of particles formed. Before imaging NP samples were sputter-coated with a 25-nm-thick gold coat using a quick carbon coater. Hydrodynamic diameter and zeta potential were measured by Zetasizer (Malvern).

To quantify loading achieved, siRNA was recovered from synthesized NPs using aqueous phase extraction and quantified by spectrophotometry as described previously (21, 25). Briefly, NPs were dissolved in DCM for >1 h. TE buffer was added to the solution and the mixture was vortexed vigorously before centrifugation (at 16,000 × g for 10 min at 4 °C) to extract siRNA into the top aqueous phase. The amount of siRNA was then quantified using either absorbance at 260 nm or PicoGreen Assay (Invitrogen).

Controlled-release kinetics of prepared NPs were evaluated by incubating NPs at 37 °C in PBS in a shaker and collecting samples at several time intervals for 4 d. At each time point, the NP suspension was centrifuged 16,000 × g for 5 min at and the supernatant was analyzed for total siRNA content. The removed PBS was replaced with an equal volume.

Statistical Analysis.

Unless otherwise stated, data are reported as mean ± SEM where appropriate. For single parametric comparisons, significance is assessed by Student’s unpaired t test. For multiple parametric comparisons, data are analyzed by ANOVA with Bonferroni’s post test. A level of P ≤ 0.05 was considered significant.

Acknowledgments

We thank Drs. S. Patrick Walton, Anna M. Pyle, and Anthony J. Koleske for helpful discussions and invaluable advice; Dr. Kathryn Miller-Jensen for use of the NanoDrop and Odyssey imaging system; and Marcus Russi for assisting with quantitative RT-PCR experiments. This work was supported by NIH Grants EB000487 and HL085416 and NIH Ruth L. Kirschstein National Research Service Award 1F31CA17429801A1 (to K.G.).

Footnotes

↵¹Present address: Alexion Pharmaceuticals, Cheshire, CT 06410.
↵²To whom correspondence should be addressed. Email: mark.saltzman{at}yale.edu.

Author contributions: K.G., Y.-E.S., J.C., and W.M.S. designed research; K.G., Y.-E.S., and J.C. performed research; K.G., G.T.T., C.J.C., and W.M.S. analyzed data; and K.G., G.T.T., C.J.C., and W.M.S. wrote the paper.
The authors declare no conflict of interest.
This article is a PNAS Direct Submission.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1517039112/-/DCSupplemental.

References

↵
1. Gavrilov K,
2. Saltzman WM
(2012) Therapeutic siRNA: Principles, challenges, and strategies. Yale J Biol Med 85(2):187–200
.
OpenUrl PubMed
↵
1. Dahlman JE,
2. Kauffman KJ,
3. Langer R,
4. Anderson DG
(2014) Nanotechnology for in vivo targeted siRNA delivery. Adv Genet 88:37–69
.
OpenUrl CrossRef PubMed
↵
1. Kim DH,
2. Rossi JJ
(2007) Strategies for silencing human disease using RNA interference. Nat Rev Genet 8(3):173–184
.
OpenUrl CrossRef PubMed
↵
1. Whitehead KA,
2. Langer R,
3. Anderson DG
(2009) Knocking down barriers: Advances in siRNA delivery. Nat Rev Drug Discov 8(2):129–138
.
OpenUrl CrossRef PubMed
↵
1. Thomas M,
2. Greil J,
3. Heidenreich O
(2006) Targeting leukemic fusion proteins with small interfering RNAs: Recent advances and therapeutic potentials. Acta Pharmacol Sin 27(3):273–281
.
OpenUrl CrossRef PubMed
↵
1. Arthanari Y,
2. Pluen A,
3. Rajendran R,
4. Aojula H,
5. Demonacos C
(2010) Delivery of therapeutic shRNA and siRNA by Tat fusion peptide targeting BCR-ABL fusion gene in Chronic Myeloid Leukemia cells. J Control Release 145(3):272–280
.
OpenUrl CrossRef PubMed
↵
1. Shao L, et al.
(2012) Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors. Clin Cancer Res 18(24):6648–6657
.
OpenUrl Abstract/FREE Full Text
↵
1. McLaughlin J, et al.
(2007) Sustained suppression of Bcr-Abl-driven lymphoid leukemia by microRNA mimics. Proc Natl Acad Sci USA 104(51):20501–20506
.
OpenUrl Abstract/FREE Full Text
↵
1. Fiszer-Kierzkowska A, et al.
(2011) Liposome-based DNA carriers may induce cellular stress response and change gene expression pattern in transfected cells. BMC Mol Biol 12:27
.
OpenUrl CrossRef PubMed
↵
1. McClain WH,
2. Gabriel K,
3. Schneider J
(1996) Specific function of a G.U wobble pair from an adjacent helical site in tRNA(Ala) during recognition by alanyl-tRNA synthetase. RNA 2(2):105–109
.
OpenUrl Abstract
↵
1. Hermann T,
2. Westhof E
(1999) Non-Watson-Crick base pairs in RNA-protein recognition. Chem Biol 6(12):R335–R343
.
OpenUrl CrossRef PubMed
↵
1. Jinek M,
2. Doudna JA
(2009) A three-dimensional view of the molecular machinery of RNA interference. Nature 457(7228):405–412
.
OpenUrl CrossRef PubMed
↵
1. Davis AR,
2. Kirkpatrick CC,
3. Znosko BM
(2011) Structural characterization of naturally occurring RNA single mismatches. Nucleic Acids Res 39(3):1081–1094
.
OpenUrl Abstract/FREE Full Text
↵
1. Christiansen ME,
2. Znosko BM
(2009) Thermodynamic characterization of tandem mismatches found in naturally occurring RNA. Nucleic Acids Res 37(14):4696–4706
.
OpenUrl Abstract/FREE Full Text
↵
1. Kawano T, et al.
(2007) MUC1 oncoprotein regulates Bcr-Abl stability and pathogenesis in chronic myelogenous leukemia cells. Cancer Res 67(24):11576–11584
.
OpenUrl Abstract/FREE Full Text
↵
1. Spiller DG, et al.
(1998) The influence of target protein half-life on the effectiveness of antisense oligonucleotide analog-mediated biologic responses. Antisense Nucleic Acid Drug Dev 8(4):281–293
.
OpenUrl CrossRef PubMed
↵
1. Bartlett DW,
2. Davis ME
(2006) Insights into the kinetics of siRNA-mediated gene silencing from live-cell and live-animal bioluminescent imaging. Nucleic Acids Res 34(1):322–333
.
OpenUrl Abstract/FREE Full Text
↵
1. Yang E, et al.
(2003) Decay rates of human mRNAs: Correlation with functional characteristics and sequence attributes. Genome Res 13(8):1863–1872
.
OpenUrl Abstract/FREE Full Text
↵
1. Sharova LV, et al.
(2009) Database for mRNA half-life of 19 977 genes obtained by DNA microarray analysis of pluripotent and differentiating mouse embryonic stem cells. DNA Res 16(1):45–58
.
OpenUrl Abstract/FREE Full Text
↵
1. Narsai R, et al.
(2007) Genome-wide analysis of mRNA decay rates and their determinants in Arabidopsis thaliana. Plant Cell 19(11):3418–3436
.
OpenUrl Abstract/FREE Full Text
↵
1. Devalliere J, et al.
(2014) Sustained delivery of proangiogenic microRNA-132 by nanoparticle transfection improves endothelial cell transplantation. FASEB J 28(2):908–922
.
OpenUrl Abstract/FREE Full Text
↵
1. Cheng CJ,
2. Saltzman WM
(2011) Enhanced siRNA delivery into cells by exploiting the synergy between targeting ligands and cell-penetrating peptides. Biomaterials 32(26):6194–6203
.
OpenUrl CrossRef PubMed
↵
1. Heidel JD,
2. Davis ME
(2011) Clinical developments in nanotechnology for cancer therapy. Pharm Res 28(2):187–199
.
OpenUrl CrossRef PubMed
↵
1. Steinbach JM,
2. Weller CE,
3. Booth CJ,
4. Saltzman WM
(2012) Polymer nanoparticles encapsulating siRNA for treatment of HSV-2 genital infection. J Control Release 162(1):102–110
.
OpenUrl CrossRef PubMed
↵
1. Woodrow KA, et al.
(2009) Intravaginal gene silencing using biodegradable polymer nanoparticles densely loaded with small-interfering RNA. Nat Mater 8(6):526–533
.
OpenUrl CrossRef PubMed
↵
1. Deng ZJ, et al.
(2013) Layer-by-layer nanoparticles for systemic codelivery of an anticancer drug and siRNA for potential triple-negative breast cancer treatment. ACS Nano 7(11):9571–9584
.
OpenUrl CrossRef PubMed
↵
1. Foster AA,
2. Greco CT,
3. Green MD,
4. Epps TH 3rd,
5. Sullivan MO
(2015) Light-mediated activation of siRNA Release in diblock copolymer assemblies for controlled gene silencing. Adv Healthc Mater 4(5):760–770
.
OpenUrl CrossRef PubMed
↵
1. Freier SM, et al.
(1986) Improved free-energy parameters for predictions of RNA duplex stability. Proc Natl Acad Sci USA 83(24):9373–9377
.
OpenUrl Abstract/FREE Full Text
↵
1. Mathews DH,
2. Sabina J,
3. Zuker M,
4. Turner DH
(1999) Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 288(5):911–940
.
OpenUrl CrossRef PubMed
↵
1. Kierzek R,
2. Burkard ME,
3. Turner DH
(1999) Thermodynamics of single mismatches in RNA duplexes. Biochemistry 38(43):14214–14223
.
OpenUrl CrossRef PubMed
↵
1. Matveeva OV, et al.
(2010) Optimization of duplex stability and terminal asymmetry for shRNA design. PLoS One 5(4):e10180
.
OpenUrl CrossRef PubMed

Article Alerts

Email Article

Citation Tools

Request Permissions

Article Classifications

Biological Sciences
Applied Biological Sciences

Physical Sciences
Engineering

Proceedings of the National Academy of Sciences: 112 (48)

Table of Contents

Submit

[1] ↵
Gavrilov K,
Saltzman WM
(2012) Therapeutic siRNA: Principles, challenges, and strategies. Yale J Biol Med 85(2):187–200
.
OpenUrl PubMed

[2] Gavrilov K,

[3] Saltzman WM

[4] ↵
Dahlman JE,
Kauffman KJ,
Langer R,
Anderson DG
(2014) Nanotechnology for in vivo targeted siRNA delivery. Adv Genet 88:37–69
.
OpenUrl CrossRef PubMed

[5] Dahlman JE,

[6] Kauffman KJ,

[7] Langer R,

[8] Anderson DG

[9] ↵
Kim DH,
Rossi JJ
(2007) Strategies for silencing human disease using RNA interference. Nat Rev Genet 8(3):173–184
.
OpenUrl CrossRef PubMed

[10] Kim DH,

[11] Rossi JJ

[12] ↵
Whitehead KA,
Langer R,
Anderson DG
(2009) Knocking down barriers: Advances in siRNA delivery. Nat Rev Drug Discov 8(2):129–138
.
OpenUrl CrossRef PubMed

[13] Whitehead KA,

[14] Langer R,

[15] Anderson DG

[16] ↵
Thomas M,
Greil J,
Heidenreich O
(2006) Targeting leukemic fusion proteins with small interfering RNAs: Recent advances and therapeutic potentials. Acta Pharmacol Sin 27(3):273–281
.
OpenUrl CrossRef PubMed

[17] Thomas M,

[18] Greil J,

[19] Heidenreich O

[20] ↵
Arthanari Y,
Pluen A,
Rajendran R,
Aojula H,
Demonacos C
(2010) Delivery of therapeutic shRNA and siRNA by Tat fusion peptide targeting BCR-ABL fusion gene in Chronic Myeloid Leukemia cells. J Control Release 145(3):272–280
.
OpenUrl CrossRef PubMed

[21] Arthanari Y,

[22] Pluen A,

[23] Rajendran R,

[24] Aojula H,

[25] Demonacos C

[26] ↵
Shao L, et al.
(2012) Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors. Clin Cancer Res 18(24):6648–6657
.
OpenUrl Abstract/FREE Full Text

[27] Shao L, et al.

[28] ↵
McLaughlin J, et al.
(2007) Sustained suppression of Bcr-Abl-driven lymphoid leukemia by microRNA mimics. Proc Natl Acad Sci USA 104(51):20501–20506
.
OpenUrl Abstract/FREE Full Text

[29] McLaughlin J, et al.

[30] ↵
Fiszer-Kierzkowska A, et al.
(2011) Liposome-based DNA carriers may induce cellular stress response and change gene expression pattern in transfected cells. BMC Mol Biol 12:27
.
OpenUrl CrossRef PubMed

[31] Fiszer-Kierzkowska A, et al.

[32] ↵
McClain WH,
Gabriel K,
Schneider J
(1996) Specific function of a G.U wobble pair from an adjacent helical site in tRNA(Ala) during recognition by alanyl-tRNA synthetase. RNA 2(2):105–109
.
OpenUrl Abstract

[33] McClain WH,

[34] Gabriel K,

[35] Schneider J

[36] ↵
Hermann T,
Westhof E
(1999) Non-Watson-Crick base pairs in RNA-protein recognition. Chem Biol 6(12):R335–R343
.
OpenUrl CrossRef PubMed

[37] Hermann T,

[38] Westhof E

[39] ↵
Jinek M,
Doudna JA
(2009) A three-dimensional view of the molecular machinery of RNA interference. Nature 457(7228):405–412
.
OpenUrl CrossRef PubMed

[40] Jinek M,

[41] Doudna JA

[42] ↵
Davis AR,
Kirkpatrick CC,
Znosko BM
(2011) Structural characterization of naturally occurring RNA single mismatches. Nucleic Acids Res 39(3):1081–1094
.
OpenUrl Abstract/FREE Full Text

[43] Davis AR,

[44] Kirkpatrick CC,

[45] Znosko BM

[46] ↵
Christiansen ME,
Znosko BM
(2009) Thermodynamic characterization of tandem mismatches found in naturally occurring RNA. Nucleic Acids Res 37(14):4696–4706
.
OpenUrl Abstract/FREE Full Text

[47] Christiansen ME,

[48] Znosko BM

[49] ↵
Kawano T, et al.
(2007) MUC1 oncoprotein regulates Bcr-Abl stability and pathogenesis in chronic myelogenous leukemia cells. Cancer Res 67(24):11576–11584
.
OpenUrl Abstract/FREE Full Text

[50] Kawano T, et al.

[51] ↵
Spiller DG, et al.
(1998) The influence of target protein half-life on the effectiveness of antisense oligonucleotide analog-mediated biologic responses. Antisense Nucleic Acid Drug Dev 8(4):281–293
.
OpenUrl CrossRef PubMed

[52] Spiller DG, et al.

[53] ↵
Bartlett DW,
Davis ME
(2006) Insights into the kinetics of siRNA-mediated gene silencing from live-cell and live-animal bioluminescent imaging. Nucleic Acids Res 34(1):322–333
.
OpenUrl Abstract/FREE Full Text

[54] Bartlett DW,

[55] Davis ME

[56] ↵
Yang E, et al.
(2003) Decay rates of human mRNAs: Correlation with functional characteristics and sequence attributes. Genome Res 13(8):1863–1872
.
OpenUrl Abstract/FREE Full Text

[57] Yang E, et al.

[58] ↵
Sharova LV, et al.
(2009) Database for mRNA half-life of 19 977 genes obtained by DNA microarray analysis of pluripotent and differentiating mouse embryonic stem cells. DNA Res 16(1):45–58
.
OpenUrl Abstract/FREE Full Text

[59] Sharova LV, et al.

[60] ↵
Narsai R, et al.
(2007) Genome-wide analysis of mRNA decay rates and their determinants in Arabidopsis thaliana. Plant Cell 19(11):3418–3436
.
OpenUrl Abstract/FREE Full Text

[61] Narsai R, et al.

[62] ↵
Devalliere J, et al.
(2014) Sustained delivery of proangiogenic microRNA-132 by nanoparticle transfection improves endothelial cell transplantation. FASEB J 28(2):908–922
.
OpenUrl Abstract/FREE Full Text

[63] Devalliere J, et al.

[64] ↵
Cheng CJ,
Saltzman WM
(2011) Enhanced siRNA delivery into cells by exploiting the synergy between targeting ligands and cell-penetrating peptides. Biomaterials 32(26):6194–6203
.
OpenUrl CrossRef PubMed

[65] Cheng CJ,

[66] Saltzman WM

[67] ↵
Heidel JD,
Davis ME
(2011) Clinical developments in nanotechnology for cancer therapy. Pharm Res 28(2):187–199
.
OpenUrl CrossRef PubMed

[68] Heidel JD,

[69] Davis ME

[70] ↵
Steinbach JM,
Weller CE,
Booth CJ,
Saltzman WM
(2012) Polymer nanoparticles encapsulating siRNA for treatment of HSV-2 genital infection. J Control Release 162(1):102–110
.
OpenUrl CrossRef PubMed

[71] Steinbach JM,

[72] Weller CE,

[73] Booth CJ,

[74] Saltzman WM

[75] ↵
Woodrow KA, et al.
(2009) Intravaginal gene silencing using biodegradable polymer nanoparticles densely loaded with small-interfering RNA. Nat Mater 8(6):526–533
.
OpenUrl CrossRef PubMed

[76] Woodrow KA, et al.

[77] ↵
Deng ZJ, et al.
(2013) Layer-by-layer nanoparticles for systemic codelivery of an anticancer drug and siRNA for potential triple-negative breast cancer treatment. ACS Nano 7(11):9571–9584
.
OpenUrl CrossRef PubMed

[78] Deng ZJ, et al.

[79] ↵
Foster AA,
Greco CT,
Green MD,
Epps TH 3rd,
Sullivan MO
(2015) Light-mediated activation of siRNA Release in diblock copolymer assemblies for controlled gene silencing. Adv Healthc Mater 4(5):760–770
.
OpenUrl CrossRef PubMed

[80] Foster AA,

[81] Greco CT,

[82] Green MD,

[83] Epps TH 3rd,

[84] Sullivan MO

[85] ↵
Freier SM, et al.
(1986) Improved free-energy parameters for predictions of RNA duplex stability. Proc Natl Acad Sci USA 83(24):9373–9377
.
OpenUrl Abstract/FREE Full Text

[86] Freier SM, et al.

[87] ↵
Mathews DH,
Sabina J,
Zuker M,
Turner DH
(1999) Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 288(5):911–940
.
OpenUrl CrossRef PubMed

[88] Mathews DH,

[89] Sabina J,

[90] Zuker M,

[91] Turner DH

[92] ↵
Kierzek R,
Burkard ME,
Turner DH
(1999) Thermodynamics of single mismatches in RNA duplexes. Biochemistry 38(43):14214–14223
.
OpenUrl CrossRef PubMed

[93] Kierzek R,

[94] Burkard ME,

[95] Turner DH

[96] ↵
Matveeva OV, et al.
(2010) Optimization of duplex stability and terminal asymmetry for shRNA design. PLoS One 5(4):e10180
.
OpenUrl CrossRef PubMed

[97] Matveeva OV, et al.

Main menu

User menu

Search

Enhancing potency of siRNA targeting fusion genes by optimization outside of target sequence

Significance

Abstract

Results

Theoretical Basis for Rational Design.

Rational Modifications Improve BCR-ABL mRNA and Protein Knockdown.

Effects Dwindle at the Level of Leukemic Cell Death.

Modifications Applied to Anti-TMPRSS2-ERG and Anti-Luciferase siRNA.

Robust and Specific Leukemic Cell Death Can Be Achieved Using a Nontoxic siRNA Delivery Vehicle.

Discussion

Methods

ΔΔG Calculations.

Cells.

siRNA.

Quantitative RT-PCR.

Western Blotting.

Image Analysis.

Cell Death.

Cell Luminescence.

NP Synthesis.

NP Characterization.

Statistical Analysis.

Acknowledgments

Footnotes

References

Citation Manager Formats

Article Classifications

You May Also be Interested in

Similar Articles

Articles

PNAS Portals

Information

Main menu

User menu

Search

Significance

Abstract

Results

Theoretical Basis for Rational Design.

Rational Modifications Improve BCR-ABL mRNA and Protein Knockdown.

Effects Dwindle at the Level of Leukemic Cell Death.

Modifications Applied to Anti-TMPRSS2-ERG and Anti-Luciferase siRNA.

Robust and Specific Leukemic Cell Death Can Be Achieved Using a Nontoxic siRNA Delivery Vehicle.

Discussion

Methods

ΔΔG Calculations.

Cells.

siRNA.

Quantitative RT-PCR.

Western Blotting.

Image Analysis.

Cell Death.

Cell Luminescence.

NP Synthesis.

NP Characterization.

Statistical Analysis.

Acknowledgments

Footnotes

References

Citation Manager Formats

Article Classifications

Sign up for Article Alerts

Jump to section

You May Also be Interested in

Similar Articles

Articles

PNAS Portals

Information