Plant Material.

Plant material from 1,081 P. trichocarpa genotypes, originally collected from wild populations in California, Oregon, Washington, and British Columbia, were planted in a stool bed at the Oregon State University Research Farm in Corvallis, OR (10). During January 2014, dormant branch cuttings were collected and sent to the North Dakota State University’s Agricultural experiment station research greenhouse complex in Fargo, ND. For each genotype, branches were cut into 10 cuttings, measuring 10 cm in length, with at least one bud. Cuttings were soaked in distilled water for 48 h, planted in cone-tainers (Ray Leach SC10 Super Cone-tainers; Stuewe and Sons, Inc.) measuring 3.8-cm in diameter and 21-cm deep filled with growing medium (SunGro Professional Mix #8; SunGro Horticulture Ltd.) amended with 12 g of Nutricote slow release fertilizer (15-9-12) (N-P-K) (7.0% NH₃-N, 8.0% NO₃-N, 9.0% P₂O₅, 12.0% K2O, 1.0% Mg, 2.3% S, 0.02% B, 0.05% Cu, 0.45% Fe, 0.23% chelated Fe, 0.06% Mn, 0.02% Mo, 0.05% Zn; Scotts Osmocote Plus; Scotts Company Ltd.). The cuttings were planted so that the uppermost bud remained above the surface of the growing medium. Plants were grown in a greenhouse with a day/night temperature regime of 20 °C/16 °C and an 18-h photoperiod supplemented with 600 W high-pressure sodium lamps. Slow-release fertilizer was added weekly with 15-30-15 (N-P-K) Jack’s fertilizer (Jr. Peters, Inc.) at 200 ppm for 2 mo to promote root growth, and plants subsequently were fertilized with 20-20-20 (N-P-K) liquid fertilizer (Scotts Peters Professional; Scotts Company, Ltd.) once a week. Plants were watered as needed.

Pathogen Culture.

Three isolates of S. musiva (MN-12, MN-14, and MN-20) collected from three separate trees near Garfield, MN were chosen for inoculation, based on preliminary virulence testing, and were transferred from storage (−80 °C) onto K-V8 [180 mL V8 juice (Campbell Soup Company), 2 g calcium carbonate, 20 g agar, and 820 mL deionized water] growth medium, sealed with Parafilm (Structure Probe, Inc.). Petri plates were placed on a light bench under full-spectrum fluorescent bulbs (Sylvania; Osram Gmbh) at room temperature until sporulation was observed. Following sporulation, five 5-mm plugs were transferred onto another K-V8 plate and grown for 14 d under continuous light. There were total of 200 plates for each isolate.

Inoculation for GWAS.

The experimental design was a randomized complete-block design with four blocks. Plants were inoculated when they reached a minimum height of 30 cm (∼54 d after planting). Plates containing isolates were unsealed, and ∼1 mL of deionized water was added to the plate. Rubbing the medium surface with an inoculation loop dislodged the spores, and the spore suspension was collected with a pipette (7). The spore suspensions were individually bulked from the three isolates at a concentration of 10⁶ spores/mL for each isolate. Plants were taken out of the greenhouse, and their heights were measured before inoculation. They were sprayed with a high-pressure, low-volume gravity-fed air-spray gun (Central Pneumatic; Harbor Freight Tools) at 20 psi until the entire leaf and stem surface was wet (15 mL) and were placed into a black plastic bag for 48 h. Following incubation plants were placed on the greenhouse bench for 3 wk.

Phenotyping.

At 3 wk postinoculation phenotypic responses were characterized by measuring the height of each tree. Subsequently, the number of cankers was counted, and digital images were acquired. This information was analyzed providing a range of phenotypes: (i) number of cankers; (ii) number of cankers/cm, and (iii) disease severity based on digital imagery. Initially the number of cankers and number of cankers/cm were used for the GWAS phenotyping. The order of individuals selected for phenotyping from each block was done randomly. Broad-sense heritability was estimated from mean squares estimates derived from an ANOVA analysis based on 426 genotypes with all four replicates.

GWAS Analysis.

Whole-genome resequencing, SNP/indel calling, and SNPeFF analysis for the 545 individuals of this Populus GWAS population were previously described (10). In this study, we used the same sequencing and analytical pipelines to incorporate an additional 337 genotypes. The resulting SNP and indel dataset is available at https://bioenergycenter.org/besc/gwas/. To assess genetic control, we used the EMMA algorithm in EMMAX software (University of Michigan) with kinship as the correction factor for genetic background effects (27) to compute genotype-to-phenotype associations using 8,253,066 SNP variants with minor allele frequencies >0.05 identified from whole-genome resequencing (10). Four independent replicates of absolute canker numbers and number of cankers/cm were used as phenotypes. A P value threshold of 6.1 × 10⁻⁰⁹ (0.05/8,253,066) was used to determine significance. Deviation of P values from expectation was evaluated using quantile–quantile (QQ) plots with lambda (λ) as the test statistic. Pairwise LD around the four candidate receptors was established using SNPs 5 kb upstream and downstream of the position with the lowest P value.

RNA-Seq Experiment.

The resistant genotype BESC-22 and the susceptible genotype BESC-801 were selected based on the results from the GWAS analysis described above. The experimental design was a randomized complete-block design with three blocks. Each plant-by-time point combination occurred once per block. Each plant was inoculated at three points. Following mRNA extraction, the samples from the three inoculation points were pooled. Each pool was considered a biological replicate for the RNA-seq experiment.

Inoculum was prepared in an identical manner to that described above. However, to ensure that only tissue exposed to the fungal pathogen was used for transcriptome sequencing, position-based inoculations at the lenticels rather than whole-tree inoculations were conducted. Three lenticels on each plant were inoculated with a 5-mm plug of sporulating mycelium from isolate MN-14 and wrapped in Parafilm. At the time of sample collection tissue from all three lenticels was sampled. Approximately 100 mg of symptomatic tissue from each inoculation point was harvested, placed in a MP Biomedicals Lysing Matrix tube, and flash-frozen in liquid nitrogen. The frozen samples were placed in a Bead Beater homogenizer (BioSpec Products) and ground to a fine powder. The mRNA from each sample was isolated using the Dynabeads mRNA DIRECT Kit following the manufacturer’s protocol with the additional steps of adding Ambion Plant Isolation Aid to the lysis buffer as well as a chloroform cleanup step after centrifuging the lysate.

Stranded RNA-seq library(s) were generated and quantified using qPCR. Sequencing was performed on an Illumina HiSeq 2500 (150mer paired-end sequencing). Raw fastq file reads were filtered and trimmed using the JGI QC pipeline. Using BBDuk (https://sourceforge.net/projects/bbmap/), raw reads were evaluated for sequence artifacts by kmer matching (kmer = 25) allowing one mismatch, and detected artifacts were trimmed from the 3′ end of the reads. RNA spike-in reads, PhiX reads, and reads containing any Ns were removed. Quality trimming was performed using the Phred trimming method set at Q6. Following trimming, reads under the length threshold (minimum length 25 bases or one-third of the original read length, whichever was longer) were removed. Raw reads from each library were aligned to the reference genome (28, 29) using TopHat (30). Only reads that mapped uniquely to one locus were counted. FeatureCounts (30) was used to generate raw gene counts. DESeq2 (v1.2.10) (30) was subsequently used to determine which genes were differentially expressed between pairs of conditions. The parameters used to call a gene between conditions was determined at a P value ≤0.05.

RNA-seq differential expression analysis for S. musiva was performed using the Tuxedo suite pipeline (31). Illumina short paired reads were trimmed for quality using Sickle (31) set with a minimum quality score cutoff of 30 and a minimum read length of 100 bp. Using TopHat v2.1.0 (30) and Bowtie2 v2.2.3 (32), we aligned trimmed reads for each sample replicate to combined assembly contigs from S. musiva strain SO2202 (GenBank accession no. GCA_000320565.2) and P. trichocarpa (GenBank accession no. GCF_000002775.3; https://phytozome.jgi.doe.gov/). Reads were mapped with settings “-r 0 -i 36 -I 1000 -p 4” and “-G” with combined gene annotations from the S. musiva and P. trichocarpa reference genomes. S. musiva contigs and mapped reads were extracted using SAMtools v0.1.18. Transcript isoforms for each of the sample replicates were individually assembled and quantified using Cufflinks v2.2.1 (30) guided by the S. musiva reference genome and gene annotations. Transcripts assembled from each alignment were merged using Cuffmerge (30).

Differential gene-expression analysis was performed using Cuffdiff (30). Time-series comparisons were performed for the resistant interaction between BESC-22 and S. musiva at 24 and 72 hpi and the susceptible interaction with BESC-801 and S. musiva at 24 and 72 hpi, with three replicates per time point. These analyses excluded 0 hpi due to low sequencing depth for S. musiva. Differential expression analyses were also performed comparing gene expression at 24 and 72 hpi between the resistant and susceptible interactions.

Generation of Constructs for Protein Expression.

The predicted lectin domains of G-type lecRLK and L-type lecRLK were cloned (23). Briefly, to create Gateway entry clones, truncated coding regions of G-type lecRLK (amino acids 36–192) and L-type lecRLK (amino acids 30–281) were amplified from P. trichocarpa cDNA using the following gene-specific primer pairs: G-RLK1-36F, 5′-AACTTGTACTTTCAAGGCCAGTCTCTCTCTGCAAGC-3′/G-RLK1-192R, 5′-ACAAGAAAGCTGGGTCCTAACCTGGTGCAGGATCTT-3′ and L-RLK2-30F, 5′-AACTTGTACTTTCAAGGCCACTTCATCTATCATGG-3′/L-RLK2-281, 5′-ACAAGAAAGCTGGGTCCTAAGGCAACTTTGACACATC-3′. The control protein was a noncatalytic peptide fragment of Arabidopsis ESK1 (amino acids 44–133) and was amplified from Arabidopsis cDNA using the following gene specific primer pairs: ESK1-44F, 5′-AACTTGTACTTTCAAGGCGTGGAATTGCCGCCG-3′/ESK1133R, 5′-ACAAGAAAGCTGGGTCCTACGAACGGGAAATGATAC-3′. Underlined sequences indicate the partial attB adapter sequences appended to the primers for the first round of PCR amplification, and bold sequences denote the inserted STOP codon. A second set of universal primers, attB_Adapter-F, 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTCTGAAAACTTGTACTTTCAAGGC-3′/attB_Adapter-R, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3′, was used to complete the attB recombination site and append a tobacco etch virus (TEV) protease cleavage site (24). The attB-PCR product was cloned into pDONR221 (Life Technologies) using Gateway BP Clonase II Enzyme Mix (Life Technologies) to create entry clones. To generate expression clones of G-type lecRLK (pGEn2-EXP-G-type lecRLK36-192) and L-type lecRLK (pGEn2-EXP-L-type lecRLK30-281), the entry clones were recombined into a Gateway-adapted version of the pGEn2 mammalian expression vector (pGEn2-DEST) (25) using Gateway LR Clonase II Enzyme Mix (Life Technologies). The resulting expression constructs (His-GFP-G-type lecRLK^∆36–192 and His-GFP-L-type lecRLK^∆30–281) encode fusion proteins comprised of an N-terminal signal sequence, an 8xHis tag, an AviTag recognition site, the superfolder GFP (sfGFP) coding region, the recognition sequence of the TEV protease, and the indicated lectin domains. For transfection, plasmids were purified using the PureLink HiPure Plasmid Filter Maxiprep Kit (Life Technologies).

Expression and Purification of His-GFP-G-Type lecRLK36-192 and His-GFP-L-Type lecRLK30-281.

Recombinant expression was performed by transient transfection of suspension cultured HEK293-F cells (FreeStyle 293-F cells; Thermo Fisher Scientific) in a humidified CO₂ platform shaker incubator at 37 °C with 80% humidity. The HEK293-F cells were maintained in Freestyle 293 expression medium (Thermo Fisher Scientific), and transfection with plasmid DNA using polyethyleneimine as transfection reagent (linear 25-kDa polyethyleneimine; Polysciences, Inc.) was performed as previously described (22, 23). After 24 h, the cell cultures were diluted 1:1 with fresh medium supplemented with valproic acid (2.2 mM final concentration), and protein production was continued for an additional 4–5 d at 37 °C. The cell culture was harvested, clarified by sequential centrifugation at 241 × g for 10 min and 2,054 × g for 20 min, and passed through a 0.45-µM filter (Millipore).

All chromatography experiments were carried out on an ÄKTA FPLC System (GE Healthcare). The medium was adjusted to contain Hepes (50 mM, pH 7.2), sodium chloride (400 mM), and imidazole (20 mM) before column loading. Small-scale purification of His8-GFP–tagged enzymes secreted into the culture medium by HEK293 cells was performed using HisTrap HP columns (GE Healthcare). To eliminate the possibility of protein contamination, purification of each enzyme was carried out on an individual 1-mL HisTrap HP column. Before use, a blank run was performed on each new column to remove any weakly bound Ni²⁺ ions. Adjusted medium was loaded onto HisTrap HP columns (GE Healthcare) equilibrated with buffer A [50 mM Hepes (pH 7.2), 0.4 M sodium chloride, and 20 mM imidazole]. The columns were washed and eluted with a step gradient consisting of five column volumes per condition of buffer A to buffer B [50 mM Hepes (pH 7.2), 0.4 M sodium chloride, and 500 mM imidazole]. These consisted of three sequential wash steps of 0%, 10%, and 20% buffer B, followed by two elution steps of 60% and 100% buffer B. Fractions containing GFP fluorescence (60% buffer B elution) were collected and pooled. Protein purity was assessed by SDS-PAGE. Purified His-GFP-G-type lecRLK36-192 and His-GFP-L-type lecRLK30-281 were concentrated to ∼1.5 mg/mL using a 30-kDa–cutoff Amicon Ultra centrifugal filter device (Merck Millipore, www.emdmillipore.com/US/en?bd=1) and dialyzed (3,500 molecular weight cutoff) into binding buffer without divalent metals [75 mM Hepes⋅HCl (pH 6.8), 150 mM NaCl] in the presence of Chelex 100 Molecular Biology Grade Resin (1 g/L; Bio-Rad) and used directly for binding experiments. Protein concentrations were determined with the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) and BSA standards.

Growth of S. musiva in Liquid Culture.

Sporulating 1-wk-old S. musiva cultures growing on solid K-V8 medium [180 mL/L V8 juice, 2 g/L CaCO3, 2% (vol/vol) agar] were rinsed with 1 mL of sterile double-distilled water, and the conidia were dislodged with an inoculating loop. For the inoculation of the liquid cultures, 200-µL aliquots of the spore suspensions were pipetted into 100 mL of liquid K-V8 medium in 250-mL Erlenmeyer flasks. The cultures were incubated at ambient temperature in darkness for 5 d. During the incubation, the cultures were constantly agitated at 150 rpm with an orbital platform shaker (Innova 2100; New Brunswick). To harvest the mycelium, the cultures were filtered with Miracloth (EMD Millipore). The harvested mycelium was rinsed with 50 mL of double-distilled water and squeezed dry by pressing the mycelium inside the Miracloth between stacks of paper towels. Finally, 50-mg mycelium samples were collected and lyophilized for lectin-binding assays.

Analysis of Lectin Binding to S. musiva Cell Walls.

To evaluate the ability of recombinant plant lectins to bind to S. musiva, cell walls from cultured fungi were sequentially extracted with cold water, hot water, and aqueous KOH as described in ref. 33, with minor modifications. Briefly, freeze-dried fungal mycelium was resuspended in cold water (100 mL/g) containing sodium azide (0.02%) and was extensively homogenized using a Polytron homogenizer (Brinkmann Instruments) in a cold room at 4 °C. The homogenate was centrifuged at 15,302 × g for 15 min, and the pellet was washed extensively with cold water. The debris containing the cell walls was resuspended in hot water containing sodium azide (0.02%), homogenized again, and incubated at 60 °C overnight in a shaking incubator (250 rpm). The pellets were collected again by centrifugation, treated with hot water for 1 h, and centrifuged again. This was repeated another two times. The washed pellets were resuspended in 1 M KOH containing sodium borohydride (1%) and were incubated overnight at 30 °C. Next, residues were pelleted again and washed extensively with water. A portion of the hot water and KOH insoluble S. musiva cell walls was collected, washed extensively with acetone, and air-dried under vacuum.

Lectin-binding assays were carried out based on the methods of Lim et al. (34) with minor modifications. Microcrystalline cellulose (Avicel PH-101; Sigma-Aldrich) was used as a control substrate for all binding assays. For lectin pulldown assays, 2 mg of each dry substrate was carefully weighed into tubes. Then 250 μL of protein (50 μg/mL) in lectin-binding buffer [75 mM Hepes⋅HCl (pH 6.8), 150 mM NaCl, 5 mM MnCl₂, 5 mM CaCl₂, 1 mg/mL BSA] was added, and samples were incubated for 2 h at room temperature with end-over-end rotation. Samples were centrifuged (13,523 × g, 5 min), and 100 μL of the supernatants containing the unbound proteins was assayed for GFP fluorescence (excitation, 415 nm; emission, 550 nm). The percent of bound enzyme was calculated by the depletion method (35).

In Vivo Overexpression of L-Type lecRLK and G-Type lecRLK in Populus Protoplasts.

For protoplast transfection, protoplasts from P. tremula × P. alba clone INRA 717-1-B4 were isolated and subsequently transfected, as previously described (36). For overexpression, 10 µg of L-type lecRLK constructs with a 35S promoter and vector control were transfected into 100 µL of protoplasts. After 12 h incubation, protoplasts were collected by 2-min centrifugation at 2,000 × g and were frozen in liquid nitrogen for the qRT-PCR experiment.

Generation of Transgenic Populus Hairy Roots.

To generate binary vectors of G-type lecRLK for hairy roots transformation, the cDNA sequence was first cloned into pENTR/D TOPO vectors and then into the pGWB402omega binary vector by LR recombination reaction. The binary vector was transformed into Agrobacterium rhizogenes strain ARqua1 by electroporation, and hairy roots were generated by transforming P. tremula × P. alba clone INRA 717-1-B4 with A. rhizogenes (37). Hairy-root cultures were inoculated with S. musiva in a manner similar to that described above. Briefly, each plate was sprayed with a suspension of 1 × 10⁶ spores/mL of S. musiva isolate MN-14. The mock-inoculated roots were sprayed with sterile distilled water. After a 24-h incubation period samples were flash-frozen in liquid nitrogen for RNA extraction and the qRT-PCR experiment.

RNA Extraction and qRT-PCR.

RNA was extracted from protoplasts and hairy-roots samples using the Sigma plant RNA extraction kit. cDNA synthesis was performed using DNase-free total RNA (1.5 µg), oligo dT primers, and RevertAid Reverse Transcriptase (Thermo Fisher). qRT-PCR was performed using 3 ng cDNA, 250 nM gene-specific primers, and iTaq Universal SYBR Green Supermix (Bio-Rad). Gene expression was calculated by the 2ΔΔCt method using UBQ10b as the internal control.

Primers.

The following primers were used:

• UBQ10b_F GCCTTCGTGGTGGTTATTAAGC

• UBQ10b_R TCCAACAATGGCCAGTAAACAC

• BAK1a_F TGGCATCCTGATGAGAACAG

• BAK1a_R AAAGGTCCAAACCACTTACGC

• BAK1b_F GGAGATGGCATTTGTGAAGG

• BAK1b_R GCTCGAAAGATGACCAATCC

• WRKY40_F CATGGATGTCTTTCCCTCTTG

• WRKY40_R TTCTCTTTCTGCCTGTGTTCC

• WRKY70a_F ACTATCATCAAGCAGGGAAAGG

• WRKY70a_R TTCTGGAGGCGAATTTGAAG

• WRKY70b_F GAATCTGCTGATTTCGATGATG

• WRKY70b_R AGGCGGAAATTACAAAGAAGC