Modulating the body's networks could become mainstream therapy for many health issues.
Image credit: The Feinstein Institutes for Medicine Research.
New Research In
Physical Sciences
Featured Portals
Articles by Topic
Biological Sciences
Featured Portals
Articles by Topic
Edited by Robert Langer, Massachusetts Institute of Technology, Cambridge, MA, and approved May 6, 2016 (received for review February 22, 2016)
Article Figures & SI
Figures
- Fig. 1.
S. pneumoniae pathogenesis outcomes and infectious disease statistics in the United States (1998–2013). (A) S. pneumoniae colonizes the human nasopharynx and produces a bacterial biofilm with an accompanying extracellular matrix capable of providing protection from external and host challenges. External triggers such as viral infection prompt the active release of virulent pneumococci that disseminate to secondary sites and cause disease. (B) Leading vaccination strategies [polysaccharide conjugate vaccines (PCVs), such as the Prevnar family] mediate protection against certain bacterial serotypes by promoting clearance of pneumococci before biofilm establishment. Clearing all bacteria opens the niche to colonization by nonvaccine serotypes or other bacterial species. (C) The strategy featured in this work mediates clearance of only virulent biofilm-released bacteria while maintaining the presence of the preexisting biofilm. (D) The annual infection rate per 100,000 people for the total population (blue) and children under the age of 5 y (red), 1998–2013. The first years following the introduction of Prevnar 7 and 13 are marked with dotted lines. (E) Prevalence of infectious pneumococcal strains, 1998–2013 (29). Strains are grouped into those covered by Prevnar 7 (blue), those covered by Prevnar 13 (red), and nonvaccine types (NVT; green). (F) The reduction in the annual infection rate in children under the age of 5 y from 1998–2008 relative to 1998–1999. The dashed line corresponds to the division between Prevnar 7 vaccine and nonvaccine type strains in 1999–2000 (35). (G) The reduction in the annual infection rate in children under the age of 5 y, 2008–2013. The dashed line corresponds to the division between Prevnar 13 vaccine and nonvaccine type strains in 2008–2009 (35).
- Fig. 2.
Antigen identification and S. pneumoniae conditioning through an in vitro biofilm model. (A) S. pneumoniae were seeded on epithelial cells, and the biofilm structure was investigated using SEM. Visible in these images are the extracellular matrix, water channels, tower formations, and the honeycomb structure that pneumococci form with larger biofilms. (B and C) Mouse bacterial burden was determined after i.p. injections (sepsis model) (B) or aspiration with anesthesia (pneumonia model) (C) using broth-grown (Planktonic), biofilm-associated (Biofilm), or biofilm heat-released (Heat) S. pneumoniae strain EF3030. Each dot in the graphs represents an individual mouse. The dotted line represents the limit of detection for bacterial counts. (D) Time-to-death assessment of mice inoculated with biofilm heat-released bacteria; mice that were inoculated with either planktonic or biofilm-associated bacteria did not die in any challenge model. (E–G) Mice were immunized with various antigens and challenged with biofilm heat-released EF3030 in sepsis (E and F) and pneumonia (G) models. ***P < 0.001, compared with planktonic and biofilm samples (B and C) and PspA (E).
- Fig. S1.
Characterization of Co-PoP liposomal delivery device. (A and B) HPLC analysis of Co-PoP (A) and the resulting mass spectrum (B). (C) Liposome-binding analysis for all proteins used in the study. (D and E) Particle diameter (D) and zeta potential (E) of liposomes formulated with 0, 5, and 15 μg of PspA.
- Fig. 3.
Directed clearance of biofilm-released bacteria and protection against mouse-passaged challenge strains. (A) Bacterial burden at various anatomical sites was determined daily in unimmunized (filled circles) and GlpO + PncO immunized (open circles) mice. Mice were inoculated intranasally without anesthesia with planktonic or biofilm heat-released EF3030 (Upper) or D39 (Lower) bacteria. (B) Comparative analysis of the planktonic (black) and biofilm-released (red) EF3030 clinical isolate data from A. A value of 100% represents no difference between immunized and unimmunized subjects; values below 100% indicate a directed response. A full statistical comparison is presented in Table S5. (C and D) Protective capabilities of GlpO + PncO immunization were evaluated further in sepsis (C) and pneumonia (D) models with established mouse-passaged pneumococcal bacteria. Dotted lines represent the limit of detection for bacterial counts.
- Fig. S2.
Characterization of biofilm-released D39 bacterial virulence and vaccine protective capabilities. (A and B) Bacterial burden was determined for pneumococcal populations after i.p. injections (sepsis model) (A) or intranasal aspiration after anesthesia (pneumonia model) (B). Mice were inoculated with broth-grown (Planktonic), biofilm-associated (Biofilm), or biofilm heat-released (Heat) D39. Each dot in the graphs represents an individual mouse; an “x” represents a mouse that became moribund and was killed before the end of the experiment. The dotted line represents the limit of detection for bacterial counts. (C and D) Time-to-death assessment of mice inoculated with heat-released bacteria from the sepsis (C) and pneumonia (D) models after immunization with PspA or GlpO + PncO.
- Fig. S3.
Bacterial burden associated with protection against mouse-passaged pneumococcal challenge strains. Mice were immunized with GlpO + PncO and challenged with planktonic D39 (A), A66.1 (B), WU2 (C), and TIGR4 (D) cells in either a sepsis or pneumonia model. Dotted lines represent the limit of detection for bacterial counts.
- Fig. S4.
Characteristics of directed clearance and protection against an expanded set of strains. (A) Directed clearance of biofilm-released bacteria in passively immunized mice. Bacterial burden at various anatomical sites was determined daily in unimmunized (filled circles) and GlpO + PncO passively immunized (open circles) mice. Mice were inoculated intranasally without anesthesia with planktonic (red) or biofilm heat-released (blue) EF3030. Dotted lines represent the limit of detection for bacterial counts. (B) Protective capabilities of GlpO + PncO immunization were evaluated further in the sepsis model using an expanded set of mouse pneumococcal strains. *P < 0.05, **P < 0.01, and ***P < 0.001; NS, not significant.
- Fig. 4.
Bacterial dissemination and time-to-death assessment of mice stably colonized with pneumococci and triggered with IAV. (A and B) Bacterial burden of EF3030 or D39 in unimmunized or GlpO + PncO immunized mice was measured at 1 (A) or 5 (B) d postinfection with IAV. The dotted line represents the limit of detection for bacterial counts. (C and D) Protective capabilities of traditionally or passively GlpO + PncO immunized mice against in vivo IAV-mediated bacterial release of EF3030 (C) or D39 (D). *P < 0.05, **P < 0.01, ***P < 0.001; NS, not significant.
- Fig. S5.
Schedule of immunization and bacterial challenge.
Tables
Antigen gene Primers Source Restriction sites Plasmid Name dexB F: TAAGCACATATGCAAGAAAAATGGTGGCATAATGCCGTAG D39 NdeI/XhoI pET21c pCJ05 R: TAAGCACTCGAGTTCCACACAGAAAGCATCCCA htrA F: TAAGCACCATGGGGAAACATCTAAAAACATTTTACAA D39 NcoI/XhoI pET20b pCJ06 R: TAAGCACTCGAGAGATTCTAAATCACCTGAAC glpO F: TAAGCAGAGCTCGAATTTTCAAAAAAAACACGTGAATTGTC D39 SacI/XhoI pET21c pCJ07 R:TAAGCACTCGAGATTTTTTAATTCTGCTAAATCGTTGTTAG stkP F:TAAGCACATATGATCCAAATCGGCAAGATTTT D39 NdeI/NotI pET21c pCJ08 R: TAAGCAGCGGCCGCAGGAGTAGCTGAAGTTGTTTTA blpB F: TAAGCACCATGGGGAATCCTAATCTTTTTAGAAG D39 NcoI/XhoI pET20b pCJ09 R: TAAGCACTCGAGATCAGAATGGGTTAAAATTTTA pncO F:TAAGCACATATGAAAAAGTATCAACTTCTATT EF3030 NdeI/XhoI pET21c pCJ10 R: TAAGCACTCGAGCCCCAAGACCCTATGTAGAAAA prtA F: TAAGCAGAGCTCAAAAAAAGCACAGTATTGTC D39 SacI/XhoI pET21c pCJ12 R:TAAGCACTCGAGATCTTGATTTTTTTTCTTCAAT - Table S5.
Statistical comparison of the percent of directed vaccine effect for anatomical locations indicated in Fig. 3B
Day Mean diff. 95% CI of diff. Significant Nasopharynx 1 30 24.02–35.98 Yes 2 31 25.02–36.98 Yes 3 56 50.02–61.98 Yes 4 96 90.02–102 Yes 5 84 78.02–89.98 Yes 6 83 77.02–88.98 Yes 7 61 55.02–66.98 Yes 8 94 88.02–99.98 Yes 9 104 98.02–110 Yes 10 43 37.02–48.98 Yes 11 75 69.02–80.98 Yes 12 71 65.02–76.98 Yes 13 60 54.02–65.98 Yes 14 66 60.02–71.98 Yes Nasopharynx lavage 1 98 92.02–104 Yes 2 135 129–141 Yes 3 64 58.02–69.98 Yes 4 43 37.02–48.98 Yes 5 96 90.02–102 Yes 6 112 106–118 Yes 7 100 94.02–106 Yes 8 83 77.02–88.98 Yes 9 40 34.02–45.98 Yes 10 25 19.02–30.98 Yes 11 61 55.02–66.98 Yes 12 50 44.02–55.98 Yes 13 33 27.02–38.98 Yes 14 41 35.02–46.98 Yes Lung 1 −22 −27.98 to −16.02 Yes 2 33 27.02–38.98 Yes 3 52 46.02–57.98 Yes 4 37 31.02–42.98 Yes 5 26 20.02–31.98 Yes 6 59 53.02–64.98 Yes 7 54 48.02–59.98 Yes 8 59 53.02–64.98 Yes 9 58 52.02–63.98 Yes 10 49 43.02–54.98 Yes 11 47 41.02–52.98 Yes 12 54 48.02–59.98 Yes 13 77 71.02–82.98 Yes 14 65 59.02–70.98 Yes CI, confidence interval; Mean Diff., mean difference between planktonic and biofilm-released values. All adjusted P values <0.0001.
Strain Capsule type (serotype) Virulence pattern Included in current vaccines Protection in this study, % D39 2 1 Yes 100 D39, heat-released 2 4 Yes 100 DBL2 2 2 Yes 100 A66.1 3 1 Yes 100 WU2 3 1 Yes 100 ATCC6303 3 2 Yes 100 3JYP2670 3 2 Yes 50 TIGR4 4 2 Yes 100 DBL5 5 2 Yes 66 WCH16, heat-released 6A 4 Yes 50 DBL6A 6B 2 Yes 66 ATCC-6312, heat-released 12F 4 No 83 ATCC-10354, heat-released 15B 4 No 100 EF3030 19F 3 Yes 100 EF3030, heat-released 19F 4 Yes 100 ATCC-6324, heat-released 24 4 No 100 ATCC-6327, heat-released 27 4 No 100 Virulence pattern classification Carriage Lung infection Sepsis Comments 1 — ++ +++ Bacteria carries poorly and transitions to the blood wherever placed 2 ± ++ ++ Bacteria causes strong infection wherever placed; occasionally will transition to the blood and cause death 3 ++ +++ ± Bacteria carries well and infects locally but is unlikely to kill; rarely transitions to the blood and causes death 4 ++ +++ ++ Bacteria carries well and causes strong infection wherever placed and can transition to the blood Gene Size, bp Function Virulent gene expression (log2) relative to Average log2 fold change Surface accessible Strain conservation, % homology Planktonic Biofilm Full protein Surface-accessible regions Surface-accessible epitopes pncO 690 Bacteriocin ABC transporter transmembrane protein 8.5 4.8 6.6 Yes 95 93 97 glpO 1,827 α-Glycerophosphate oxidase 9 5.9 7.4 Yes 99 98 98 Gene expression values were determined by Pettigrew et al. (36), and surface accessibility was established using the InterPro database (www.ebi.ac.uk/interpro/). Strain conservation was calculated by accounting for gap and mismatches in the gene sequences of 30 S. pneumoniae strains with complete genomes available in BLAST (blast.ncbi.nlm.nih.gov/Blast.cgi). Epitope regions were predicted with the BepiPred linear epitope prediction method using IEDB Analysis Resource (tools.immuneepitope.org/bcell/).
Data supplements
Supporting Information
Directed vaccination
Sign up for Article Alerts
Jump to section
You May Also be Interested in
Adaptations in heart structure and function likely enabled endurance and survival in preindustrial humans.
Image courtesy of Pixabay/Skeeze.
Viscoelastic carrier fluids enhance retention of fire retardants on wildfire-prone vegetation.
Image courtesy of Jesse D. Acosta.
Water requirements may make desert bird declines more likely in a warming climate.
Image courtesy of Sean Peterson (photographer).
QnAs with NAS member and plant biologist Sheng Yang He
Image courtesy of Sheng Yang He.