Supporting Methods

Cell Lysate Preparation. Cells grown under the previously specified conditions were lysed in the following lysis buffer: 20 mM Tris, pH 7.4/150 mM NaCl/1% Nonidet P-40/ 10% glycerol/1 mM EDTA/1 mM EGTA/5 mM sodium pyrophosphate/50 mM NaF/10 nM b -glycerophosphate/1 mM sodium vanadate/0.5 mM DTT/4 m g/ml leupeptin/4 m g/ml pepstatin/4 m g/ml apoprotein/1 mM PMSF. After cell lysis, lysates were centrifuged at 16,000 ´ g for 5 min at 4°C. The supernatant was used for subsequent procedures.

Reagents and Cell Lines. Anti-phospho-Akt (Ser-473), anti-total Akt, anti-EGFR, anti-phospho-ErbB-2, and anti-phospho-ErbB-3 (Tyr-1289) antibodies were obtained from Cell Signaling Technology (Beverly, MA). Anti-ErbB-2 antibody was obtained from Calbiochem. Anti-ErbB-3 antibody was obtained from Lab Vision (Fremont, CA). Anti-b -actin antibody was obtained from Sigma. Anti-EGFR was obtained from Santa Cruz Biotechnology (sc-03). Anti-p85 antibody was obtained from Upstate Biotechnology (Lake Placid, NY). H1299, H23, A549, H522, and H322 are patient-derived NSCLC cell lines purchased from the American Type Culture Collection (ATCC) and propagated in RPMI medium 1640 supplemented with 10% FBS. H358 and Calu-3 are patient-derived NSCLC cell lines that were kindly provided by Dr. Balazs Halmos (Beth Israel Deaconess Medical Center, Boston). These were also grown in RPMI supplemented with 10% FBS. A431 cells were kindly provided by Stephen Soltoff (Beth Israel Deaconess Medical Center, Boston) and propagated in DME supplemented with 10% FBS. NCI-H3255 cells were isolated and propagated as described in ref. 1. The DFCILU-011 cell line was established from a male nonsmoking patient with adenocarcinoma of the lung treated at the Dana-Farber Cancer Institute and propagated in DME supplemented with 10% FBS (T.M., J.A.E., N. Hanna, S. Kobayashi, N. Lindeman, B. Halmos, J.P., L.C.C., D. Tenen, B.E.J., and P.A.J., unpublished data). CHO-K1 cells were purchased from ATCC and grown in DMEM/F12 supplemented with 10% FBS. Gefitinib was generously provided by AstraZeneca (Wilmington, DE).

EGFR L858R Mutant. L858R mutation was constructed according to Stratagene’s QuikChange Site-Directed Mutagenesis kit by using the following oligonucleotides: sense CACAGATTTTGGGCGGGCCAAACTGCTGGG and antisense CCCAGCAGTTTGGCCCGCCCAAAATCTGTG. The mutant was confirmed by DNA sequencing.

shRNA Constructs. The following oligonucleotides were used to create the shRNA constructs (targeted sequence is underlined). The number used to designate each construct corresponds to the nucleotide position according to GenBank accession no. NM_001982.

"475" forward, CCGGATTCTCTACTCTACCATTGCCTCGAGGCAATGGTAGAGTAGAGAATTTTTTG; "475" reverse, AATTAAAAAATTCTCTACTCTACCATTGCCTCGAGGCAATGGTAGAGTAGAGAAT; "1117" forward, CCGGCCTGACAAGATGGAAGTAGATCTCGAGATCTACTTCCATCTTGTCAGGTTTTTG; "1117" reverse; AATTAAAAACCTGACAAGATGGAAGTAGATCTCGAGATCTACTTCCATCTTGTCAGG; "1639" forward, CCGGCGACTAGACATCAAGCATAATCTCGAGATTATGCTTGATGTCTAGTCGTTTTTG; "1639" reverse, AATTAAAAACGACTAGACATCAAGCATAATCTCGAGATTATGCTTGATGTCTAGTCG; "4160" forward, CCGGCTGCCTTTGATAACCCTGATTCTCGAGAATCAGGGTTATCAAAGGCAGTTTTTG; "4160" reverse, AATTAAAAACTGCCTTTGATAACCCTGATTCTCGAGAATCAGGGTTATCAAAGGCAG; "4570" forward, CCGGGCTCTTATGTGTGCCTTTGTTCTCGAGAACAAAGGCACACATAAGAGCTTTTTG; "4570" reverse, AATTAAAAAGCTCTTATGTGTGCCTTTGTTCTCGAGAACAAAGGCACACATAAGAGC; "4705" forward, CCGGGGTTAGGAGTAGATATTGACCTCGAGGTCAATATCTACTCCTAACCTTTTTG; and "4705" reverse, AATTAAAAAGGTTAGGAGTAGATATTGACCTCGAGGTCAATATCTACTCCTAACC.

The 475 construct was the most efficient in blocking cotransfected ErbB-3 expression (>90%, data not shown) and was used for infection of cell lines. Virus produced from the parental vector was used as control. Lentivirus production and infections were performed as described in ref. 2. Two days after infection, cells were split into two aliquots. One-half of the cells were placed into media containing puromycin (to assess for infection efficiency), and the other half were placed into medium without selection. Three days after plating, the cells grown in medium without selection were lysed, and the extracts were used for Western blot analysis. Of note, all of the infections were efficient (>90%), with no appreciable cell death observed in puromycin selection.

Transient Transfections. CHO cells were seeded in six-well plates at » 50% confluency. Transient transfections were performed with lipofectamine plus (Invitrogen) according to the manufacturer’s recommendations. ErbB-3 or GFP (0.2 m g) was cotransfected with 0.2 m g of the WT EGFR or EGFR L858R. The cells were placed in serum-free medium 30 h after transfection. They were kept in serum-free medium overnight and then stimulated with EGF (60 ng/ml) for 10, 60, or 240 minutes. The samples were lysed in ice-cold lysis buffer. Protein quantitation was performed with BCA assay, and 40 m g of protein lysate was used for SDS/PAGE and Western blot analysis.

Sequencing of EGFR and K-Ras. RNA was isolated from cell lines by using the RNEasy RNA isolation kit (Qiagen, Valencia, CA). cDNA was transcribed from 2 m g of total RNA with Superscript II Reverse Transcriptase (Invitrogen). The cDNA was used as template for subsequent PCR amplifications of EGFR. The details of the PCR conditions and the primers have been previously published (1). K-Ras sequencing was designed to cover codons 12,13, and 61. The entire EGFR coding region was sequenced. The PCR conditions and primer sequences are available upon request. The PCR products were sequenced according to the manufacturer’s recommendations and as described in ref. 3.

1. Paez, J. G., Jänne, P. A., Lee, J. C., Tracy, S., Greulich, H., Gabriel, S., Herman, P., Kaye, F. J., Lindeman, N., Boggon, T. J., et al. (2004) Science 304, 1497-1500.

2. Sage, J., Miller, A. L., Perez-Mancera, P. A., Wysocki, J. M. & Jacks, T. (2003) Nature 424, 223-228.

3. Tracy, S., Mukohara, T., Hansen, M., Meyerson, M., Johnson, B. E. & Jänne, P. A. (2004) Cancer Res. 64, 7241-7244.