Modulation of reactivation of latent herpes simplex virus 1 in ganglionic organ cultures by p300/CBP and STAT3
Contributed by Bernard Roizman, May 24, 2013 (sent for review May 9, 2013)
Significance
HSVs initiate human infections with the aid of viral tegument proteins brought along with viral DNA into cells. These viruses then enter and establish latent, silent infection in sensory ganglia. Periodically, HSV reactivates from a latent state. A key unresolved question is the mechanism by which the virus reactivates in the absence of the tegument proteins. Studies of murine trigeminal ganglia harboring latent virus and maintained in organ cultures suggest that viral DNA is maintained in a dynamic equilibrium favoring gene repression. The equilibrium shifts toward gene expression on inactivation of histone deacetylases, inhibition of STAT3, or activation of p300/CBP.
Abstract
A key property of herpes simplex viruses (HSVs) is their ability to establish latent infection in sensory or autonomic ganglia and to reactivate on physical, hormonal, or emotional stress. In latently infected ganglia, HSV expresses a long noncoding RNA and a set of microRNAs, but viral proteins are not expressed. The mechanism by which latent HSV reactivates is unknown. A key question is, what is the mechanism of reactivation in the absence of tegument proteins that enable gene expression in productive infection? Elsewhere we have reported the use of ganglionic organ cultures that enable rapid reactivation in medium containing antibody to NGF or delayed reactivation in medium containing NGF and EGF. We also reported that in the ganglionic organ cultures incubated in medium containing antibody to NGF, all viral genes are derepressed at once without requiring de novo protein synthesis within the time frame of a single replicative cycle. Here we report that latent HSV in ganglia immersed in medium containing NGF and EGF is reactivated by (i) broad spectrum as well as specific histone deacetylase 1 or histone deacetylase 4 inhibitors, (ii) activation of p300/CBP, and (iii) either STAT3 carrying the substitution of tyrosine 705 to phenylalanine or an inhibitor of STAT3. Conversely, reactivation of latent HSV was blocked by p300/CBP inhibitor in medium containing antibody to NGF. The results suggest that (i) STAT3 is required for the maintenance of the latent state and interference with its functions leads to reactivation and (ii) p300/CBP is essential for HSV reactivation.
Sign up for PNAS alerts.
Get alerts for new articles, or get an alert when an article is cited.
Herpes simplex viruses 1 and 2 (HSV-1 and HSV-2) are common human pathogens that are transmitted from person to person by physical contact between infected and uninfected tissues. Characteristically, these viruses vigorously replicate at the portal of entry into the body. Concurrently they are transported retrograde to neurons of ganglia innervating that site (1). In neurons, the viruses establish a latent infection (2, 3). In the course of latent infection, the genes expressing the viral proteins are repressed (4, 5), and only a long noncoding RNA designated as a latency-associated transcript (LAT) (6–9) and microRNAs are expressed (10–12). Periodically, in response to physical hormonal or emotional stress, the virus replicates and is transported to a site at or near the portal of entry into the body where it can cause a lesion. The virus made in the lesion can be transmitted to a noninfected individual (4).
The fundamental problems associated with HSV infections are multifold. HSV-1 is transmitted primarily by oral contact. Although in most individuals the recurrent lesions occur at the mucocutaneous region of the lip or genitals (classical fever blisters), the virus is occasionally transported to the brain where it causes encephalitis or to the eye where it causes herpes keratitis. Encephalitis typically occurs in 1 in 100,000 individuals per year and can cause severe sequelae, including death (13). Recurrent herpes keratitis is a major cause of blindness in United States (14). The problems associated with HSV-2 genital infections can be overwhelming, particularly if the recurrences are frequent, painful, or transmitted to a newborn.
Much of the morbidity of HSV-1 and HSV-2 infections is due to the capacity of these viruses to establish latent infections in neurons and to reactivate. In most instances, the replication of HSV-1 and HSV-2 can be controlled by existing antiviral drugs. Importantly, however, antiviral drugs have no effect on latent virus, reactivation frequency, or shedding. Adding to the pressure to eliminate reactivating virus is evidence that individuals with recurrent genital HSV infections are more susceptible to HIV infection than those who are not infected (15, 16).
The studies reported here are parts of an effort to define the role played by specific regulatory pathways in the maintenance of viral genes in a repressed state in trigeminal ganglia (TG) harboring HSV-1 in a latent, silent state. The experimental design is as follows: Mice are inoculated by the corneal route with wild-type or mutant viruses. Wild-type HSV-1 replicates in the eye, is transported retrograde to TG, and replicates in some neurons but is silenced and retained in a latent state in other neurons (17). By day 30 after infection, the ganglia contain only silenced, latent virus. Our objective is to analyze the events that take place within a 24-h interval after induction of reactivation, that is, within the time frame of a single virus replicative cycle. To achieve this objective, ganglia are excised and incubated intact in medium containing antibody to nerve growth factor (NGF) or in medium containing both NGF and epidermal growth factor (EGF). Deprivation of NGF leads to activation of viral gene expression and abrogation of latency (18). In the presence of both NGF and EGF, reactivation is delayed (19). The studies published to date indicate the following:
i) Viral genes form several groups that are coordinate and sequential on productive infection in cell culture and also at the portal of entry into the body (20, 21). Thus, α-genes are derepressed with the involvement of viral protein 16 (VP16), a protein brought into cells during infection (22). At least one α-protein designated infected cell protein 0 (ICP0) plays a key role in the derepression of β and at least a large fraction of γ-genes (23). Upon incubation of intact TG in medium containing anti-NGF antibody, genes representative of all coordinately regulated viral genes are derepressed at once in the absence of prior protein synthesis (19). In effect, the mechanism of reactivation does not involve VP16 or ICP0.
ii) One hypothesis that could explain the massive derepression of all viral genes at once is that, in the absence of NGF, the neuron undergoes apoptosis (24). Indeed, exposure of trigeminal organ cultures to proapoptotic drugs induced activation of viral genes in the presence of NGF and EGF. However, unlike the spontaneous reactivation in the absence of NGF, the reactivation of viral genes in the presence of at least one proapoptotic drug required concurrent protein synthesis (18).
In this report, we detail the role of STAT3 and p300/CBP in reactivation of HSV-1 in latently infected ganglia. In the first series of experiments, we show that inhibition of histone-deacetylating enzymes and activation of histone acetyl transferase p300/CBP results in reactivation of latent virus whereas inhibition of p300/CBP suppresses reactivation. In the second series of experiments, we show that STAT3 plays a key role in the maintenance of HSV-1 in a latent form inasmuch as interference with its functions induces reactivation.
Results
Histone Deacetylase Inhibitors Activate Latent Virus in the Ganglionic Organ Culture Model.
Earlier studies have shown that HSV-1 can be reactivated from latently infected neurons by histone deacetylase (HDAC) inhibitors (25). The purpose of these studies was to verify that HDAC inhibitors, both broad spectrum and those with some degree of specificity, reactivate HSV-1 in latently infected TG maintained in organ culture incubated in medium containing NGF + EGF. In this series of experiments, we tested three inhibitors. Trichostatin A (TSA) is a broad-spectrum HDAC inhibitor (25, 26). Earlier studies have shown that it induces the reactivation of virus in neurons harboring latent virus (25). pyridin-3-ylmethyl 4-(2-aminophenylcarbamoyl)benzylcarbamate (MS275) and 3-[5-(3-(3-Fluorophenyl)-3-oxopropen-1-yl)-1-methyl-1H-pyrrol-2-yl]-N-hydroxy-2-propenamide (MC1568) at low concentrations act as specific inhibitors of HDAC 1 and 4, respectively (27, 28). At high concentrations, their specificity decreases. All three HDACs inhibitors induced the reactivation of HSV in TG harvested 30 d after infection and incubated in medium containing NGF and EGF (Fig. 1 A and B). As in earlier studies, the results show the geometric mean levels of viral mRNAs from six ganglia extracted at the time of excision and at 24 h after excision. As previously reported, LAT and miRNAs decrease in amounts (Fig. 1C) concurrent with accumulation of viral gene products (Fig. 1B).
Fig. 1.
Activation of p300/CBP Induces Reactivation of Latent Virus and, Conversely, Inhibition of p300/CBP Blocks Reactivation.
We report two series of experiments. In the first, ganglia excised from mice inoculated at least 30 d earlier were incubated in medium containing NGF+EGF and supplemented with N-(4-chloro-3-trifluoromethyl-phenyl)-2-ethoxy-benzamide (CTB). CTB is a powerful activator of histone acetyltransferase activity of P300/CBP by binding and altering the structure of the enzyme (29). At 24 h after incubation, the ganglia were extracted and analyzed for the presence of mRNA representative of the four groups of viral mRNAs and also for the presence of the LAT and viral miRNAs (Fig. 2). Following exposure to the drug, all viral mRNAs increased ∼50-fold whereas miRNAs and the LAT decreased ∼10-fold.
Fig. 2.
Earlier studies have shown that the spice curcumin is a potent inhibitor of the acetyl transferase activity of p300 (30). To test whether curcumin will block reactivation, we repeated the experiment described above but with curcumin in place of CTB. In this experiment, the ganglia were incubated either in medium containing NGF+EGF or in medium containing antibody to NGF. As shown in Fig. 3A, curcumin blocked the reactivation of HSV and degradation of the LAT and miRNAs independent of the medium in which the ganglia were incubated. It is noteworthy that, in ganglia incubated in medium containing antibody to NGF, curcumin suppressed the accumulation of small amounts of mRNAs normally detected at the time of excision of the ganglia. Compare, for example, the amounts of mRNA detected in freshly excised ganglia (Fig. 3A, column 1) with those detected in ganglia incubated in medium containing curcumin (Fig. 3A, columns 4 and 5). It is also noteworthy that at the higher concentration (300 μM) curcumin suppressed the accumulation of the LAT (Fig. 3B, columns 4 and 5).
Fig. 3.
Inhibition of STAT3 Phosphorylation Induces Activation of Latent HSV.
In this series of experiments, we tested the effects of the STAT3 inhibitor 2-hydroxy-4-(2-(tosyloxy)acetamido)benzoic acid (NSC74859) on reactivation of HSV from murine TG harboring latent virus (31). The experimental design was similar to that reported above. The excised ganglia were incubated in medium containing NGF+EGF and one of two concentrations of the drug. The results of analyses of the mRNAs extracted from ganglia 24 h after excision are shown in Fig. 4. In brief, the results show that the representative of all four temporally regulated groups of viral genes was up-regulated by 24 h after excision of the ganglia and incubation in the presence of the STAT3 inhibitor. The results suggest that STAT3 plays a role in the maintenance of HSV-1 in the latent state in murine TG.
Fig. 4.
Construction and Testing of Recombinant HSV-1 Expressing a Wild-Type and Dominant-Negative STAT3.
The objective of this series of experiments was to verify the conclusion that disruption of STAT3 function induces reactivation of latent virus by construction of viruses that deliver to the infected neurons a wild-type or a dominant-negative STAT3.
The procedures for construction of the recombinant viruses are described in Materials and Methods. Fig. 5 shows the schematic diagrams of the domains of STAT3 and the structure of the genomes of the recombinant viruses. Specifically, the wild-type STAT3 coding sequences flanked by the SV40 early promoter at it 5′ terminus and the myc tag at its 3′ terminus were inserted between Unique Long 3 (UL3) and UL4 ORFs in recombinant named as R128 (Fig. 5, line 2). In R130 (Fig. 5, line 3), we inserted in the same location an identical construct except that tyrosine 705 was replaced by phenylalanine. The objective of the Y705F substitution was to block the phosphorylation of tyrosine705.
Fig. 5.
Characterization of the Course of R128 and R130 Recombinant Virus Infection in Mice.
In this series of experiments, we characterized the accumulation of viral DNA, mRNAs representative of the major kinetic classes of viral mRNAs, the LAT, and the representative miRNAs in mice following intracorneal inoculation of mice. As in all studies reported, each experimental point represents the results obtained on six ganglia. The salient features of the results are related below.
Fig. 6A shows the accumulation of viral DNAs in TG harvested 1, 3, 7, and 14 d after infection with wild-type HSV-1(F strain) recombinant viruses. Consistent with earlier studies, HSV DNA reached peak levels on day 7 and declined thereafter. In this experiment, the amounts of viral DNA accumulating in ganglia of mice infected with R130 were consistently lower than those of mice infected with wild-type virus or recombinant carrying wild-type STAT3.
Fig. 6.
Fig. 7 shows the patterns of accumulation of infected cell protein (ICP27), thymidine kinase (TK), VP16, or UL41 mRNAs representative of viral α-, β-, γ1-, and γ2-genes, respectively, and of the LAT and selected miRNAs. In the experiment shown, we have observed significant fluctuation in the levels of mRNAs on day 3 but less at later time points. In general, mRNAs attained peak levels on days 3 or 7 and decreased thereafter. The data indicate that the patterns of accumulation of mRNAs of wild-type virus were either similar or slightly elevated with respect to those of the recombinant viruses. In a similar vein, the patterns of accumulation of the LAT and miRNAs were either similar or slightly elevated with respect to the accumulation of the corresponding products of the recombinant viruses.
Fig. 7.
Interference with STAT3 Functions by a Virus Expressing a Gene Encoding a Dominant-Negative STAT3.
The objective of the studies presented here was to verify the conclusion based on the STAT3 inhibitor studies that STAT3 plays a role in defining the status of latent virus and that interference with the function of STAT3 would lead to virus reactivation. To test this hypothesis, TG were excised 30 d after infection with wild-type virus or with R128 or R130 recombinant viruses. One set of ganglia were immediately extracted and assayed for the amounts of viral DNA and mRNAs representing the major kinetic classes of viral genes. The remaining ganglia were incubated in medium containing antibody to NGF or both NGF+EGF for 24 h and then assayed for the amounts of viral mRNAs, the LAT, or representative miRNAs. The results were as related below.
The relative amounts of viral DNA recovered from TG at the time of excision of the ganglia are shown in Fig. 6B. The results indicate that there was significantly less viral DNA in TG of mice exposed to the recombinant virus carrying the Y705F substitution than in mice infected with wild-type virus. Conversely, TG harboring the R128 recombinant viral genome expressing a wild-type STAT3 gene contained at least as much viral DNA as the ganglia carrying latent wild-type virus and significantly more than ganglia harboring latent R130 recombinant virus carrying the Y705F substitution.
Fig. 8 shows the relative amounts of mRNAs transcribed from representative genes sequentially derepressed during productive infection. Fig. 8, column 1, shows the basal levels of mRNA detected in ganglia processed immediately after excision. As previously described, during the time frame of a productive infection the amounts of viral transcripts increase ∼50-fold on incubation in medium containing anti-NGF antibody and ∼2- to 3-fold in medium containing NGF+EGF. We detected fewer copies of viral mRNA in ganglia harboring latent recombinant viruses at 0 h (compare columns 4 and 7 with column 1 in Fig. 8). Comparison of columns 1–3 with 7–9 shows that recombinant viruses R128 and R130 and wild type HSV-1(F) exhibit similar patterns, indicating that in ganglia harboring R128 the pattern of activation of latent virus is similar to that of HSV-1(F). In contrast, ganglia harboring latent R130 exhibited higher levels of expression and accumulation of mRNAs in medium containing NGF+EGF than in medium containing antibody to NGF (compare columns 1–3 or 7–9 with 4–6).
Fig. 8.
We conclude that the results of this study are congruent with those obtained with the STAT3 inhibitor and suggest that STAT3 defines the status of latent HSV-1 in murine TG.
Induction of Reactivation of Latent HSV-1(F) by the STAT3 Inhibitor in Contrast to the Induction of Reactivation by p300/CBP Activation Requires de Novo Protein Synthesis.
The impetus for these studies was the observation that TG harboring the R130 recombinant virus accumulated higher levels of viral mRNAs only upon incubation in medium containing NGF+EGF but not in medium containing antibody to NGF. One interpretation of the results is that the dominant-negative STAT3 carrying the Y705F substitution had to perform or induce a function that was partly or totally blocked in ganglia incubated in medium containing antibody to NGF. To test the hypothesis that this function required de novo protein synthesis, ganglia excised 30 d after infection were incubated in medium containing NGF+EGF and the STAT3 inhibitor alone or inhibitor plus cycloheximide. As a control duplicate ganglia harboring latent wild-type virus were incubated in medium containing inhibitory concentrations of TSA alone or both TSA and cycloheximide. The rationale in designing this study was based on the expectation that induction of reactivation by HDAC inhibitors would not require de novo protein synthesis.
The results shown in Fig. 9 are as follows: The accumulation of mRNAs in ganglia exposed to TSA and cycloheximide (columns 2 and 3) were similar to those obtained in the absence of cycloheximide and 10-fold higher than those obtained in freshly excised ganglia (column 1). As expected from earlier studies (19), the amounts of the LAT and miRNAs were higher in cycloheximide-treated ganglia (column 8) than in ganglia treated with TSA only (column 7).
Fig. 9.
In contrast to the results of studies with the HDAC inhibitor, the levels of accumulated mRNAs were consistently lower in ganglia treated with both STAT3 inhibitor and cycloheximide (column 5) than with the inhibitor alone. In contrast, the levels of the LAT and miRNAs were higher in cycloheximide-treated ganglia.
We conclude that induction of viral gene expression in latently infected ganglia by the inhibitor of STAT3 requires de novo protein synthesis. In contrast, activation of viral gene expression by HDAC inhibitor does not require prior protein synthesis.
Discussion
The focus of this report is on the reactivation of latent HSV-1 in the TG organ culture model. The results of the studies presented in this report are shown schematically in Fig. 10. The salient features of the results and their significance are summarized as follows:
i) In an earlier study we reported that, in organ culture containing antibody to NGF, ganglia harboring latent HSV reactivated the virus within the time frame of a single replicative cycle after excision from mice (18). We also reported that genes representing distinct kinetic classes of viral genes are expressed concurrently. The hypothesis that we advanced to explain this phenomenon is that deprivation of NGF induces apoptosis and causes a massive derepression of all viral genes at once. To test the hypothesis, we exposed ganglia harboring latent virus to proapoptotic drugs in medium containing NGF and EGF. We did indeed observe activation of viral genes in medium containing dexamethasone, but the induction was blocked by inhibition of protein synthesis as depicted schematically in Fig. 10B (24). The key conclusion of that study is that the mechanism by which the absence of NGF triggers reactivation of the latent virus is different from that induced by proapoptotic drugs (18, 24).
ii) One focus of the current report is on the role of the STAT3 transcriptional factor in reactivation of latent HSV-1. STAT3 transcriptional factor has been shown to reside in the cytoplasm of neurons (32). Upon induction by cytokines (e.g., IL6) or stress, STAT3 is phosphorylated at residue 705 and is translocated to the nucleus where it interacts with and is acetylated by p300/CBP (Fig. 10A) (33–35). STAT3 then activates the transcription of neuroprotective genes (e.g., bcl-2, bcl-xl, IAP2, Pim-1, Reg), neurodegenerative genes (e.g., GAP-43), and neurodevelopmental genes (e.g., GFPAF) (36–41). In this report the inhibitor of STAT3 blocks its posttranslational modification. The presumed mechanism of reactivation induced by STAT3 carrying the Y705F substitution is that once it is translocated into the nucleus, it competes with endogenous wild-type STAT3.
We do not have direct evidence that activated, nuclear STAT3 blocks reactivation of latent virus. The available evidence is twofold. Foremost, overexpression of wild-type STAT3 did not alter the pattern of accumulation of viral transcripts in ganglia maintained in medium containing NGF+EGF. More significantly, interference with STAT3 function either by an inhibitor of STAT3 function or by a dominant-negative STAT3 resulted in reactivation of latent virus. The fundamental conclusion of this report is that STAT3 defines the status of latent HSV-1 in TG. One hypothesis that is consistent with the data but does not prove it is that activated STAT3 in turn can activate the expression of either neuron protective anti-apoptotic genes or proapoptotic genes. The nature of the STAT3 function may depend on the STAT3 activator, whether a cytokine or stress signaling.
iii) The second focus of our report is on the role of p300/CBP. We show that curcumin, a potent inhibitor of p300/CBP, blocks reactivation of ganglia immersed in medium lacking NGF. These results suggest that reactivation requires p300/CBP histone acetyl transferase activity. As cited above, reactivation of viral genes in ganglia harboring latent virus in medium containing antibody against NGF can take place in the absence of de novo protein synthesis. Implicit in this observation is that, in ganglia harboring latent virus, p300/CBP is available and its function in facilitating viral gene expression does not require prior or concurrent protein synthesis. This conclusion is reinforced by the observation that CTB, a drug that binds to p300/CBP and activates it by altering its conformation effectively, induced viral gene expression in ganglia incubated in medium containing NGF and EGF without prior or concurrent protein synthesis.
iv) Studies reported elsewhere have shown that wide-spectrum HDAC inhibitor induced HSV reactivation (25). In this study we reaffirm the expectation that neurons harboring latent virus by inhibition of the HDACs do not require prior or concurrent protein synthesis. We also show that HDAC inhibitors acting on a more narrow spectrum of HDACs also activate latent HSV-1. Implicit in the observation that HDAC inhibitors can induce reactivation is the hypothesis that viral genes are in a dynamic equilibrium with respect to histone acetylation and deacetylation and that the equilibrium shifts as the supply of functional HDACs is depleted. The hypothesis predicts that massive activation of p300/CBP may also act to shift the equilibrium, a hypothesis supported by the activation of latent virus gene expression by the p300 activator CTB.
Fig. 10.
Finally, two issues are relevant here. First, a fundamental objective of the studies reported here is to find the means to induce the reactivation of HSV in the presence of antiviral drugs to decrease and ultimately eliminate reactivable virus from patients with recurrent herpetic lesions. The results of the studies presented here point to several avenues by which this could be accomplished. In brief, we have shown that inhibition of STAT3 or HDACs or activation of p300/CBP can be predicted to initiate the sequence of events leading to controlled virus reactivation.
Second, to remain latent, viral DNA must be extensively remodeled into facultative heterochromatin (42–44). The results that we present are that inhibition of STAT3 or activation of p300/CBP is capable of modifying latent viral DNA to the point where it can replicate and be susceptible to antiviral drugs. It could be expected that the same process may enable the activation of the DNAs of other viruses that remain latent with humans for life. The list includes major human pathogens such as human cytomegalovirus, Epstein–Barr virus, varicella-zoster virus, and human immunodeficiency virus.
Materials and Methods
Virus Strains and Cells.
Vero cells originally obtained from the American Type Culture Collection were grown in DMEM supplemented with 5% (vol/vol) FBS. The BAC encoding the HSV-1(F) DNA was reported elsewhere (18).
Plasmid Construction of STAT3 and dnSTAT3.
The plasmid (pMXs-STAT3) containing wild-type STAT3 was a kind of gift S. Yamanaka (Kyoto University, Japan) (45). The mutant STAT3 with single substitution of Y705F (dnSTAT3) was obtained by use of the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene) with two oligo primers: ggtagtgctgccccgtTcctgaagaccaagttc and gaacttggtcttcaggaacggggcagcactacc).
Construction of STAT3 and dnSTAT3 Recombinant Viruses.
Murine Model of Virus Infection.
Four-week-old inbred female CBA/J mice (Jackson Labs) received unrestricted access to food and water. All animal studies were done according to protocols approved by the Institutional Animal Care and Use Committee of the University of Chicago. Following light scarification of the cornea, 1 × 105 pfu of virus were applied in a dropwise manner in a volume of 5 µL to each cornea of the mice. TG were excised on indicated days and subjected to DNA replication and viral gene expressions assays.
Murine Model of Virus Reactivation and Drug Treatment.
TG were removed 30 d after infection and incubated at 37 °C with 5% (vol/vol) CO2 in medium 199V supplemented with anti-NGF antibody (1 mg/mL; Abcam) for 24 h. To temporarily block virus reactivation, TG were incubated in medium containing 300 ng/mL NGF+EGF (Invitrogen). TG were treated by drugs as described in the text. HDAC inhibitor TSA, P300 inhibitor curcumin, and P300 activator CTB were purchased from Sigma. HDAC class I specific inhibitor MS275 and HDAC class II specific inhibitor MC1568 were purchased from Selleck Chemicals. STAT3 inhibitor NSC74859 was purchased from EMD Millipore.
DNA Copy-Number Assays.
Total DNA was extracted from murine TG as reported previously (17). The quantification of viral DNA copy numbers in TG was performed by SYBR green real-time PCR technology (StepOnePlus system, ABI) using viral TK gene primers and murine adipsin gene primers as internal control.
RNA Isolation and Assays.
RNAs depleted and enriched in small RNAs (<200 nt) were extracted by a mirVana miRNA isolation kit (Ambion) according to the manufacturer’s instructions. RNA were transcribed as described elsewhere (18). Viral gene RNAs and three HSV-1 miRNAs (mir-H3, mir-H5, mir-H6) were quantified by Taqman quantitative RT-PCR assays. Sequences of primers and probes were reported elsewhere (18).
Acknowledgments
We thank Lindsay Smith for technical assistance and the anonymous VirA reviewer for the invaluable assertion that STAT3 is absent from neurons. These studies were aided by National Cancer Institute Grant 5R37CA078766.
References
1
B Roizman, DM Knipe, RJ Whitley, Herpes simplex viruses. Fields Virology, eds DM Knipe, PM Howley (Lippincott Williams & Wilkins, 6th Ed, Philadelphia, 2013).
2
LJ Al-Dujaili, et al., Ocular herpes simplex virus: How are latency, reactivation, recurrent disease and therapy interrelated? Future Microbiol 6, 877–907 (2011).
3
B Roizman, AE Sears, An inquiry into the mechanisms of herpes simplex virus latency. Annu Rev Microbiol 41, 543–571 (1987).
4
GC Perng, C Jones, Towards an understanding of the herpes simplex virus type 1 latency-reactivation cycle. Interdiscip Perspect Infect Dis 2010, 262415 (2010).
5
DM Knipe, et al., Snapshots: Chromatin control of viral infection. Virology 435, 141–156 (2013).
6
MJD Farrell, AT Dobson, LT Feldman, Herpes simplex virus latency-associated transcript is a stable intron. Proc Natl Acad Sci USA 88, 790–794 (1991).
7
JG Spivack, GM Woods, NW Fraser, Identification of a novel latency-specific splice donor signal within the herpes simplex virus type 1 2.0-kilobase latency-associated transcript (LAT): Translation inhibition of LAT open reading frames by the intron within the 2.0-kilobase LAT. J Virol 65, 6800–6810 (1991).
8
W Mitchell, R Lirette, N Fraser, Mapping of low abundance latency-associated RNA in the trigeminal ganglia of mice latently infected with hepes simplex virus type 1. J Gen Virol 71, 125–132 (1990).
9
K Held, T Derfuss, Control of HSV-1 latency in human trigeminal ganglia: Current overview. J Neurovirol 17, 518–527 (2011).
10
C Cui, et al., Prediction and identification of herpes simplex virus 1-encoded microRNAs. J Virol 80, 5499–5508 (2006).
11
JL Umbach, et al., MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs. Nature 454, 780–783 (2008).
12
DJ Munson, AD Burch, A novel miRNA produced during lytic HSV-1 infection is important for efficient replication in tissue culture. Arch Virol 157, 1677–1688 (2012).
13
I Steiner, Herpes simplex virus encephalitis: New infection or reactivation? Curr Opin Neurol 24, 268–274 (2011).
14
AV Farooq, D Shukla, Herpes simplex epithelial and stromal keratitis: An epidemiologic update. Surv Ophthalmol 57, 448–462 (2012).
15
SS Wilson, et al., Susceptibility to genital herpes as a biomarker predictive of increased HIV risk: Expansion of a murine model of microbicide safety. Antivir Ther 14, 1113–1124 (2009).
16
C Kaushic, A Nazli, VH Ferreira, JK Kafka, Primary human epithelial cell culture system for studying interactions between female upper genital tract and sexually transmitted viruses, HSV-2 and HIV-1. Methods 55, 114–121 (2011).
17
T Du, G Zhou, S Khan, H Gu, B Roizman, Disruption of HDAC/CoREST/REST repressor by dnREST reduces genome silencing and increases virulence of herpes simplex virus. Proc Natl Acad Sci USA 107, 15904–15909 (2010).
18
G Zhou, T Du, B Roizman, HSV carrying WT REST establishes latency but reactivates only if the synthesis of REST is suppressed. Proc Natl Acad Sci USA 110, E498–E506 (2013).
19
T Du, G Zhou, B Roizman, HSV-1 gene expression from reactivated ganglia is disordered and concurrent with suppression of latency-associated transcript and miRNAs. Proc Natl Acad Sci USA 108, 18820–18824 (2011).
20
B Roizman, H Gu, G Mandel, The first 30 minutes in the life of a virus: UnREST in the nucleus. Cell Cycle 4, 1019–1021 (2005).
21
B Roizman, G Zhou, T Du, Checkpoints in productive and latent infections with herpes simplex virus 1: Conceptualization of the issues. J Neurovirol 17, 512–517 (2011).
22
JT Proença, et al., An investigation of herpes simplex virus promoter activity compatible with latency establishment reveals VP16-independent activation of immediate-early promoters in sensory neurones. J Gen Virol 92, 2575–2585 (2011).
23
H Gu, B Roizman, Herpes simplex virus-infected cell protein 0 blocks the silencing of viral DNA by dissociating histone deacetylases from the CoREST-REST complex. Proc Natl Acad Sci USA 104, 17134–17139 (2007).
24
T Du, G Zhou, B Roizman, Induction of apoptosis accelerates reactivation of latent HSV-1 in ganglionic organ cultures and replication in cell cultures. Proc Natl Acad Sci USA 109, 14616–14621 (2012).
25
RJ Danaher, RJ Jacob, MR Steiner, WR Allen, JM Hill, CS Miller, Histone deacetylase inhibitors induce reactivation of herpes simplex virus type 1 in a latency-associated transcript (LAT)-independent manner in neuronal cells. J Neurovirol 11, 306–317 (2005).
26
AG Kazantsev, LM Thompson, Therapeutic application of histone deacetylase inhibitors for central nervous system disorders. Nat Rev Drug Discov 7, 854–868 (2008).
27
A Nebbioso, et al., Selective class II HDAC inhibitors impair myogenesis by modulating the stability and activity of HDAC-MEF2 complexes. EMBO Rep 10, 776–782 (2009).
28
N Khan, et al., Determination of the class and isoform selectivity of small-molecule histone deacetylase inhibitors. Biochem J 409, 581–589 (2008).
29
K Balasubramanyam, V Swaminathan, A Ranganathan, TK Kundu, Small molecule modulators of histone acetyltransferase p300. J Biol Chem 278, 19134–19140 (2003).
30
K Balasubramanyam, et al., Curcumin, a novel p300/CREB-binding protein-specific inhibitor of acetyltransferase, represses the acetylation of histone/nonhistone proteins and histone acetyltransferase-dependent chromatin transcription. J Biol Chem 279, 51163–51171 (2004).
31
K Siddiquee, et al., Selective chemical probe inhibitor of Stat3, identified through structure-based virtual screening, induces antitumor activity. Proc Natl Acad Sci USA 104, 7391–7396 (2007).
32
JD Kriesel, BB Jones, IP Hwang, KM Dahms, SL Spruance, Signal transducers and activators of transcription (Stat) are detectable in mouse trigeminal ganglion neurons. J Interferon Cytokine Res 21, 445–450 (2001).
33
N Nadiminty, et al., Stat3 activation of NF-kappaB p100 processing involves CBP/p300-mediated acetylation. Proc Natl Acad Sci USA 103, 7264–7269 (2006).
34
PY Cheng, et al., Interplay between SIN3A and STAT3 mediates chromatin conformational changes and GFAP expression during cellular differentiation. PLoS ONE 6, e22018 (2011).
35
K Al Zaid Siddiquee, J Turkson, STAT3 as a target for inducing apoptosis in solid and hematological tumors. Cell Res 18, 254–267 (2008).
36
R Catlett-Falcone, et al., Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells. Immunity 10, 105–115 (1999).
37
Y Aoki, GM Feldman, G Tosato, Inhibition of STAT3 signaling induces apoptosis and decreases survivin expression in primary effusion lymphoma. Blood 101, 1535–1542 (2003).
38
GH Li, et al., STAT3 silencing with lentivirus inhibits growth and induces apoptosis and differentiation of U251 cells. J Neurooncol 91, 165–174 (2009).
39
N Lee, KL Neitzel, BK Devlin, AJ MacLennan, STAT3 phosphorylation in injured axons before sensory and motor neuron nuclei: Potential role for STAT3 as a retrograde signaling transcription factor. J Comp Neurol 474, 535–545 (2004).
40
S Dziennis, NJ Alkayed, Role of signal transducer and activator of transcription 3 in neuronal survival and regeneration. Rev Neurosci 19, 341–361 (2008).
41
AL Pranada, S Metz, A Herrmann, PC Heinrich, G Müller-Newen, Real time analysis of STAT3 nucleocytoplasmic shuttling. J Biol Chem 279, 15114–15123 (2004).
42
NJ Kubat, RK Tran, P McAnany, DC Bloom, Specific histone tail modification and not DNA methylation is a determinant of herpes simplex virus type 1 latent gene expression. J Virol 78, 1139–1149 (2004).
43
DL Kwiatkowski, HW Thompson, DC Bloom, The polycomb group protein Bmi1 binds to the herpes simplex virus 1 latent genome and maintains repressive histone marks during latency. J Virol 83, 8173–8181 (2009).
44
Bloom DC, Giordani NV, Kwiatkowski DL (2010) Epigenetic regulation of latent HSV-1 gene expression. Biochim Biophys Acta 1799(3–4):246–256.
45
K Takahashi, S Yamanaka, Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676 (2006).
Information & Authors
Information
Published in
Cover image: Pictured is a mother koala (Phascolarctos cinereus) with her joey, resting on a eucalyptus tree at the Los Angeles Zoo. More than half of captive koalas in northeastern Australia die from leukemia and lymphoma, and it remains unclear whether an endogenous retrovirus isolated from these koalas, KoRV, is associated with malignancy. Wenqin Xu et al. screened koalas from the San Diego and Los Angeles Zoos for KoRV and found that all of the sampled koalas were infected with the previously identified subtype of the virus, KoRV-A. However, only koalas from the Los Angeles Zoo developed malignancies and were infected with a previously unrecognized viral subtype, KoRV-B. The findings suggest that KoRV-B may be associated with leukemia and lymphoma in koalas. See the article by Xu et al. on pages 11547–11552. Image courtesy of Tad Motoyama (Los Angeles Zoo, Los Angeles).
Classifications
Submission history
Published online: June 20, 2013
Published in issue: July 9, 2013
Keywords
Acknowledgments
We thank Lindsay Smith for technical assistance and the anonymous VirA reviewer for the invaluable assertion that STAT3 is absent from neurons. These studies were aided by National Cancer Institute Grant 5R37CA078766.
Authors
Competing Interests
The authors declare no conflict of interest.
Metrics & Citations
Metrics
Citation statements
Altmetrics
Citations
Cite this article
110 (28) E2621-E2628,
Export the article citation data by selecting a format from the list below and clicking Export.
Cited by
Loading...
View Options
View options
PDF format
Download this article as a PDF file
DOWNLOAD PDFLogin options
Check if you have access through your login credentials or your institution to get full access on this article.
Personal login Institutional LoginRecommend to a librarian
Recommend PNAS to a LibrarianPurchase options
Purchase this article to access the full text.