CRISPR/Cas9-based split homing gene drive targeting doublesex for population suppression of the global fruit pest Drosophila suzukii
Edited by Anthony James, University of California, Irvine, CA; received January 27, 2023; accepted May 4, 2023
Significance
Spotted wing drosophila (Drosophila suzukii) is a vinegar fly with a worldwide distribution that does significant economic damage to soft-skinned fruits. We made and evaluated split CRISPR homing gene drives that target the conserved female-specific exon of the doublesex gene, which is essential for sexual development in Drosophila. Our results suggest that homing gene drives could provide a cost-effective approach for suppression of D. suzukii populations.
Abstract
Genetic-based methods offer environmentally friendly species-specific approaches for control of insect pests. One method, CRISPR homing gene drive that target genes essential for development, could provide very efficient and cost-effective control. While significant progress has been made in developing homing gene drives for mosquito disease vectors, little progress has been made with agricultural insect pests. Here, we report the development and evaluation of split homing drives that target the doublesex (dsx) gene in Drosophila suzukii, an invasive pest of soft-skinned fruits. The drive component, consisting of dsx single guide RNA and DsRed genes, was introduced into the female-specific exon of dsx, which is essential for function in females but not males. However, in most strains, hemizygous females were sterile and produced the male dsx transcript. With a modified homing drive that included an optimal splice acceptor site, hemizygous females from each of the four independent lines were fertile. High transmission rates of the DsRed gene (94 to 99%) were observed with a line that expressed Cas9 with two nuclear localization sequences from the D. suzukii nanos promoter. Mutant alleles of dsx with small in-frame deletions near the Cas9 cut site were not functional and thus would not provide resistance to drive. Finally, mathematical modeling showed that the strains could be used for suppression of lab cage populations of D. suzukii with repeated releases at relatively low release ratios (1:4). Our results indicate that the split CRISPR homing gene drive strains could potentially provide an effective means for control of D. suzukii populations.
Sign up for PNAS alerts.
Get alerts for new articles, or get an alert when an article is cited.
Several genetic strategies for suppression of insect pest populations such as female-specific release of insects carrying a dominant lethal (fsRIDL) (1, 2), X-shredder sex ratio distortion (3, 4), precision-guided sterile insect technique (pgSIT) (5, 6), and homing gene drives (7, 8) have been developed in the past few years. The gene drive concept emerged from naturally occurring selfish genetic elements that show biased or super-Mendelian inheritance (9, 10). In 2003, Austin Burt proposed the use of homing endonuclease genes (HEGs) for control of pest populations (11). The central idea was to adapt an HEG to recognize an essential gene in the species of interest, for example, a gene required for female development. Following the introduction of a double-strand break (DSB) by the homing endonuclease, repair through homology-directed repair (HDR) led to copying or “homing” of the HEG into the targeted gene. A homing event in the germline would convert a heterozygous allele to homozygous resulting in super-Mendelian inheritance of any given trait or genetic elements. HEG (I-SceI)-based homing gene drives have been successfully performed in Anopheles gambiae and Drosophila melanogaster (12–15). Since it proved difficult in practice to adapt HEGs to target essential genes, the advent of easily programmable “RNA-guided endonucleases” such as Cas9 has expedited gene drive research tremendously, showing the potential of this approach to genetically alter or suppress wild populations of insect pests (16–18).
CRISPR/Cas, which refers to Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated protein, was originally derived from the immune systems of bacteria and archaea (19, 20). In cells, Cas9 DNA endonuclease bound with a small single guide RNA (sgRNA) is guided to a specific target sequence through base pairing between the sgRNA and DNA. Once the target is recognized, Cas9 binds to its sequence and promotes DSBs. CRISPR/Cas9-based homing gene drive systems have been demonstrated in a wide range of organisms including yeast (21), D. melanogaster (18, 22), mice (23), and the mosquito disease vectors A. gambiae (24), A. stephensi (25), and Aedes aegypti (26). The systems typically contain three elements, a Cas9 gene driven by a promoter active in the germline, one or more sgRNA genes controlled by a U6 gene promoter, and a fluorescent protein marker gene to monitor biased inheritance (24, 25). The gene drive cassette is flanked by homologous sequences or “arms” that match the gene sequences to either side of the Cas9 cleavage site (27–31). Given their potential to spread, recommendations have been made for improved biocontainment of gene drive strains (32). One suggested approach is to test and evaluate gene drives as a “split” homing gene drive in which the Cas9 and sgRNA components are present at widely separated locations in the genome (17, 33).
Resistance development is one of the major challenges to develop an efficient gene drive system. This could simply occur due to naturally occurring allelic variants present in a population that are resistant to Cas9 cleavage (34, 35). Resistance can also arise as a consequence of DNA repair. In addition to HDR, the DSB at the homology site can also be repaired through nonhomologous end joining (NHEJ) and microhomology-mediated end joining pathways (36). Mutations within the sgRNA target site can prevent further Cas9-mediated cleavage, resulting in resistant-allele accumulation and loss of drive (24, 25). For example, a gene drive in A. gambiae was initially very successful, but the accumulation of short deletion mutations in the sgRNA target sequence that were resistant to Cas9 cleavage and restored functionality of the encoded protein led to drive resistance (37). More complex gene drive designs have been employed to minimize drive failure due to resistance. For example, using multiplexed sgRNAs along with a recoded rescue element targeting a haplolethal RpL35A gene, Champer et al have observed up to 91% of drive inheritance in D. melanogaster (29).
As population growth will largely be determined by female productivity, gene drives targeting a gene required for female development or reproduction could be particularly effective for population suppression (11, 24, 38). Drive males would be viable and fertile and thus pass on the disrupted female-essential gene to their offspring. Among insects, the sex-determining genes involved in sexual development and differentiation are functionally conserved (39) and have been exploited to develop genetic control methods of pest management (7). The bottom of the sex determination pathway in dipteran species such as D. melanogaster, Ceratitis capitata, and Musca domestica is quite conserved (40). The female-specific protein transformer (TRA) combines with non-sex-specific proteins (TRA2 and RBP1 in D. melanogaster) to regulate the sex-specific alternative splicing of doublesex (dsx) and fruitless (fru) gene transcripts (41, 42). In D. melanogaster, the TRA/TRA2/RBP1 complex binds to multiple sites in the 3′UTR of the female dsx transcript and enhance the use of a weak splice acceptor (SA) that immediately precedes the female exon (43). In the absence of the TRA/TRA2/RBP1 complex in males, this weak SA site is ignored, and instead, the common exon is spliced to a male-specific exon that is downstream of the female exon. The sex-specific DSXF and DSXM isoforms control the proper sexual and somatic tissue differentiation in a developing fly (44–47). As the female exon is highly conserved and essential for DSXF function, it was a suitable target for a homing drive. At the laboratory scale, Kyrou et al. have shown a complete population suppression with a homing gene drive targeting the female-specific exon of the dsx gene in A. gambiae (7). The sequence matching the sgRNA spanned the intron–female exon boundary and was invariant among several Anopheles species. Drive-resistant alleles did not accumulate suggesting strong functional constraint on the targeted sequence.
We have been interested in developing genetic strategies for control of the invasive fruit pest Drosophila suzukii. A native of Asia, D. suzukii is now present in North America, Europe, and parts of South America (48–50). Unlike most Drosophila species that are not economic pests, D. suzukii females have a serrated ovipositor that facilitates egg laying in ripe fruit before harvest (51). While farmers mostly rely on insecticides for control, use is weather dependent, resistance has been reported to spinosad and pyrethroids in California (52, 53), and a wide range of noncrop host plants can provide a refuge (54, 55). Area-wide genetic control strategies offer an attractive species-specific alternative for control of this pest. The sterile insect technique (SIT) has been used successfully for area-wide suppression of some pests for over 70 y (56). In an SIT program, a large excess of sterile males (at least 10:1) is repeatedly released over the targeted area. For implementation of SIT for control of D. suzukii, methods for mass rearing and for sterilization have been developed (57–59). A recent study found that repeated releases of sterile males led to significant suppression of a field population of D. suzukii (60). Kandul and colleagues used the pgSIT approach to generate sterile D. suzukii males (6). This required crossing Cas9 and sgRNA strains that produced offspring with Cas9-mediated loss-of-function mutations in genes essential for female survival and male fertility. Repeated releases of sterile males (3 to 5:1 release ratio) into lab cage populations led to effective population suppression. We recently developed fsRIDL D. suzukii strains (61, 62) that produce only males when reared on diet without tetracycline. We showed that repeated releases of an excess of fsRIDL males (3 to 10:1 release ratio) led to suppression of small cage populations of D. suzukii. While effective, implementing SIT, pgSIT, and fsRIDL control programs across a large area would likely be expensive because of the need to repeatedly release an excess of sterile or modified males. As homing gene drive offers a potentially much more efficient population suppression approach for control of D. suzukii (63), here we have developed and evaluated a CRISPR/Cas9-based split homing gene drive that targets the female-specific exon of dsx.
Results
dsx Female-Exon Disruption Causes Dominant Female Sterility in Most but Not All Lines.
The dsx female-specific exon (Fig. 1A) is highly conserved in the genomes of wild-type D. suzukii collected across the United States and several other locations in Europe and South America (64) (SI Appendix, Table S2). Six sgRNAs were evaluated using an in vitro DNA cleavage assay with recombinant Cas9 (SI Appendix, Fig. S1). One of the most effective, dsx-sgRNA3, was selected for the homing gene drive construct. The selected target is well conserved across D. suzukii genomes (SI Appendix, Table S2). The dsx homing cassette (6.1 kb) consists of dsx homology arms, an U6:3 promoter–dsx-sgRNA3 gene, and a constitutively expressed DsRed selection marker gene (Fig. 1B). The U6:3 promoter was from D. melanogaster (65) and was used previously to express a white sgRNA in D. suzukii (66). The sgRNA targets Cas9 to the dsx female exon to induce a DSB 52 bp downstream from the start of the exon. Following microinjection of the dsx homing construct and Cas9 protein precomplexed with the dsx-gRNA into precellular embryos (67, 68), four independent homing strains were established at a transformation rate of about 9% (Dataset S1). All of the transgenic G1 females that had a single copy of the dsx homing transgene were sterile with the exception of two out of the six females obtained from the 1C G0 parent (Dataset S1). Consequently, the homing lines have been maintained by crossing transgenic males with wild-type virgin females each generation. To further investigate sterility, hemizygous females were crossed with wild-type males, and the proportion that produced offspring was recorded. Hemizygous 1C2 female fertility was comparable to wild type (Fig. 1D and SI Appendix, Table S3), but fecundity was reduced (SI Appendix, Table S5). However, hemizygous females from the other lines were fully sterile (i.e. dominant sterility) (Fig. 1D) and did not lay eggs (SI Appendix, Table S4). Morphologically, the dominant sterile females appeared to be very similar to wild type with a serrated ovipositor that allows the pest to lay eggs in ripe fruit (SI Appendix, Fig. S4). Further, upon dissection, the ovaries appeared to contain developing eggs, although the ovaries were often smaller than wild type (SI Appendix, Fig. S5). All homozygous 1C2 flies were intersexual but could be separated morphologically as male-like or female-like (SI Appendix, Figs. S2–S5). Molecular analyses with PCR primer pairs for X-linked (yellow) and Y-linked (DsPp1-Y2) genes showed that the male-like and most of the female-like intersex flies were genetically male (XY) and female (XX), respectively (SI Appendix, Fig. S10 A and B).
Fig. 1.
We hypothesized that the reason 1C2 hemizygous females were fertile but females from the other initial drive strains were sterile was because of nucleotide differences that somehow influence the splicing of dsx exon 2 to the male exon. To test this hypothesis, we initially amplified and sequenced a 6.7-kb region from the transgene to the male exon. However, very few nucleotide differences were found between the drive strains and none that were unique to 1C2 (SI Appendix, Fig. S8). Consequently, we next examined a 1.07-kb region upstream of the transgene that included the common exon 2 and part of the first intron. In this region, there were a few nucleotide differences between the 1C2 strain and the sterile strains, mostly within the first intron (SI Appendix, Fig. S9).
Hemizygous Females Express the dsxM Transcript.
We next examined whether any of the females from the homing strains produce the male-specific dsxM transcript. Reverse transcriptase PCR and 3′RACE-PCR analyses showed that the hemizygous females from the dominant female sterile lines produce both the male and female transcripts, but 1C2 females only make the female transcript (Fig. 1 E and F). In addition, 3′ RACE analysis identified a shorter transcript in females from all lines that appears to use a cryptic polyadenylation signal in the U6:3 terminator (SI Appendix, Fig. S7 and Table S7). All strains produce the female dsxF transcript (Fig. 1F). However, this analysis also detected a minor splice variant that was present in all sterile strains but not 1C2 (Fig. 1F). This transcript was produced through joining of the exon 2 splice donor site with a cryptic SA site in the D. melanogaster polyubiquitin promoter (reverse strand), which is part of the PUb-DsRed marker gene (SI Appendix, Table S8). Male-like (XY) 1C2 homozygotes did not produce the dsxM transcript (SI Appendix, Fig. S10C). However, a related transcript, dsxM.C2, which is similar to dsxM but has an extra copy of exon 2, was identified (SI Appendix, Table S8). The extra copy of exon 2 is in-frame and would encode a protein identical to DSXM but with a duplication of the 46 amino acid domain encoded by exon 2 (SI Appendix, Table S12). These molecular analyses show that the female-exon knock-in disrupts splicing of dsx transcripts.
Addition of a Myosin Splice-Acceptor Site Rescued the Hemizygous Female Sterility of Homing Strains.
Previous modeling had shown that population suppression would be more efficient if homing occurred in both sexes (69). To consistently obtain a drive that was not dominant female sterile, we reasoned that the addition of an optimal SA site directly after the left homology arm could prevent the use of the downstream male exon SA site. The modified homing construct contains the SA site sequence of muscle myosin heavy-chain gene from D. melanogaster (70, 71), followed by an in-frame short coding region that includes an HA epitope tag (72) and C-terminal degron sequence (73, 74) (Fig. 1C). The latter was included to promote proteolysis of the DSX-HA protein to minimize any potential interference with the DSXF protein made by the nontargeted dsx allele. Following microinjections with the homing construct and Cas9/sgRNA complex, four G0 produced transgenic offspring. Molecular analyses confirmed the correct integration of the transgene in all four of the dsxSA homing construct (DsxSA-HC) strains (SI Appendix, Fig. S6). In contrast to the sterility observed with the initial homing construct, hemizygous females from all four lines were fertile and comparable to wild type (Fig. 1D). The fecundity of a selected line, 23AI1SA, was comparable to wild type (SI Appendix, Table S5). Further, RT-PCR and 3′RACE-PCR analyses confirmed that these hemizygous females were not expressing the male transcript (Fig. 1 E and F), but the transcript “HA tag-C-degron” was being expressed and correctly spliced (Fig. 1G and SI Appendix, Fig. S7). Hence, these results demonstrated that myosin splice site presence prevented the male transcript expression and significantly rescued hemizygous female sterility observed with the initial dsx knock-in lines. Homozygotes were intersexual, either XY male-like or XX female-like (SI Appendix, Fig. S10). Male-like homozygotes did not appear to produce the dsxM transcript but did efficiently use the myosin SA site.
Homing Gene Drive Efficiency.
We tested homing gene drive efficiency by following a split homing gene drive approach (28) using a previously developed Dmnos-Cas9-NLS line (#36) that expresses Cas9 in the germline from the D. melanogaster nanos promoter (66). Homozygous Cas9 virgin females were crossed with hemizygous males of a homing strain. Their offspring that carried a copy of the Cas9 transgene and the disrupted dsx gene with the drive construct were identified and then crossed with wild-type flies (29). The males and females obtained from the initial cross were called “male drive” and “female drive”, respectively (Fig. 2B). For the dominant sterile female strains, only the male drive homing was assessable, whereas with fertile female strains, both the male and female drive’s homing efficiency was measured. This was done by counting the proportion of offspring that showed red fluorescence. If there was no homing, 50% of the offspring would be expected to inherit the disrupted dsx allele with the DsRed and sgRNA genes. The female drives of 1C2 and 23AI1SA showed drive inheritance of 61% and 58%, respectively (Fig. 2C, Dataset S2, Tabs 4 and 6). The homing drive inheritance of the male drives of these strains was significantly higher (P < 0.0001, one-way ANOVA) at 71% and 66%, respectively (Fig. 2D). The homing drive efficiency of other female fertile lines 1C1 and 6CT1SA was found in the same range (Dataset S2, Tabs 3 and 5). For the dominant female sterile strains 3A3 and 15A2, the male drives showed a homing drive inheritance of 57% and 56% (Dataset S2, Tabs 1, 2). We also measured the homing drive efficiency using a Dmvasa-Cas9-NLS line (#4) that is active in the germline and soma (66). The male drive showed drive inheritance up to 59 to 65% (SI Appendix, Fig. S12 and Dataset S2, Tabs 7-9). The female drive efficiency could not be assessed as females developed a deformed ovipositor structure and were sterile. All of the drive experiments described above were from crosses of groups of males and females (i.e., batch crosses). For the fertile 1C2 line, we also measured drive efficiency with single-drive parents. The individual 1C2 female drive and male drive crosses showed drive inheritance which was comparable to batch crosses with an average of 58% for female drive and 69% for male drive but with more variation between crosses (Dataset S2, Tabs 10, 11).
Fig. 2.
The Dmnos-Cas9-NLS line (#36) used for the above experiments had lower editing efficiency than lines that carried a version of Cas9 with two nuclear localization sequences (NLS-Cas9-NLS), gene promoters from D. suzukii, and a viral p10 terminator (66). Unfortunately, we were unable to use these lines for drive experiments as, like the homing construct, they also carried a constitutively expressed red fluorescent protein marker (66). Consequently, with the aim of improving homing efficiency, Cas9 lines were made that expressed NLS-Cas9-NLS from the D. suzukii nanos promoter (Fig. 2A). The 3′UTR and flanking sequence from the D. suzukii nanos gene were used to ensure localization of the Cas9 transcript at the posterior end of the oocyte and translational repression of unlocalized transcripts (75). Preliminary crosses with lines that express sgRNAs for the yellow and white genes (66) indicated that the NLS-Cas9-NLS lines were all active and produced a high proportion of heritable yellow and white mutations (SI Appendix, Table S9). Homing drive experiments were performed as before with one of the X-linked NLS-Cas9-NLS lines (#27AI1). Homozygous virgin NLS-Cas9-NLS females were crossed with hemizygous Dsx-HC and DsxSA-HC males, and offspring were collected that had one copy of each transgene. For the dominant female sterile line 3A3, male drive efficiency was high with a homing drive inheritance of 97% (Fig. 2F, Dataset S2, Tab 12). Similarly, male and female drives showed a high homing drive inheritance of 97 to 99% with the 1C2 and 23AI1SA lines (Fig. 2 E and F, Dataset S2, Tabs 13-14 and 17). However, fecundity was reduced with the female drives compared to wild type (SI Appendix, Table S6), which suggests somatic Cas9 activity and/or maternal Cas9 deposition as Cas9 was inherited from the female parent. Reduced fecundity was observed in A. gambiae heterozygous dsx drive females (7). Further, the F2 female offspring from female drives showed a deformed ovipositor and were sterile. Molecular analysis showed the presence of insertion/deletions (indels) at the Cas9 cut site, indicating significant maternal deposition of Cas9 and sgRNA. F2 females from male drives were fertile. We also performed drive experiments beginning with Cas9 males crossed with hemizygous 1C2 and 23AI1SA virgin females. A high frequency of transmission of the DsRed gene was again observed with 99% and 95% of the offspring showing red fluorescence, respectively (SI Appendix, Fig. S13 and Dataset S2, Tabs 15, 16).
Potential Resistance Allele Development.
In D. melanogaster homing drive strains, a lower drive inheritance rate due to resistance allele formation through NHEJ repair pathways has been reported (28, 34). As the female exon of dsx is essential for function, most deletion mutations would simply be lost from the population. However, it is possible that some small in-frame deletion or insertion mutations would be resistant to Cas9 cleavage but produce a functional DSX protein. Consequently, we performed deep sequencing and Sanger sequencing of genomic DNA from nondrive flies, the flies that did not inherit the DsRed fluorescent protein gene. The flies will carry one wild-type copy of dsx from the wild-type parent and one potentially mutant dsx allele from the drive parent. The analysis of nondrive flies from the crosses with the Dmnos-Cas9-NLS #36 line revealed that approximately 90 to 99% were wild type (SI Appendix, Fig. S11), which is consistent with the low activity of the Cas9 line. Of the modified alleles, likely loss-of-function (frameshift) and potentially functional in-frame deletion mutations were identified (Dataset S3, Tabs 1-3). From the drive experiments with the Dsnos-NLS-Cas9-NLS line, a higher proportion of the nondrive flies showed indels, which is consistent with higher Cas9 activity of the line. From the female drive crosses, 100% of the nondrive flies showed modified dsx alleles. About 50% of the nondrive flies from the male drive crosses were wild type (Dataset S3, Tab 4).
We next evaluated whether some of the mutations would prevent in vitro cleavage of DNA templates by Cas9/sgRNA complex. While single bp changes within the dsx-sgRNA3 target did not prevent DNA cleavage, templates with 3 bp and 6 bp in-frame deletions were not appreciably digested by Cas9 (SI Appendix, Fig. S1). To determine whether the DSX protein produced from a dsx mutant allele was functional, we injected D. suzukii embryos with Cas9/dsx-sgRNA3 complex and long single-stranded oligonucleotides (ssODNs) with the deletion mutations. If the ssODN was used as a template for HDR, the dsx allele should have the desired in-frame 3-bp or 6-bp deletion. Individual G0 were crossed with hemizygous 23AI1SA flies and their female offspring collected and individually assessed for fertility and then genotyped (Fig. 3, Dataset S3, Tab 5). All G1 females that carried a dsx allele with either the 3bp or 6bp deletion were sterile and had a deformed ovipositor (Fig. 3). Thus, the DSXF proteins produced by the mutant alleles do not appear to be functional.
Fig. 3.
Mathematical Simulations.
We next modeled discrete generation lab cage population suppression experiments similar in design to those we used previously with a D. suzukii fsRIDL strain (61). We were interested in determining what release ratios would be needed to drive the cage populations to extinction. As before, the starting population would consist of 300 pairs of a North Carolina wild-type strain of D. suzukii. The released males would carry one copy of the X-linked NLS-Cas9-NLS gene used above and one copy of a dsx homing drive transgene. To be successful, the released males would need to be competitive with the wild-type males for mating with virgin females. Consequently, we next performed mating competition experiments with wild-type males, drive males, and wild-type virgin females in a 1:1:1 ratio. The results show that the drive males are fully competitive with wild-type males (SI Appendix, Table S10). Nevertheless, the model incorporated a fitness cost of 5% for the Cas9 transgene. The model also included a reduced fecundity for hemizygous 23AI1SA drive females (approximately 63% relative to wild type, SI Appendix, Table S6) and 100% sterility for female offspring of hemizygous drive females (SI Appendix, Fig. S14). Repeated releases of males at relatively low release ratios (1:4) with either dominant or recessive female sterile drive led to suppression within 10 generations (Fig. 4). In contrast, single releases with release ratios as high as 10:1 (transgenic: wild type) were much less successful in driving the cage populations to extinction (SI Appendix, Fig. S15). We also modeled a fully autonomous drive using the same fitness/fecundity values and homing frequencies as for the split drive. We found that a single release of the dominant female sterile drive is ineffective at low release ratios (SI Appendix, Fig. S16), consistent with earlier modeling that found that an HEG drive that caused dominant female sterility did not invade from rare (76). In contrast, a single release of the recessive female sterile drive showed a much higher likelihood of causing extinction (SI Appendix, Fig. S16).
Fig. 4.
Discussion
In this study, we developed a CRISPR/Cas9-based split homing gene drive that targets dsx, a gene essential for sexual development. A gene drive targeting dsx was found to be highly efficient for suppression of A. gambiae cage populations (7). Similarly, our homing gene drive targeted the highly conserved female-specific exon of dsx in D. suzukii. In this study, the sgRNA was fully within the female exon, whereas for A. gambiae, the sgRNA spanned the intron–female exon boundary. This was thought to be advantageous as there appears to be strong selection for the nucleotide sequence around the splice site, likely reflecting sequence requirements for sex-specific alternative splicing. In D. suzukii, it was not possible to design a sgRNA that spanned the exon–intron boundary due to a lack of a suitable PAM site. The most similar would be a sgRNA that is mostly in the female exon but with a PAM in the intron (sgRNA6, SI Appendix, Fig. S1 A and B). Nevertheless, the sequence we targeted does appear to be functionally constrained. We found that dsx alleles carrying either a 3 bp or 6 bp in-frame deletion did not produce a functional DSXF protein. Both mutations were detected in nondrive flies and do prevent in vitro cleavage of DNA templates by Cas9/sgRNA. However, since the DSXF protein is not functional, it would not produce resistance to drive. Of course, it is possible that other mutations in the targeted sequence could lead to functional resistance to drive. These could be uncovered by performing gene drive experiments with cage populations of D. suzukii. The potential for resistance allele formation could also be reduced by modifying the homing drive to express more than one sgRNA such as dsx-sgRNAs 3 and 4 or 6 (77, 78).
Unlike in A. gambiae (7, 24), D. suzukii females with a single copy of the dsx homing construct were found to be sterile (except 1C lines, see below). The dominant female sterility was not completely unexpected as naturally occurring insertion mutations within the D. melanogaster dsx female-specific exon can cause dominant sterility (46). The mutations in the female exon interrupt regular dsx pre-mRNA alternative splicing generating both the male and female isoforms causing intersexual development (44, 46, 79). That is, apparently, an insertion mutation can disrupt the enhancement of the weak female-specific SA site by the TRA/TRA2/RBP1 complex bound to the dsx 3′UTR, and consequently, the spliceosome makes use of the downstream male exon SA site. In the homing drive strains, the wild-type dsx allele in hemizygous females would continue to produce the female-specific transcript. Consequently, XX flies would have both dsxM and dsxF transcripts, likely causing the observed sterility (46, 80). Although hemizygous sterile females appeared to have a normal ovipositor and contained ovaries, they did not lay eggs, which was possibly caused by altered dsx neuronal function affecting female reproductive behaviors (81). The exception was the 1C hemizygous females (1C1 and 1C2), which were fertile. This could be due to differences in genetic background between the strains. We also considered that this could be due to nucleotide polymorphisms in the dsx gene as alternative splicing follows a complicated regulatory process that is influenced by presence of exonic and intronic mutations (82). However, there were very few nucleotide differences in the 6.7-kb region between the transgene and the downstream dsx male exon and none that were unique to the 1C2 strain. There were a few nucleotide differences between the 1C2 strain and the sterile strains in a 1.07-kb region upstream of the transgene. It is possible that these few specific nucleotides are important for the correct splicing of dsx transcripts. The nucleotide polymorphisms unique to 1C2 were in the first intron about 500 to 600 bp upstream of exon 2 (SI Appendix, Fig. S9). 1C2 males and females did produce an unusual minor transcript that had a duplication of exon 2. This exon duplication could be due to trans-splicing, which is rare in Drosophila (83). A study of RNA splicing in rat liver and kidney concluded that exon repetition is rare, allele specific, and determined in cis (84). If so, the nucleotide polymorphisms unique to 1C2 in the first intron could be influencing this unusual splicing event. It also possible that 1C2 has an extra copy of exon 2, but if so, it must well upstream of the female exon. As epigenetic mechanisms can influence alternative splicing (85), another possibility is that the local chromatin environment around the dsx gene in the 1C lines somehow influences splicing such that the splicing machinery does not use the male exon SA site. This may explain why we did not detect splicing of exon 2 to either the male exon or the cryptic SA site in the polyubiquitin promoter of the DsRed marker gene in the 1C2 strain. Both splicing events were found in all of the dominant sterile strains. It is possible that the protein encoded by the transcript that uses the cryptic SA site could bind to the DSXF protein produced by the wild-type allele and interfere with function as DSX functions as a dimer (86). If so, the observed sterility would be due to production of DSXM and the dominant-negative DSX protein. Last, with regard to splicing, we found that all males produced the dsxM2 transcript (Fig. 1 and SI Appendix, Table S8), which was recently identified in D. melanogaster and found to have masculinizing activity (87). This male-specific transcript is similar to dsxF but retains the female intron, which contains an in-frame translation stop codon near the beginning of the intron. Homozygous 1C2 and 23AI1SA developed as sterile intersexes with XY more male-like and XX more female-like. It is not clear why XY and XX intersexes showed different morphologies as we did not detect either dsxF or dsxM transcripts and both XY and XX appear to produce dsxM2 (SI Appendix, Fig. S10).
Since prior modeling suggested that population suppression would be more efficient if drive was not limited to one sex (69), we modified the homing construct by adding a myosin SA site to reduce the use of the male exon acceptor site. The construct also included an in-frame carboxy-terminal degron motif that could destabilize the protein, but this remains to be shown. All lines carrying the modified homing construct were fertile and did not show any evidence of male splicing. Whereas the dominant female sterile strains are maintained by crossing transgenic males with wild-type virgin females each generation, the dsxSA strains are easily maintained with only the occasional need to remove nontransgenic flies. For rearing at a larger scale, it could be advantageous to make a balancer chromosome with the wild-type dsx gene within a chromosomal inversion and carrying a recessive lethal mutation. Such “balancer” chromosomes are widely used for maintenance of D. melanogaster lines (88).
Drive conversion efficiencies with the Cas9 lines that express a version of Cas9 with N and C-terminal NLS were 89 to 99% for female drive and 95 to 97% for male drive. Drive efficiencies were lower with our original lines that express Cas9 with a single C-terminal NLS. This was consistent with our previous report that NLS-Cas9-NLS lines showed higher editing efficiency (66). Cas9 carrying multiple NLSs has been reported to show higher editing efficiencies in mammalian cells (89, 90). However, it is also possible that using the promoter and 3′UTR from the D. suzukii nos gene for Cas9 expression has improved editing efficiency.
To determine release ratios that could be successful in future lab cage suppression experiments, we modeled repeated releases of males hemizygous for Cas9 and a dsx homing drive construct. The modeling showed that repeated releases of hemizygous males at low release ratios (e.g., 1:4) could suppress a population in less than 10 generations. This compares favorably to the large releases required for SIT [typically 10:1 or higher (56, 91)] and the 3:1 ratio used previously with fsRIDL males in a discrete generation experiment (61). Interestingly, releasing males carrying either the recessive or dominant female sterile gene drives produced similar results (Fig. 4 C and D). With the dominant female sterile drive, suppression is due to introgression of the disrupted dsx gene and homing gene drive in males. The results are similar to coupling fsRIDL to gene drive, which was previously modeled to be very efficient for population suppression (92). We also modeled single releases of fully autonomous dominant and recessive female sterile drives. Consistent with previous modeling of a HEG homing drive that caused dominant female sterility (76), low release ratios of the dominant female drive were unlikely to cause extinction of the cage populations. With drive limited to males, at low release ratios, the drive allele does not accumulate to a high enough level to place a significant load on the cage population. Of course, these modeling predictions remain to be confirmed experimentally. For a future field release, the split drive systems developed in this study have the advantage that the drive is reversible and largely confinable, particularly if the population is isolated (26, 33). For larger-scale field releases, performing a cross of Cas9 and dsx homing lines would be a challenge and would require development of methods for mass separation of sexes. This is also a challenge for the A. gambiae dsx homing strains and for implementation of the pgSIT approach in D. suzukii (6, 7). Fluorescence-based machine sorting could provide a means for separating sexes at scale (93).
The dsx gene was thought to be an excellent target site for gene drive by previous research (7), one that was highly conserved with the potential to be used in a wide variety of insect species. Our finding of dominant sterility potentially complicates the use of this gene in some species, but our use of a SA suggests a way that this could likely be rectified, preserving dsx as a candidate target in diverse species.
Materials and Methods
Homing and Cas9 Constructs Design and Assembly.
The highly conserved small protein-coding part of the dsx female-specific exon was targeted to make a split homing drive strain that would disrupt female fly development. First, the dsx gene sequence was retrieved from the SWD fly base (http://spottedwingflybase.org) and used to design sgRNAs using ChopChop (https://chopchop.cbu.uib.no). The most efficient sgRNAs were selected through in vitro testing (SI Appendix, Fig. S1), and a synthetic DNA fragment designed with left and right homology arms sequences to either side of the Cas9 cut site for one of the gRNAs (sgRNA5) (SI Appendix, Table S1).
All the plasmids used in this study were made following standard cloning techniques and confirmed by DNA sequencing. First, for the homing constructs, the pCFD3 vector (Addgene, #49410) that contains the D. melanogaster U6:3 promoter and terminator was digested with BbsI and then ligated with annealed oligos sgRNA3SS: GTCGAACTTGAATATCTATGACGG and sgRNA3AS: AAACCCGTCATAGATATTCAAGTT (SI Appendix, Table S11) to make the pCFD3-dsx-sgRNA3 construct. Next, the U6:3-dsx-sgRNA3 region (968 bp) from this plasmid was amplified using primers cfd.F1 and cfd.R1 (SI Appendix, Table S11) and then cloned into NotI/NcoI digested pUC57-DsxHDR plasmid to make pUC57-DsxHDR-U6:3-dsx-sgRNA3, an intermediate construct. The pUC57-DsxHDR plasmid contains a 2,102-bp synthesized fragment (GenScript, Piscataway, NJ) that consists of dsx left (1,071 bp) and right (929 bp) homology arms along with a multiple cloning site (MCS-102 bp). To facilitate cloning of the fluorescent protein marker gene PUb-DsRed, an Age-I site was added to the pPUb-DsRed-attB plasmid (94) using the Q5site directed mutagenesis kit (NEB, #E0554S). The DsRed gene was then excised using Asc-I/Age-I and ligated with pUC57-DsxHDR-sgRNA3 that had been digested with the same enzymes to make the final homing construct “pUC57-DsxHDR-U6:3dsx-sgRNA3-pUbDsRed” (Dsx homing construct, 8.9 kb). To make the dsx homing construct with a SA site, a fragment was synthesized that contains the D. melanogaster myosin gene SA followed by a short coding region for a HA tag followed by C-terminal degron and translation stop codon and then the D. melanogaster hsp70 3′UTR and polyA site (SI Appendix, Table S1). The fragment was excised by digestion with PspOMI/PacI and cloned into “pUC57-DsxHDR:U6:3-sgRNA3-pUbDsRed” cut with PspOMI and PacI to generate pUC57-DsxSA:U6:3dsxsgRNA3-pUbDsRed (DsxSA homing construct, 9.5 kb).
For the Cas9 expression construct, we first made an intermediate plasmid pBAC2[Dshsp83-Kozak-NLS-ZsGreen-3′Dshsp83], by amplifying fragments containing the D. suzukii hsp83 promoter, NLS-ZsGreen, and D. suzukii hsp83 3′UTR and 3′ flanking using the primers listed in SI Appendix, Table S11 with plasmid DNA templates. The three fragments were purified and sequentially assembled with a linearized pBAC2 vector (NcoI/SacII) (95) using NEBuilder HiFi DNA assembly kit (NEB#E2621). We next amplified fragments containing the Dsnos promoter, Cas9 with two NLSs (96), and Dsnos 3′ UTR and flanking using primers listed in SI Appendix, Table S11, with plasmid DNA templates. The purified fragments were sequentially assembled with a linearized pBAC2[Dshsp83-Kozak-NLS-ZsGreen-3′Dshsp83] vector (NotI/XhoI) using the NEBuilder HiFi DNA assembly kit. The resulting plasmid was confirmed by DNA sequencing and named pB-Dsnos-NLS-SpCas9-NLS hsp83-ZsGreen.
Microinjections and Homing Strains Establishment.
Plasmid DNA was purified from E. coli cultures using the Zymo Midi Kit (Cat#D4201), ethanol-precipitated, and dissolved in injection buffer (sodium phosphate buffer supplied with 300 mM of KCl) to a final concentration of ~1,000 ng/μL. Prior to microinjection, the plasmid DNA was filtered through a 0.45-μm filter (MilliporeSigma, Cat#UFC30HV25). To make the RNP complexes for use with the homing constructs, either synthetic “crRNA:tracrRNA” duplex (IDT synthesized) or sgRNA made by in vitro transcription using the MEGAshortscript T7 transcription kit (Invitrogen, Cat#AM1354). For crRNA:tracrRNA, the dsx-crRNA (72 ng/μL) and tracrRNA (134 ng/μL) were mixed in nuclease-free duplex buffer (IDT) and incubated at 95 °C for 5 min and then allowed to cool to room temperature for duplex formation. The ribonucleoprotein complexes (RNPs) were preassembled by incubating crRNA:tracrRNA duplex (134 ng/μL:72 ng/μL) or synthesized sgRNA (150 ng/μL) with Cas9 protein (NEB #M0646T) in injection buffer supplemented with 300 mM KCl at 37 °C for 20 to 30 min. The final injection mix consisted of plasmid DNA at 500 ng/μL and Cas9 RNP complex at a final concentration of 322 to 500 ng/μL for Cas9 and was centrifuged at max speed for at least 10 min at 4 °C prior to injection. For making in-frame deletion mutations, ssODNs were synthesized (IDT) and mixed with Cas9 RNP complex to a final concentration of 2 to 10 μM. D. suzukii precellular embryos were microinjected, and the G0 adult flies were individually crossed with wild-type counter flies and the offspring screened for red fluorescence to identify any positive transformants as described previously (61, 67). In one of the injections, ligase 4-dsRNA (200 ng, MegaScrib RNAi kit used for dsRNA synthesis) was included in the injection mix with the aim of promoting the HDR repair pathway for the homing construct knock-in.
Confirmation of Homing Constructs Integration into the dsx Gene.
To confirm successful knock-in of the homing constructs into dsx target region, genomic DNA was extracted from adults, and PCR was performed using a primer (SI Appendix, Table S11) from the homing cassette and a primer from the neighboring genomic region. PCR was performed on both sides of the knock-in. Further, the PCR products were cloned into pGEM-T easy vector (Promega) followed by Sanger sequencing.
RT-PCR and RACE-PCR of dsx Transcripts.
RT-PCR and 3′ RACE-PCR were performed to analyze dsx transcripts in the female flies of established lines, with wild-type flies used as control. To perform RT-PCR on these lines, total RNA was isolated as previously described (97) from hemizygous virgin females, hemizygous males, and homozygous XY intersex (n = 12 to 20) followed by cDNA synthesis using SuperScript III (Invitrogen, Cat#18080400) following the manufacturer’s recommendations. cDNAs were used as templates to amplify the dsx male and female isoforms using specific primer pairs (SI Appendix, Table S11) and OneTaq 2X master mix with standard buffer (NEB, #M0482S). RT-PCR products were purified and cloned into the pGem-T easy vector (Promega, Cat#A1360) followed by Sanger sequencing (SI Appendix, Table S8). 3′ RACE-PCR on RNA from 3A3, 1C2, and 23AI1SA lines was carried out according to the kit manual (SMARTer RACE 5′/3′ kit from Clontech, cat#634859) with RACE ready cDNA synthesized from the virgin hemizygous females. Amplification was performed using the provided universal primer mix along with dsx gene-specific-primer1 (GSP1), followed by a nested PCR with dsx GSP2 (SI Appendix, Table S11). The nested 3′-RACE-PCR products were cloned into the pRACE vector, and plasmid DNA was sequenced using Sanger sequencing (SI Appendix, Table S7).
Sequencing to Detect SNPs (Single Nucleotide Polymorphisms).
From the fertile (1C2) and sterile strains (3A3, 15A2, and 30B1), a 6.7-kb region from the transgene to the downstream dsx male exon was amplified from genomic DNA using a 1:1 mixture of Q-5 High-Fidelity (M0492S) and OneTaq (M0482S) DNA polymerases with primer pair pUbF4_CTAATTCACAAGACCCTGAAGCA and DsxMTR4_GAGTAATACTTACACAAAGAGGACAGC (SI Appendix, Table S8). The PCR products were cloned into pGem-T easy vector (Promega), and the complete sequence of the plasmid DNA was determined by Illumina sequencing (Next Generation Sequencing) at the MGH, CCIB DNA core facility (Cambridge, MA). The 1.07-kb region upstream of the transgene was amplified from genomic DNA (Dsx-HC and Dsx-HCSA strains), cloned into pGem-T easy vector (Promega, Cat#A1360), and the DNA sequence determined by Sanger sequencing. All of the obtained sequences were analyzed for any SNP among the strains using MacVector [version 18.2.3 (33)].
Transgenic Female Fertility, Egg-Laying, and Male Competition Assays.
Fertility of female fertile lines was assessed by crossing single 4 to 5-d-old females with three wild-type males. Twenty replicates were performed for each line. For sterile female lines 3A3, 15A2, and 30B1, batch crosses were set with 10 females and 10 wild-type males. Vials were monitored for any offspring for at least 2 wk after setting the crosses (SI Appendix, Table S3). For the egg-laying assay, 6 to 7-d-old hemizygous females (n = 15 to 20) were mated with the same number and age of wild-type males and left for 24 h on plates (60 × 15 mm) containing fresh diet. Flies were then transferred to fresh egg-laying plates for a further 24 h. Both sets of plates were examined for deposited eggs (SI Appendix, Table S4). All the crosses were set in triplicate. The wild-type NC strain was used as control.
To assess male competitiveness, five wild-type males, five transgenic males, and five wild-type virgin females were placed in a vial and observed for 1 h. The flies were all 5 d old. Any copulating pairs were removed from the vial by aspiration. The genotype of the males was determined by fluorescence microscopy.
Fly Rearing and Split Homing Gene Drive Crosses.
All transgenic lines and wild-type fly stocks were raised on cornmeal-yeast-agar diet at room temperature (20 to 22 °C) in the open laboratory as described previously (62). The wild-type colony was established from infested fruit collected from a field in North Carolina in 2011 (98) and has been periodically augmented with flies collected in North Carolina (99). Males from sterile dsx homing lines (3A3, 15A2, and 30B1) were maintained by crossing males with wild-type virgin females. To measure the editing activity of the Dsnos-NLS-Cas9-NLS lines, virgin females were crossed with males from the yellow sgRNA line ex2 and white sgRNA line wex2 (66). Virgin female offspring were crossed with wild-type or yellow males and the phenotype of the male offspring scored for yellow body or white eye phenotypes.
To set split homing drive crosses (28), the previously characterized Dmnos-Cas9-NLS #36 (also called Nos.Cas9.G#36) and Dmvasa-Cas9-NLS #4 (also called Vasa.Cas9.G#4/10) Cas9 lines (66) were crossed with dsx homing lines. Homing drive crosses were set in 2 to 3 batches with 10 pairs. For “Cross-I”, virgin Cas9 females and homing males were crossed, and the trans-heterozygous (having both Cas9 and homing cassette) F1 offspring were collected. The males and virgin females, called “male drive” and “female drive”, respectively, were then crossed with wild-type flies of the opposite sex in “Cross-II”. The F2 offspring from Cross-II were scored for the inheritance of the red fluorescent protein marker using an M205FA microscope (Leica Microsystems, Buffalo Grove, IL) with the DsRed filter [ex545/25, em 595/50 nm]. The F2 offspring that did not show red fluorescence (i.e. non-drive) flies were saved at −80 °C for molecular analysis. In addition to the batch crosses, individual male or female 1C2 flies were crossed with wild-type flies (1:3) to evaluate drive inheritance (Dataset S2, Tabs 10, 11). All “Cross-I” crosses were set in triplicate. Similarly, the split homing drive crosses were set with the X chromosome-linked Dsnos-NLS-Cas9-NLS line #27AI1 and the Dsx-HC (3A3, 1C2) and DsxSA-HC (23AI1SA) lines. The gene drive experiments were performed in an ACL2 containment facility.
Resistance Assessment.
Genomic DNA was extracted from nondrive flies that lacked red fluorescence (~28 to 150) using organic extraction as described previously (97) or by using a Qiagen DNeasy Blood and Tissue kit (Cat#69504) following the manufacturer’s instructions. The DNA was amplified using OneTaq polymerase (NEB#M0484S) and the primer pair DsxcutF1_GGGTAAGTGAACTGATCATTGAAAC and DsxcutR1_ GAAGATAATCCAAGTTGCGCTTTAG that flank the Cas9 cut site and the 406-bp DNA fragment sequenced using Illumina DNA sequencing (Azenta Life Sciences). The deep sequencing data were analyzed using CRISPResso2 software, version 2.2.8. (100). Paired-end reads with a minimum average read quality 30 (parameter -q 30) were analyzed for “indels” on the target site. Frameshift analysis was performed (using parameter -c) on female exon’s coding sequence. For nondrive flies obtained from crosses with the Dsnos-NLS-Cas9-NLS line #27AI1, individual flies were homogenized in 50 squash buffer (10 mM Tris pH 8.2, 1 mM EDTA pH8, 25 mM NaCl, and 200 μg/mL proteinase K) and then incubated at 37 °C for 45 min and 95 °C for 2 min. PCR was performed as above with 2 μL of genomic DNA. The PCR products were sequenced using Sanger sequencing and analyzed using the Synthego ICE Analysis Tool v3 (Synthego). For the experiments with ssODNs, DNA from individual flies was obtained by homogenization in squash buffer, amplified, and sequenced using Sanger sequencing. The DNA sequences were analyzed using SnapGene (SnapGene, version 6.1.1).
Statistical Analysis.
Statistical analyses were mostly performed using GraphPad Prism version 9.1.2 (225). At least three replicate data were used for the comparisons. For the gene drive inheritance analysis, one-way ANOVA, Tukey’s multiple comparison test, was performed. Drive inheritance between female drive and male drive was analyzed using Student’s t test (in Excel). The female fertility, egg laying, and female fecundity data were analyzed using one-way ANOVA, Dunnett’s multiple comparison test. The male mating competitiveness data were analyzed in SAS (version 9.4, Cary, NC). A two-sided z-test was run for each line comparing the MCI to the null hypothesized proportion of 0.5.
Modeling.
We used a discrete-time stochastic model with nonoverlapping generations and conversion efficiencies based on sex. No relative fitness cost associated with the dsx transgene was assumed, although a (multiplicative) fitness cost of 5% affecting hatching probability was assumed for the Cas9 transgene. Resistant-allele evolution was ignored. We used this model to simulate a recessive female sterile split drive based on the 23AI1SA line, a dominant female sterile split drive, and fully autonomous versions of each. In all cases, flies homozygous for the dsx transgene are sterile.
For the recessive female sterile drive, the conversion efficiencies used are 97.36% and 93.88% in males and females, respectively. In addition, hemizygous females have a fecundity of 62.74% relative to wild-type females. Strong maternal deposition is included so that all female offspring of hemizygous drive (one copy each Cas9 and gRNA transgenes) are sterile. For the dominant female sterile drive, the male conversion efficiency used was 95.03%.
We simulated the spread of either gene drive in a small cage experiment using a population of 600 flies. The cage experiment is based on the approach outlined in Li et al. (61). Specifically, each generation is initialized with N=300x(T/C) male and female flies. Here, T is the average number of female offspring produced in a test bottle, and C is the average number of female offspring produced in a control (i.e., drive-free) bottle. C remains fixed throughout the experiment, but T will change as the drive allele becomes more abundant. This experimental setup ignores density-dependent dynamics in the fly population.
The number of released transgenic males is constant and is equal to a proportion of the original 300 males. For example, releasing one transgenic male fly for every four wild-type male flies corresponds to a release ratio of 0.25 and adds 75 transgenic males each generation. For both drives, released males are hemizygous for the Cas9 and dsx transgenes. The number of eggs produced by each pairing is determined by a Poisson distribution with mean 50. The genotype of the father and subsequent eggs are determined by their respective multinomial distributions. Sex is binomially distributed.
To initialize the next generation, N male and female eggs each are selected randomly from those produced in the previous generation. Hatching probability depends on genotype and is binomially distributed. Survival to adulthood is assumed constant across genotypes.
Data, Materials, and Software Availability
The data that support the findings of this study are available in the main manuscript and in the supporting information. The NCBI accession numbers for pUC57-DsxHDR-U6:3dsxgRNA3-pUbDsRed, pUC57-DsxSA:U6:3dsxgRNA3-pUbDsRed, and pB-Dsnos-NLS-SpCas9-NLS hsp83-ZsGreen plasmids are OQ130035–OQ130037. The code used to perform the mathematical modeling is available online at https://github.com/cbutler112358/suzukii_pop_supp_code (101).
Acknowledgments
We thank Bill Reid for providing a plasmid with the Dshsp83-ZsGreen marker for transformation of D. suzukii, Fred Gould for helpful discussions, Emily Griffith for statistical analysis of the male mating competitiveness data, Joanna Chiu for providing an alignment of the female dsx exon sequences from D. suzukii collected from different regions, Esther Belikoff and Sophia Webster for microinjection training (A.K.Y.), and our colleagues in the Scott lab for helpful discussions. This work was supported by Biotechnology Risk Assessment Research (BRAG) program grants 2016-33522-25625, 2020-33522-32317, and 2021-33522-35341 from the USDA National Institute of Food and Agriculture to M.J.S. C.B. and A.L.L. were supported by NIH grant R01-AI139085.
Author contributions
A.K.Y., C.B., A.Y., A.A.P., A.L.L., and M.J.S. designed research; A.K.Y., C.B., A.Y., and A.A.P. performed research; A.K.Y., C.B., A.L.L., and M.J.S. analyzed data; and A.K.Y., C.B., and M.J.S. wrote the paper.
Competing interests
The authors declare no competing interest.
Supporting Information
Appendix 01 (PDF)
- Download
- 18.33 MB
Dataset S01 (XLSX)
- Download
- 2.49 MB
Dataset S02 (XLSX)
- Download
- 63.96 KB
Dataset S03 (XLSX)
- Download
- 11.83 MB
References
1
T. Ant et al., Control of the olive fruit fly using genetics-enhanced sterile insect technique. BMC Biol. 10, 51 (2012).
2
C. Concha et al., A transgenic male-only strain of the New World screwworm for an improved control program using the sterile insect technique. BMC Biol. 14, 72 (2016).
3
N. Windbichler, P. A. Papathanos, A. Crisanti, Targeting the X chromosome during spermatogenesis induces Y chromosome transmission ratio distortion and early dominant embryo lethality in Anopheles gambiae. PLoS Genet. 4, e1000291 (2008).
4
R. Galizi et al., A CRISPR-Cas9 sex-ratio distortion system for genetic control. Sci. Rep. 6, 31139 (2016).
5
M. Li et al., Suppressing mosquito populations with precision guided sterile males. Nat. Commun. 12, 5374 (2021).
6
N. P. Kandul et al., Precision guided sterile males suppress populations of an invasive crop pest. GEN Biotechnol. 1, 372–385 (2022).
7
K. Kyrou et al., A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes. Nat. Biotechnol. 36, 1062–1066 (2018).
8
A. Simoni et al., A male-biased sex-distorter gene drive for the human malaria vector Anopheles gambiae. Nat. Biotechnol. 38, 1054–1060 (2020).
9
I. M. Hastings, Selfish DNA as a method of pest control. Philos. Trans. R. Soc. Lond. B Biol. Sci. 344, 313–324 (1994).
10
S. P. Sinkins, F. Gould, Gene drive systems for insect disease vectors. Nat. Rev. Genet. 7, 427–435 (2006).
11
A. Burt, Site-specific selfish genes as tools for the control and genetic engineering of natural populations. Proc. Biol. Sci. 270, 921–928 (2003).
12
Y. S. Chan, D. S. Huen, R. Glauert, E. Whiteway, S. Russell, Optimising homing endonuclease gene drive performance in a semi-refractory species: The Drosophila melanogaster experience. PLoS One 8, e54130 (2013).
13
Y. S. Chan, D. A. Naujoks, D. S. Huen, S. Russell, Insect population control by homing endonuclease-based gene drive: An evaluation in Drosophila melanogaster. Genetics 188, 33–44 (2011).
14
N. Windbichler et al., Homing endonuclease mediated gene targeting in Anopheles gambiae cells and embryos. Nucleic Acids Res. 35, 5922–5933 (2007).
15
N. Windbichler et al., A synthetic homing endonuclease-based gene drive system in the human malaria mosquito. Nature 473, 212–215 (2011).
16
E. Bier, Gene drives gaining speed. Nat. Rev. Genet. 23, 5–22 (2022).
17
R. R. Raban, O. S. Akbari, "An introduction to the molecular genetics of gene drives and thoughts on their gradual transition to field use" in Transgenic Insects: Techniques and Applications, M. Q. Benedict, M. J. Scott, Eds. (CABI, Wallingford, UK, ed. 2, 2022), pp. 174–199.
18
J. Champer, Drosophila melanogaster as a model for gene drive systems" in Transgenic Insects: Techniques and Applications, M. Q. Benedict, M. J. Scott, Eds. (CABI, Wallingford, UK, ed. 2, 2022), pp. 200–223.
19
M. Jinek et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–821 (2012).
20
J. A. Doudna, E. Charpentier, Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096 (2014).
21
J. E. DiCarlo, A. Chavez, S. L. Dietz, K. M. Esvelt, G. M. Church, Safeguarding CRISPR-Cas9 gene drives in yeast. Nat. Biotechnol. 33, 1250–1255 (2015).
22
V. M. Gantz, E. Bier, The mutagenic chain reaction: A method for converting heterozygous to homozygous mutations. Science 348, 442–444 (2015).
23
H. A. Grunwald et al., Super-mendelian inheritance mediated by CRISPR-Cas9 in the female mouse germline. Nature 566, 105–109 (2019).
24
A. Hammond et al., A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae. Nat. Biotechnol. 34, 78–83 (2016).
25
V. M. Gantz et al., Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi. Proc. Natl. Acad. Sci. U.S.A. 112, E6736–E6743 (2015).
26
M. Li et al., Development of a confinable gene drive system in the human disease vector Aedes aegypti. Elife 9, e51701 (2020).
27
D. Chae et al., Chemical controllable gene drive in Drosophila. ACS Synth. Biol. 9, 2362–2377 (2020).
28
N. P. Kandul et al., Assessment of a split homing based gene drive for efficient knockout of multiple genes. G3 (Bethesda). 10, 827–837 (2020).
29
J. Champer et al., A CRISPR homing gene drive targeting a haplolethal gene removes resistance alleles and successfully spreads through a cage population. Proc. Natl. Acad. Sci. U.S.A. 117, 24377–24383 (2020).
30
N. P. Kandul, J. Liu, J. B. Bennett, J. M. Marshall, O. S. Akbari, A confinable home-and-rescue gene drive for population modification. Elife 10, e65939 (2021).
31
G. Terradas et al., Inherently confinable split-drive systems in Drosophila. Nat. Commun. 12, 1480 (2021).
32
M. Q. Benedict et al., Recommendations for laboratory containment and management of gene drive systems in arthropods. Vector Borne Zoonotic Dis. 18, 2–13 (2018).
33
J. Champer et al., Molecular safeguarding of CRISPR gene drive experiments. Elife 8, e41439 (2019).
34
J. Champer et al., Novel CRISPR/Cas9 gene drive constructs reveal insights into mechanisms of resistance allele formation and drive efficiency in genetically diverse populations. PLoS Genet. 13, e1006796 (2017).
35
T. A. R. Price et al., Resistance to natural and synthetic gene drive systems. J. Evol. Biol. 33, 1345–1360 (2020).
36
C. Xue, E. C. Greene, DNA repair pathway choices in CRISPR-Cas9-mediated genome editing. Trends Genet. 37, 639–656 (2021).
37
A. M. Hammond et al., The creation and selection of mutations resistant to a gene drive over multiple generations in the malaria mosquito. PLoS Genet. 13, e1007039 (2017).
38
A. R. North, A. Burt, H. C. J. Godfray, Modelling the suppression of a malaria vector using a CRISPR-Cas9 gene drive to reduce female fertility. BMC Biol. 18, 98 (2020).
39
D. Bopp, G. Saccone, M. Beye, Sex determination in insects: Variations on a common theme. Sex. Dev. 8, 20–28 (2014).
40
M. Salvemini et al., Genomic organization and splicing evolution of the doublesex gene, a Drosophila regulator of sexual differentiation, in the dengue and yellow fever mosquito Aedes aegypti. Bmc Evol. Biol. 11, 41 (2011).
41
K. Hoshijima, K. Inoue, I. Higuchi, H. Sakamoto, Y. Shimura, Control of doublesex alternative splicing by transformer and transformer-2 in Drosophila. Science 252, 833–836 (1991).
42
Y. Yang, W. Zhang, J. R. Bayre, M. A. Weiss, Doublesex and the regulation of sexual dimorphism in Drosophila melanogaster: Structure, function, and mutagenesis of a female-specific domain. J. Biol. Chem. 283, 7280–7292 (2008).
43
K. W. Lynch, T. Maniatis, Assembly of specific SR protein complexes on distinct regulatory elements of the Drosophila doublesex splicing enhancer. Genes Dev. 10, 2089–2101 (1996).
44
R. Nothiger et al., Genetic and developmental analysis of the sex-determining gene doublesex (dsx) of Drosophila melanogaster. Genet. Res. 50, 113–123 (1987).
45
B. S. Baker, M. F. Wolfner, A molecular analysis of doublesex, a bifunctional gene that controls both male and female sexual-differentiation in Drosophila melanogaster. Genes Dev. 2, 477–489 (1988).
46
R. N. Nagoshi, B. S. Baker, Regulation of sex-specific RNA splicing at the Drosophila doublesex gene–cis-acting mutations in exon sequences alter sex-specific RNA splicing patterns. Genes Dev. 4, 89–97 (1990).
47
E. Clough et al., Sex- and tissue-specific functions of Drosophila doublesex transcription factor target genes. Dev. Cell 31, 761–773 (2014).
48
M. K. Asplen et al., Invasion biology of spotted wing Drosophila (Drosophila suzukii): A global perspective and future priorities. J. Pest Sci. 88, 469–494 (2015).
49
A. Cini et al., Tracking the invasion of the alien fruit pest Drosophila suzukii in Europe. J. Pest Sci. 87, 559–566 (2014).
50
G. Tait et al., Drosophila suzukii (Diptera: Drosophilidae): A decade of research towards a sustainable integrated pest management program. J. Econ. Entomol. 114, 1950–1974 (2021).
51
M. Hauser, A historic account of the invasion of Drosophila suzukii (Matsumura) (Diptera: Drosophilidae) in the continental United States, with remarks on their identification. Pest Manag. Sci. 67, 1352–1357 (2011).
52
B. E. Gress, F. G. Zalom, Identification and risk assessment of spinosad resistance in a California population of Drosophila suzukii. Pest Manag. Sci. 75, 1270–1276 (2019).
53
F. Ganjisaffar, M. R. Demkovich, J. C. Chiu, F. G. Zalom, Characterization of field-derived Drosophila suzukii (Diptera: Drosophilidae) Resistance to pyrethroids in California berry production. J. Econ. Entomol. 115, 1676–1684 (2022).
54
J. C. Lee et al., Infestation of wild and ornamental noncrop fruits by Drosophila suzukii (Diptera: Drosophilidae). Ann. Entomol. Soc. Am. 108, 117–129 (2015).
55
M. Kenis et al., Non-crop plants used as hosts by Drosophila suzukii in Europe. J. Pest Sci. 89, 735–748 (2016).
56
W. Klassen, C. F. Curtis, "History of the sterile insect technique" in Sterile Insect Technique. Principles and Practice in Area-Wide Integrated Pest Management, V. A. Dyck, J. Hendrichs, A. S. Robinson, Eds. (Springer, Dordrecht, 2005), pp. 3–36.
57
F. Sassu et al., Mass-rearing of Drosophila suzukii for sterile insect technique application: Evaluation of two oviposition systems. Insects 10, 448 (2019).
58
M. Aceituno-Medina, A. Ordonez, M. Carrasco, P. Montoya, E. Hernandez, Mass rearing, quality parameters, and bioconversion in Drosophila suzukii (Diptera: Drosophilidae) for sterile insect technique purposes. J. Econ. Entomol. 113, 1097–1104 (2020).
59
G. Lanouette et al., The sterile insect technique for the management of the spotted wing drosophila, Drosophila suzukii: Establishing the optimum irradiation dose. PLoS One 12, e0180821 (2017).
60
R. A. Homem et al., Field suppression of spotted wing Drosophila (SWD) (Drosophila suzukii matsumura) using the sterile insect technique (SIT). Insects 13, 328 (2022).
61
F. Li et al., A conditional female lethal system for genetic suppression of the global fruit crop pest Drosophila suzukii. Pest Manag. Sci. 77, 4915–4922 (2021).
62
A. Yamamoto, A. K. Yadav, M. J. Scott, Evaluation of additional Drosophila suzukii male-only strains generated through remobilization of an FL19 transgene. Front. Bioeng. Biotechnol. 10, 829620 (2022).
63
M. J. Scott et al., Agricultural production: Assessment of the potential use of Cas9-mediated gene drive systems for agricultural pest control. J. Responsible Innov. 5, S98–S120 (2018).
64
K. M. Lewald et al., Population genomics of Drosophila suzukii reveal longitudinal population structure and signals of migrations in and out of the continental United States. G3 (Bethesda). 11, jkab343 (2021).
65
F. Port, H. M. Chen, T. Lee, S. L. Bullock, Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc. Natl. Acad. Sci. U.S.A. 111, E2967–E2976 (2014).
66
N. P. Kandul et al., Genetically encoded CRISPR components yield efficient gene editing in the invasive pest Drosophila suzukii. CRISPR J. 4, 739–751 (2021).
67
F. Li, M. J. Scott, CRISPR/Cas9-mediated mutagenesis of the white and Sex lethal loci in the invasive pest, Drosophila suzukii. Biochem. Biophys. Res. Commun. 469, 911–916 (2016).
68
D. F. Paulo et al., Specific gene disruption in the major livestock pests Cochliomyia hominivorax and Lucilia cuprina using CRISPR/Cas9. G3 (Bethesda) 9, 3045–3055 (2019).
69
A. Deredec, A. Burt, H. C. Godfray, The population genetics of using homing endonuclease genes in vector and pest management. Genetics 179, 2013–2026 (2008).
70
E. L. George, M. B. Ober, C. P. Emerson, Functional domains of the Drosophila melanogaster muscle myosin heavy-chain gene are encoded by alternatively spliced exons. Mol. Cell. Biol. 9, 2957–2974 (1989).
71
V. L. Collier, W. A. Kronert, P. T. Odonnell, K. A. Edwards, S. I. Bernstein, Alternative myosin hinge regions are utilized in a tissue-specific fashion that correlates with muscle-contraction speed. Genes Dev. 4, 885–895 (1990).
72
J. Field et al., Purification of a RAS-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8, 2159–2165 (1988).
73
I. Koren et al., The eukaryotic proteome is shaped by E3 ubiquitin ligases targeting C-terminal degrons. Cell 173, 1622–1635.e14 (2018).
74
A. Varshavsky, N-degron and C-degron pathways of protein degradation. Proc. Natl. Acad. Sci. U.S.A. 116, 358–366 (2019).
75
P. Lasko, mRNA localization and translational control in Drosophila oogenesis. Cold Spring Harb. Perspect. Biol. 4, a012294 (2012).
76
P. A. Papathanos, N. Windbichler, M. Menichelli, A. Burt, A. Crisanti, The vasa regulatory region mediates germline expression and maternal transmission of proteins in the malaria mosquito Anopheles gambiae: A versatile tool for genetic control strategies. BMC Mol. Biol. 10, 65 (2009).
77
J. Champer et al., Reducing resistance allele formation in CRISPR gene drive. Proc. Natl. Acad. Sci. U.S.A. 115, 5522–5527 (2018).
78
S. E. Champer et al., Computational and experimental performance of CRISPR homing gene drive strategies with multiplexed gRNAs. Sci. Adv. 6, eaaz0525 (2020).
79
K. Inoue, K. Hoshijima, I. Higuchi, H. Sakamoto, Y. Shimura, Binding of the Drosophila transformer and transformer-2 proteins to the regulatory elements of doublesex primary transcript for sex-specific RNA processing. Proc. Natl. Acad. Sci. U.S.A. 89, 8092–8096 (1992).
80
J. A. Waterbury, L. L. Jackson, P. Schedl, Analysis of the Doublesex female protein in Drosophila melanogaster: Role in sexual differentiation and behavior and dependence on intersex. Genetics 152, 1653–1667 (1999).
81
E. J. Rideout, A. J. Dornan, M. C. Neville, S. Eadie, S. F. Goodwin, Control of sexual differentiation and behavior by the doublesex gene in Drosophila melanogaster. Nat. Neurosci. 13, 458–466 (2010).
82
P. Baeza-Centurion, B. Minana, J. Valcarcel, B. Lehner, Mutations primarily alter the inclusion of alternatively spliced exons. Elife 9, e59959 (2020).
83
C. J. McManus, M. O. Duff, J. Eipper-Mains, B. R. Graveley, Global analysis of trans-splicing in Drosophila. Proc. Natl. Acad. Sci. U.S.A. 107, 12975–12979 (2010).
84
R. Rigatti, J. H. Jia, N. J. Samani, I. C. Eperon, Exon repetition: A major pathway for processing mRNA of some genes is allele-specific. Nucleic Acids Res. 32, 441–446 (2004).
85
L. Y. Zhu, Y. R. Zhu, D. J. Dai, X. Wang, H. C. Jin, Epigenetic regulation of alternative splicing. Am. J. Cancer Res. 8, 2346–2358 (2018).
86
S. Cho, P. C. Wensink, Linkage between oligomerization and DNA binding in Drosophila doublesex proteins. Biochemistry 37, 11301–11308 (1998).
87
C. Han et al., A male-specific doublesex isoform reveals an evolutionary pathway of sexual development via distinct alternative splicing mechanisms. Commun. Biol. 5, 728 (2022).
88
D. E. Miller, K. R. Cook, R. S. Hawley, The joy of balancers. PLoS Genet. 15, e1008421 (2019).
89
Y. Wu et al., Highly efficient therapeutic gene editing of human hematopoietic stem cells. Nat. Med. 25, 776–783 (2019).
90
S. Shui, S. Wang, J. Liu, Systematic investigation of the effects of multiple SV40 nuclear localization signal fusion on the genome editing activity of purified SpCas9. Bioengineering (Basel). 9, 83 (2022).
91
M. J. Scott, C. Concha, J. B. Welch, P. L. Phillips, S. R. Skoda, Review of research advances in the screwworm eradication program over the past 25 years. Entomol. Exp. Appl. 164, 226–236 (2017).
92
D. D. Thomas, C. A. Donnelly, R. J. Wood, L. S. Alphey, Insect population control using a dominant, repressible, lethal genetic system. Science 287, 2474–2476 (2000).
93
E. Marois et al., High-throughput sorting of mosquito larvae for laboratory studies and for future vector control interventions. Malar J. 11, 302 (2012).
94
S. H. Webster, M. R. Vella, M. J. Scott, Development and testing of a novel killer-rescue self-limiting gene drive system in Drosophila melanogaster. Proc. Biol. Sci. 287, 20192994 (2020).
95
C. Concha et al., Efficient germ-line transformation of the economically important pest species Lucilia cuprina and Lucilia sericata (Diptera, Calliphoridae). Insect Biochem. Mol. Biol. 41, 70–75 (2011).
96
L. Cong et al., Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823 (2013).
97
R. J. Linger, E. J. Belikoff, M. J. Scott, Dosage compensation of X-linked Muller element F genes but not X-linked transgenes in the Australian sheep blowfly. PLoS One 10, e0141544 (2015).
98
H. J. Burrack, G. E. Fernandez, T. Spivey, D. A. Kraus, Variation in selection and utilization of host crops in the field and laboratory by Drosophila suzukii Matsumara (Diptera: Drosophilidae), an invasive frugivore. Pest Manage. Sci. 69, 1173–1180 (2013).
99
J. E. Elsensohn, M. F. K. Aly, C. Schal, H. J. Burrack, Social signals mediate oviposition site selection in Drosophila suzukii. Sci. Rep. 11, 3796 (2021).
100
K. Clement et al., CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat. Biotechnol. 37, 224–226 (2019).
101
C. Butler. suzukii_pop_supp_code, github, https://github.com/cbutler112358/suzukii_pop_supp_code, release date April 8, 2023.
Information & Authors
Information
Published in
Cover image: Pictured is a colony of bell-shaped, ciliated protists attached to organic debris. Carlos Floyd et al. imaged and analyzed the kinematics of two ciliated protist species (Vorticella sp. and Spirostomum sp.) to model the fast, calcium ion-powered contractions of the protists’ myoneme protein assemblies. The resulting mathematical model reproduced experimental observations across species and demonstrated that myoneme contractions have three distinct operating regimes. The findings could provide insight into protozoan evolution and inform the development of fast, motile synthetic cells. See the article by Floyd et al., e2217737120. Image credit: Karl Gaff (photographer).
Classifications
Copyright
Copyright © 2023 the Author(s). Published by PNAS. This article is distributed under Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND).
Data, Materials, and Software Availability
The data that support the findings of this study are available in the main manuscript and in the supporting information. The NCBI accession numbers for pUC57-DsxHDR-U6:3dsxgRNA3-pUbDsRed, pUC57-DsxSA:U6:3dsxgRNA3-pUbDsRed, and pB-Dsnos-NLS-SpCas9-NLS hsp83-ZsGreen plasmids are OQ130035–OQ130037. The code used to perform the mathematical modeling is available online at https://github.com/cbutler112358/suzukii_pop_supp_code (101).
Submission history
Received: January 27, 2023
Accepted: May 4, 2023
Published online: June 12, 2023
Published in issue: June 20, 2023
Keywords
Acknowledgments
We thank Bill Reid for providing a plasmid with the Dshsp83-ZsGreen marker for transformation of D. suzukii, Fred Gould for helpful discussions, Emily Griffith for statistical analysis of the male mating competitiveness data, Joanna Chiu for providing an alignment of the female dsx exon sequences from D. suzukii collected from different regions, Esther Belikoff and Sophia Webster for microinjection training (A.K.Y.), and our colleagues in the Scott lab for helpful discussions. This work was supported by Biotechnology Risk Assessment Research (BRAG) program grants 2016-33522-25625, 2020-33522-32317, and 2021-33522-35341 from the USDA National Institute of Food and Agriculture to M.J.S. C.B. and A.L.L. were supported by NIH grant R01-AI139085.
Author contributions
A.K.Y., C.B., A.Y., A.A.P., A.L.L., and M.J.S. designed research; A.K.Y., C.B., A.Y., and A.A.P. performed research; A.K.Y., C.B., A.L.L., and M.J.S. analyzed data; and A.K.Y., C.B., and M.J.S. wrote the paper.
Competing interests
The authors declare no competing interest.
Notes
This article is a PNAS Direct Submission.
Authors
Metrics & Citations
Metrics
Citation statements
Altmetrics
Citations
Cite this article
120 (25) e2301525120,
Export the article citation data by selecting a format from the list below and clicking Export.
Cited by
Loading...
View Options
View options
PDF format
Download this article as a PDF file
DOWNLOAD PDFLogin options
Check if you have access through your login credentials or your institution to get full access on this article.
Personal login Institutional LoginRecommend to a librarian
Recommend PNAS to a LibrarianPurchase options
Purchase this article to access the full text.