Rapid evolution of a Y-chromosome heterochromatin protein underlies sex chromosome meiotic drive

Edited by Daven C. Presgraves, University of Rochester, Rochester, NY, and accepted by the Editorial Board February 5, 2016 (received for review October 9, 2015)
March 15, 2016
113 (15) 4110-4115
Commentary
Heterochromatin and genetic conflict
Colin D. Meiklejohn

Significance

Intragenomic conflict between the sex chromosomes is a strong evolutionary force. It can arise through the evolution of sex chromosome meiotic drive, where selfish genes located on the X chromosome promote their own transmission at the expense of the Y chromosome. Sex chromosome drive occurs in Drosophila simulans, where Paris drive results from segregation failure of the heterochromatic Y chromosome during meiosis II. Here, we show that Paris drive is caused by deficient alleles of the fast-evolving X-linked heterochromatin protein 1 D2 (HP1D2) gene. Our results suggest that dysfunctional HP1D2 alleles promote their own transmission, because they do not prepare the Y chromosome for meiosis. This finding shows that the rapid evolution of genes involved in heterochromatin structure can fuel intragenomic conflict.

Abstract

Sex chromosome meiotic drive, the non-Mendelian transmission of sex chromosomes, is the expression of an intragenomic conflict that can have extreme evolutionary consequences. However, the molecular bases of such conflicts remain poorly understood. Here, we show that a young and rapidly evolving X-linked heterochromatin protein 1 (HP1) gene, HP1D2, plays a key role in the classical Paris sex-ratio (SR) meiotic drive occurring in Drosophila simulans. Driver HP1D2 alleles prevent the segregation of the Y chromatids during meiosis II, causing female-biased sex ratio in progeny. HP1D2 accumulates on the heterochromatic Y chromosome in male germ cells, strongly suggesting that it controls the segregation of sister chromatids through heterochromatin modification. We show that Paris SR drive is a consequence of dysfunctional HP1D2 alleles that fail to prepare the Y chromosome for meiosis, thus providing evidence that the rapid evolution of genes controlling the heterochromatin structure can be a significant source of intragenomic conflicts.
Meiosis is a fundamental step underlying sexual reproduction, because it allows equal segregation of chromosomes and alleles. However, various genetic parasitic elements can take advantage of this process by promoting their own transmission at the expense of other components of the genome. Among them, segregation distorters acting in heterozygous individuals are known in a variety of organisms (1). They disrupt meiosis or kill the alternative meiotic products and therefore, end up in a majority, if not all, of the functional gametes, often with deleterious effects on fertility. When segregation distorters are sex-linked and expressed in the heterogametic sex, they cause a bias in offspring sex ratio (2). X-linked distorters in Drosophila, called sex-ratio (hereafter SR), typically cause a Y-bearing sperm shortage, with impact on male sterility. SR males sire a large excess of females (90–100%) carrying the XSR chromosome. The spread of XSR in populations triggers an extended genetic conflict between the X chromosome and the rest of the genome over the skewed sex ratio. Y-resistant chromosomes and autosomal suppressors are, thus, predicted to arise and counteract the distorters (3, 4). Such a scenario has occurred recurrently in Drosophila simulans, which harbors at least three independent SR systems (Paris, Winters, and Durham) that are all cryptic or nearly cryptic because of the evolution of suppressors (5). This finding supports the hypothesis of an endless arms race between XSR chromosomes and the rest of the genome (6, 7), with potential important consequences on sex chromosomes and genome evolution (5, 8), mating system (9), or even speciation through the evolution of hybrid incompatibilities (10, 11).
The Paris SR, which results from the missegregation of Y chromatids in anaphase II (12) (Fig. 1A), involves the cooperation of two X-linked driver loci (Fig. 1B). The first locus colocalizes with the tandem duplication of a 37-kb segment spanning six genes [hereafter duplication SR (DpSR)]. The second locus (Wlasta) was mapped about 110 kb away from DpSR within a 42-kb interval showing no large rearrangements (13, 14). Here, we show that Wlasta is heterochromatin protein 1 D2 (HP1D2), a young member of the HP1 gene family, and we characterize HP1D2 alleles that cause the drive.
Fig. 1.
Mapping of the Wlasta locus from the Paris SR system. (A) Cellular phenotype of the Paris SR trait: lagging Y chromosomes during anaphase of meiosis II. (B) Parental chromosomes used to map the Wlasta locus: XSR4 carries DpSR and a driver allele at the Wlasta locus and shows a strong and stable SR phenotype. Xsn lz carries the sn and lz mutations and is associated with an ST phenotype (equal sex ratio). The phenotype of the recombinant chromosomes that retain DpSR only depends on the Wlasta allele; they are named Xlz[ST] for recombinants with an ST phenotype and X+ lz[SR] for recombinants with an SR phenotype. (C) Phenotype of recombinant chromosomes X+ lz with breakpoints located within the 42-kb candidate region. Solid lines indicate XSR4 chromosome, and dashed lines indicate Xsn lz. (D) Association mapping using 56 X chromosomes from natural populations, all carrying DpSR. Circles correspond to log10 P value scores from a Spearman correlation test between the SR phenotype and the frequency of each SNP. The horizontal line indicates the significance threshold at a false discovery rate of 0.01 (52). The region rich in significant associated polymorphisms is in gray.

Results and Discussion

Genetic Identification of HP1D2 as Wlasta.

To identify Wlasta, we performed an ultrafine genetic mapping using recombination between a strong distorter XSR4 chromosome (∼93% of daughters on average) and a standard (ST) X chromosome carrying the singed (sn) and lozenge (lz) markers (Xsn lz; ∼50% of daughters on average) that frame the two driver loci (Fig. 1B). We generated 1,740 (+ lz) recombinant chromosomes, and among them, 10 have a breakpoint within the candidate region showing either an SR phenotype (X+ lz[SR]; 80–100% of daughters on average) or an ST phenotype (X+ lz[ST]; 45–60% of daughters on average). The positions of the recombination breakpoints enabled us to map Wlasta within a 4.5-kb interval in XSR4 (Fig. 1C) overlapping three genes: Spirit, CG12065, and HP1D2 (GD16106). The last one, a member of the HP1 gene family, is possibly involved in heterochromatin organization (15), and two members of this gene family have been shown to affect chromosome segregation (16, 17). HP1D2 is predicted to encode a chromatin-interacting protein with an N-terminal chromo domain that enables interactions with histones and a C-terminal chromo shadow domain (CSD) mediating protein–protein interactions. Interestingly, only HP1D2 was entirely included within the 4.5-kb region (Fig. 1C). We sequenced and compared the Wlasta candidate region between the two parental chromosomes and observed that XSR4 and Xsn lz diverged by 88 SNPs and 16 small (<100-bp) insertions or deletions. Intriguingly, two larger deletions were detected on XSR4. The first one spans 143 bp in the noncoding sequence between HP1D2 and CG12065, and the second one removes one-half (371 bp) of the HP1D2 coding sequence, resulting in a frameshift that prevents the translation of the CSD (Fig. 2B).
Fig. 2.
HP1D2 is involved in the Paris SR system. (A) Quantitative RT-PCR analysis of HP1D2ST and HP1D2SR testicular expression in males carrying or not carrying DpSR (Materials and Methods). Error bars represent SEMs. *P < 0.05 (Wilcoxon posthoc test using the Bonferroni correction). (B) Structure of the HP1D2 transgenes. CSD is in red, Chromo Domain (CD) is in blue, and GFP is in green. Based on the first nucleotide of the coding sequence (indicated as position 0) of each allele, the lengths of upstream and downstream sequences are indicated (kilobases). (C) SR produced by X+ lz[ST] male siblings that carry or do not carry an shRNA targeting HP1D2 with or without the nos-Gal4 driver. Black bars represent the means. The horizontal dashed line indicates an equal sex ratio (0.5), and the black line indicates an arbitrary limit between strong and moderate sex ratio bias (0.8). ***P < 0.001 (Wilcoxon test). (D) Sex ratios produced by XSR4 male siblings carrying or not carrying an extra autosomal copy of an HP1D2SR or an HP1D2ST allele. n.s., not significant. ***P < 0.001 with the Wilcoxon test.
We then performed an association mapping using a collection of 56 X chromosomes from various geographic locations (SI Appendix, Table S1). All of them carried DpSR, but they showed different drive strengths, with a sex ratio ranging from 50% to 96% females in progeny. We sequenced the 4.5-kb Wlasta candidate region and analyzed the association between nucleotide polymorphism and the SR phenotype. Surprisingly, the noncoding sequence between HP1D2 and CG12065 was particularly enriched with highly significant associated polymorphisms (Fig. 1D). This finding suggested that SR drive might be caused by a variation in expression of one of the adjacent genes.

Drive Results from HP1D2 Dysfunction.

We measured, by quantitative RT-PCR, their testicular expression in males of different genotypes carrying X chromosomes from the recombination mapping experiment (Materials and Methods). We did not observe any significant variation in transcription level of CG12065 regardless of the allele analyzed and the presence/absence of DpSR (Materials and Methods and SI Appendix, Fig. S1A). By contrast, the HP1D2 allele from XSR4 was significantly less transcribed than the allele from Xsn lz, regardless of the presence of DpSR (Fig. 2A).
To test the possibility that the SR phenotype could result from a reduction of HP1D2 expression, we knocked down HP1D2 through male germ-line expression of a specific shRNA using the upstream activation sequence system (UAS)/Gal4 (SI Appendix, Table S2). Although this knockdown only caused a slight reduction of HP1D2 expression in the testis (SI Appendix, Fig. S1B), it resulted in a highly variable but clearly significant SR phenotype in males carrying a recombinant X+ lz[ST] chromosome (Fig. 2C).
Then, to provide definitive evidence of the role of HP1D2 in Paris SR, we introduced a transgenic copy of either HP1D2ST (from Xsn lz) or HP1D2SR (from XSR4) alleles into XSR4 males and measured progeny sex ratios. Strikingly, the presence of the HP1D2ST transgene strongly reduced the drive phenotype produced by XSR4 males (Fig. 2D). For its part, the HP1D2SR transgene, with expression that was attested by GFP fluorescence, had no effect (SI Appendix, Fig. S2A). These results show that the HP1D2ST allele is dominant over the HP1D2SR allele and can prevent the distortion. In addition, after deletion of its CSD coding sequence, which is lacking in HP1D2SR, the modified allele HP1D2STΔCSD (Fig. 2B) became unable to reduce the drive phenotype, suggesting that this domain is required to restore a proper segregation of Y chromatids (SI Appendix, Figs. S1C and S2B). Among the X chromosomes used in the association study, those carrying an HP1D2 allele lacking CSD exhibit, on average, a higher but not significantly different drive ability (Wilcoxon rank sum test W = 273; P = 0.05188) (SI Appendix, Fig. S3 A and B). Because both groups of chromosomes show large variation in drive strength, it is possible that the impact of ΔCSD is masked by the greater association in the regulatory sequence of HP1D2.
Overall, our results indicate that Paris SR drive is a consequence of dysfunctional HP1D2 alleles that are less transcribed and/or lack CSD.

HP1D2 Is Expressed in Spermatogonia and Specifically Binds the Y Chromosome.

Through their relatively conserved domains and functions, HP1 proteins are usually enriched in heterochromatin (18). To determine the localization of HP1D2 in the testis, we established transgenic lines expressing HP1D2SR or HP1D2ST, with the GFP fused in their C termini (Fig. 2B). We observed that both alleles are expressed specifically in spermatogonia (Fig. 3A). Interestingly, both HP1D2:GFP proteins were not uniformly distributed on the chromatin but instead, were highly enriched on a single, highly heterochromatinized chromosome, most likely the Y chromosome (Fig. 3B). We then stained HP1D2:GFP transgenic testes with an antibody recognizing D1, an Adenine-Thymine (AT)-hook domain DNA-binding protein that is specifically enriched on the Y chromosome and to a lesser extent, the fourth chromosome in D. simulans (19). Very clearly, HP1D2:GFP was systematically associated with the main D1 nuclear foci in male germ cells (Fig. 3B). We, thus, conclude that HP1D2 specifically binds the Y chromosome in premeiotic male germ cells. This remarkable localization suggests a role for HP1D2 in organizing at least certain regions of the Y chromosome in preparation of meiosis, such as satellite DNA or other repetitive elements. In the Paris SR system, Y chromatids fail to segregate normally during the second meiotic division and frequently exhibit chromatin bridges (12). In the absence of meiotic recombination in Drosophila males, this phenotype probably indicates the presence of incompletely replicated or aberrantly organized regions of the Y chromosome at the onset of meiotic divisions.
Fig. 3.
Localization of HP1D2 in testes. (A) Confocal images showing the expression of the native GFP-tagged HP1D2ST protein (HP1D2ST:GFP; green) in a testis stained for DNA (red). In Left, the white dashed line delineates the edge of the testis. Right shows a magnification of Left, Inset. HP1D2ST:GFP is detected in nuclei that are located close to the tip of the testis. These cells correspond to spermatogonia, which are rapidly dividing premeiotic germ cells. The same localization was observed for HP1D2SR:GFP (Fig. S4). (B) Confocal images of testes from HP1D2ST:GFP or HP1D2SR:GFP males stained for GFP (green), DNA (red), and (rows 1 and 2) the AT-rich satellite binding protein D1 (blue), which specifically binds the Y and fourth chromosomes in D. simulans (19), or the histone marks (row 3) H3K9me3, which is specifically enriched in heterochromatin, or (row 4) H3K4me2, which is enriched in actively transcribed genomic regions. The fusion proteins HP1D2ST:GFP or HP1D2SR:GFP are located in close proximity to D1. Moreover, HP1D2SR:GFP colocalizes with H3K9me3 signal but not H3K4me2 signal.
In any case, it suggests that HP1D2SR proteins are unable to prepare the Y chromosome for meiosis.

HP1D2 Is a Young and Fast-Evolving Gene.

According to the estimated age of DpSR (<500 y) (14), the spread of the Paris drivers is recent, and their evolution in populations is very fast (20, 21). Through its own spreading, together with DpSR, the HP1D2SR allele carried by XSR4 (lacking CSD) became the most frequent allele in the Malagasy populations (based on the selective sweep studied in refs. 20 and 22) (SI Appendix, Fig. S3). The observation that SR drive is caused by a reduced expression or a loss of function of HP1D2 alleles suggests a scenario where HP1D2 is running headlong toward its degeneration through the spread of increasingly deficient alleles. However, because HP1D2SR localizes to the Y chromosome as well, we cannot exclude that CSD-lacking HP1D2 proteins cause drive through aberrant interactions with other chromatin proteins. If it is the case, CSD-lacking HP1D2 may evolve a new function, which has been described for another HP1 (23).
In any case, the way forward for the species is in the evolution of Y chromosomes able to manage without the ancestral HP1D2 and/or the recruitment of new genes to make up for it.
HP1D2 is a young intronless gene that originates from a duplication of HP1D/Rhino around 15–22 Mya (15). Age duplication estimation based on ref. 24. We investigated HP1D2 evolution in the Sophophora clade (Fig. 4 and SI Appendix, Figs. S5 and S6 and Tables S3–S5). We observed a cis-duplication of HP1D2 that occurred in an ancestor of the takahashii and suzukii subgroups. Another duplication happened in the melanogaster subgroup (in the ancestor of Drosophila orena and Drosophila erecta). We also found that it has been recurrently lost, like in Drosophila melanogaster (15) and Drosophila elegans, or suffers potential pseudogenization, like in D. erecta and D. orena (Fig. 4 and SI Appendix, Fig. S5). The complex and rapid evolution of HP1D2 in the melanogaster species group suggests that it is involved in recurrent genetic conflicts.
Fig. 4.
Evolution of HP1D2 homologs and paralogs in the Sophophora clade. The species phylogeny is from the work in ref. 24 and suggests that HP1D2 was lost at least two times. Canonical CD and CSD are pictured in green and red, respectively. +C indicates a new CD, Ψ indicates potential pseudogenization, and ΨS indicates potential CSD pseudogenization.

Conclusion

It has been previously hypothesized that genes that encode proteins interacting strongly with heterochromatin can be potential actors of genetic conflicts (10, 15, 19, 23). We show here for the first time, to our knowledge, that such a gene, expressed in the male germ line, plays a key role in an extended intragenomic conflict in D. simulans. HP1D2 is specifically enriched on the Y chromosome, which is, like most old Y chromosomes, heterochromatic and rich in repeated sequences (25). Other meiotic drivers are known to favor their own transmission through DNA condensation perturbation, and sometimes the interaction with a specific satellite DNA (2628). Similarly, the discrete distribution of HP1D2 on the Y chromosome suggests an impact of this protein on the chromatin organization of specific repeated sequences. The Paris SR system, thus, brings definitive evidence that the coevolution of highly repeated sequences and heterochromatin interacting proteins can generate unstable interactions, which ultimately end in genetic conflict.

Materials and Methods

Recombination Mapping.

The stocks used were previously described in refs. 22, 29, and 30. ST8 is the reference ST stock free of distorters and suppressors. XSR4 is an SR X chromosome. Xsn lz is an ST (nondriving) X chromosome carrying sn and lz mutations (22). The crossing scheme used to produce recombinants is described in SI Appendix, Fig. S6A (additional information is in ref. 22). Parental and recombinant X chromosomes are kept in male lineage through repeated backcrosses to C(1)RM,y,w females with ST8 background. We designed eight molecular markers to map the recombination sites within the 42-kb candidate region (SI Appendix, Table S6).

SR Test.

The SR phenotype for each X chromosome was measured by individual crosses of at least five single 1- to 5-d-old males with ST8 virgin females. Females were allowed to lay eggs for 4–6 d. The progeny were counted and sexed until no more flies emerged. Only crosses producing at least 50 flies were considered. All experiments were carried out at 25 °C. All of the flies were reared on axenic medium (31) at 25 °C.

Association Mapping.

The 4.5-kb candidate region for Wlasta was sequenced on 56 different X chromosomes (SI Appendix, Table S1) using the primers listed in SI Appendix, Table S7. We checked the presence of DpSR using primers listed in SI Appendix, Table S6.

Measure of Testicular Gene Expression.

For each condition, at least 30 testes pairs were dissected in PBS from males less than 5 d old. RNA extractions were performed using the NucleoSpin RNA Xs Kit as indicated by the manufacturer (Macherey-Nagel). Two different reverse transcriptases were used depending on the experiment: Maxima First-Strand cDNA Synthesis Kit for RT-qPCR (Life Technologies) and iScript cDNA Synthesis Kit (BioRad). cDNA quantification was performed with iQ SYBR Green Supermix (BioRad) in a CFX-96 Thermocycler (BioRad). For each condition, gene expression was measured using at least two biological and two technical replicates.
We selected three different reference genes [RPII140, eIF2B-β, and Light (SI Appendix, Table S8)] all recommended by four different softwares [BestKeeper (32), NormFinder (33), Genorm (34), and the comparative ΔCt (cycle threshold) method (35) (www.leonxie.com/referencegene.php)]. We then used at least two of them in each experiment.
Difference in expression level was tested with the Wilcoxon rank sum test for pairwise comparisons. We used the Kruskal–Wallis rank sum test for multiple tests followed by the posthoc test (pairwise comparisons using the Wilcoxon rank sum test) corrected by the Bonferroni method. Statistical tests have been executed using R (36).

Males Used to Measure Testicular Expression of HP1D2 and CG12065.

Males carrying parental and recombinant chromosomes from the recombination mapping experiment (Fig. 1 B and C and SI Appendix, Fig. S7A) were used to measure the expression of both candidate genes (HP1D2 in Fig. 2A and CG12065 in SI Appendix, Fig. S1A):
Three recombinant Xsn+[ST] without DpSR and with the XSR4 sequence in the 4.5-kb candidate region;
Two recombinant Xsn+[ST] without DpSR and with the Xsn lz sequence in the 4.5-kb candidate region and the parental Xsn lz chromosome;
Two recombinant X+ lz[SR] (XT6 and X378) with DpSR and the XSR4 sequence in the 4.5-kb candidate region and the parental XSR4 chromosome; and
Three recombinant X+ lz[ST] (X134, X269, and X6649) with DpSR and the Xsn lz sequence in the 4.5-kb candidate region.

Cloning and Injection.

We amplified HP1D2SR and HP1D2ST alleles, with their upstream and downstream sequences, respectively, at one time with the Phusion DNA Polymerases (Life Technologies); then, we made the modified alleles (HP1D2ST without its CSD: ΔCSD and both alleles with a GFP domain) with a fusion PCR technique (37, 38) using the primers described in SI Appendix, Table S2. Constructs were cloned in a pCaSpeR4 plasmid. shRNA was designed using the DSIR algorithm (39) (sequence is in SI Appendix, Table S2) and the microRNA-1 loop (40) and cloned in a pUASt plasmid. All inserts have been checked by sequencing before transgenesis. The injection protocol was the same as described in ref. 41, and it was carried out on flies carrying X chromosomes from the w501 stock and Y chromosome and autosomes from the ST8 stock. For each construction, at least three independent transformed lines with autosomal insertions were kept and tested.

Functional Tests of Transgenes.

To test HP1D2 transgenes, we crossed males carrying X[SR]+ lz or XSR4 with C(1)RM,y,w females homozygous for the tested transgene (Fig. 1B). F1 males were then crossed with C(1)RM,y,w females to obtain F2 male siblings with or without the HP1D2 transgene. We measured the SR in the offspring of individual F2 males. The presence/absence of the HP1D2 transgene in each male was then assessed by PCR amplification using a plasmid-specific primer (GTCGGCAAGAGACATCCACT) combined with an insert-specific primer that works on all HP1D2 transgenes (AACGGACGCTCGTGCTGTTTC).
To test the effect of UAS-shRNAHP1D2 in X[ST]+ lz males, we crossed males with the X chromosome of interest with C(1)RM,y,w females homozygous for the nos-Gal4 driver (SI Appendix, Fig. S7C). F1 males were then crossed with C(1)RM,y,w females homozygous for the UAS-shRNAHP1D2 transgene. We obtained two kinds of F2 males: males with the UAS transgene and the Gal4 driver and males with only the UAS transgene. SRs were measured in the offspring of individual F2 males. We also checked under UV light for the presence/absence of the GreenEye marker associated with the nos-Gal4 driver (42). The presence of the UAS transgene was then assessed by PCR amplification (primers: AGGCATTCCACCACTGCTCCCA and AACAAGCGCAGCTGAACAAGC).

Immunostaining.

Whole-mount testes were stained as previously described (43). Primary antibodies were mouse monoclonal anti-GFP (1:200; 11 814 460 001; Roche), rabbit anti-D1 (1:1,000) (19), rabbit anti-H3K9me3 (1:500; ref 07–442; Millipore) (44), and rabbit anti-K4me2 (1:500; 07–030; Millipore) (45). Secondary antibodies were DyLight-coupled goat anti-mouse and goat anti-rabbit antibodies (1:1,000; Jackson Immuno Research). After RNase treatment, tissues were mounted in mounting medium (Dako) containing 5 µg/mL propidium iodide (Sigma-Aldrich). For the observation of native GFP, testes were dissected and mounted without fixation in mounting medium containing 1 µM DRAQ 5 (BioStatus) to visualize DNA.

Evolutionary Analysis.

HP1D2 orthologs and paralogs (HP1D2B) were found by BLAST (SI Appendix, Table S9). They were resequenced in D. erecta, Drosophila takahashii, Drosophila suzukii, Drosophila prolongata, Drosophila biarmipes, Drosophila yakuba, Drosophila sechellia, and D. melanogaster. Based on the obtained sequences, we amplified and sequenced homologs in additional species: Drosophila prostipennis, Drosophila orena, Drosophila teissieri, Drosophila santomea, Drosophila lutescens, and Drosophila mauritiana.
HP1D2 coding sequence and protein sequences were compared between D. simulans lines and between Drosophila species. Sequences were aligned using Geneious (Geneious, version 7.1.7 developed by Biomatters) and checked manually. The phylogenetic tree used in the different evolutionary tests is based on the work in ref. 24. We used PAML (46, 47) (SI Appendix, Table S3) and HyPhy package (48, 49) (Datamonkey webserver) (SI Appendix, Fig. S6 and Table S4) to look for positive selection pressure on the Chromo Domains or the CSDs. The polymorphism of the hinge sequence is too high to allow proper alignment.
We executed typical analyses in PAML: free ratio model allowing variation of the ratio of nonsynonymous and substitutions to the number of synonymous substitutions (dN/dS) (ω) along different branches of the phylogeny to calculate dN/dS values between lineages compared with model = 0, which measures a global ω for all lineages (SI Appendix, Table S3).
We compared the polymorphism and divergence of HP1D2 between the sister species D. simulans, D. sechellia, and D. mauritiana with the McDonald–Kreitman test (50) calculated on the web interface mkt.uab.es/mkt/MKT.asp (SI Appendix, Table S10). The D. mauritiana and D. sechellia lines used in this test are shown in SI Appendix, Table S8. For D. simulans, we used the following lines: Ch006, MP31, CE122, Ch019, Ma244, Ch005, Ma247, Rf47, FP3, Rf46, MP29, MP39, Mp7, SR6, Ch007, snlz, and MP45 (SI Appendix, Table S1). They recapitulate all of the known polymorphisms for the coding sequence of HP1D2 in D. simulans, excluding the deletions.
The phylogenetic tree in SI Appendix, Fig. S3C was constructed using PhyML (51) with the generalized time reversible (GTR) nucleotide substitution model. Support values was acquired from 1,000 bootstrap replicates.

Data Availability

Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession nos. KU527662–KU527680).

Acknowledgments

We thank B. Saint Léandre and C. Berling for helpful comments. We thank J. R. David, M. L. Cariou, J. L. Da Lage, C. Wicker, and C. T. Ting for materials. This work was supported by the CNRS UMR 9191 and Agence Nationale de la Recherche Grant ANR-12-BSV7-0014-01. Q.H. is funded by a French ministerial scholarship and Fondation pour la Recherche Médicale Grant FDT20140931121.

Supporting Information

Appendix (PDF)
Supporting Information

References

1
A Burt, R Trivers Genes in Conflict: The Biology of Selfish Genetic Elements (Belknap Harvard, Cambridge, MA, 2006).
2
J Jaenike, Sex chromosome meiotic drive. Annu Rev Ecol Syst 32, 25–49 (2001).
3
C-I Wu, The fate of autosomal modifiers of the sex-ratio trait in drosophila and other sex-linked meiotic drive systems. Theor Popul Biol 24, 107–120 (1983).
4
GJ Thomson, MW Feldman, Population genetics of modifiers of meiotic drive: IV. On the evolution of sex-ratio distortion. Theor Popul Biol 8, 202–211 (1975).
5
CD Meiklejohn, Y Tao, Genetic conflict and sex chromosome evolution. Trends Ecol Evol 25, 215–223 (2010).
6
Q Helleu, PR Gérard, C Montchamp-Moreau, Sex chromosome drive. Cold Spring Harb Perspect Biol 7, a017616 (2015).
7
DW Hall, Meiotic drive and sex chromosome cycling. Evolution 58, 925–931 (2004).
8
J Cocquet, et al., A genetic basis for a postmeiotic X versus Y chromosome intragenomic conflict in the mouse. PLoS Genet 8, e1002900 (2012).
9
TA Price, DJ Hodgson, Z Lewis, GD Hurst, N Wedell, Selfish genetic elements promote polyandry in a fly. Science 322, 1241–1243 (2008).
10
N Phadnis, HA Orr, A single gene causes both male sterility and segregation distortion in Drosophila hybrids. Science 323, 376–379 (2009).
11
Y Tao, DL Hartl, CC Laurie, Sex-ratio segregation distortion associated with reproductive isolation in Drosophila. Proc Natl Acad Sci USA 98, 13183–13188 (2001).
12
M Cazemajor, D Joly, C Montchamp-Moreau, Sex-ratio meiotic drive in Drosophila simulans is related to equational nondisjunction of the Y chromosome. Genetics 154, 229–236 (2000).
13
C Montchamp-Moreau, D Ogereau, N Chaminade, A Colard, S Aulard, Organization of the sex-ratio meiotic drive region in Drosophila simulans. Genetics 174, 1365–1371 (2006).
14
L Fouvry, D Ogereau, A Berger, F Gavory, C Montchamp-Moreau, Sequence analysis of the segmental duplication responsible for Paris sex-ratio drive in Drosophila simulans. G3 (Bethesda) 1, 401–410 (2011).
15
MT Levine, et al., Phylogenomic analysis reveals dynamic evolutionary history of the Drosophila heterochromatin protein 1 (HP1) gene family. PLoS Genet 8, e1002729 (2012).
16
L-P Liu, J-Q Ni, Y-D Shi, EJ Oakeley, F-L Sun, Sex-specific role of Drosophila melanogaster HP1 in regulating chromatin structure and gene transcription. Nat Genet 37, 1361–1366 (2005).
17
MT Levine, HM Vander Wende, HS Malik, Mitotic fidelity requires transgenerational action of a testis-restricted HP1. eLife 4, e07378 (2015).
18
D Vermaak, HS Malik, Multiple roles for heterochromatin protein 1 genes in Drosophila. Annu Rev Genet 43, 467–492 (2009).
19
JJ Bayes, HS Malik, Altered heterochromatin binding by a hybrid sterility protein in Drosophila sibling species. Science 326, 1538–1541 (2009).
20
H Bastide, et al., Rapid rise and fall of selfish sex-ratio X chromosomes in Drosophila simulans: Spatiotemporal analysis of phenotypic and molecular data. Mol Biol Evol 28, 2461–2470 (2011).
21
H Bastide, PR Gérard, D Ogereau, M Cazemajor, C Montchamp-Moreau, Local dynamics of a fast-evolving sex-ratio system in Drosophila simulans. Mol Ecol 22, 5352–5367 (2013).
22
N Derome, K Métayer, C Montchamp-Moreau, M Veuille, Signature of selective sweep associated with the evolution of sex-ratio drive in Drosophila simulans. Genetics 166, 1357–1366 (2004).
23
BD Ross, et al., Stepwise evolution of essential centromere function in a Drosophila neogene. Science 340, 1211–1214 (2013).
24
B Prud'homme, et al., Repeated morphological evolution through cis-regulatory changes in a pleiotropic gene. Nature 440, 1050–1053 (2006).
25
D Bachtrog, Y-chromosome evolution: Emerging insights into processes of Y-chromosome degeneration. Nat Rev Genet 14, 113–124 (2013).
26
AM Larracuente, DC Presgraves, The selfish Segregation Distorter gene complex of Drosophila melanogaster. Genetics 192, 33–53 (2012).
27
Y Tao, JP Masly, L Araripe, Y Ke, DL Hartl, A sex-ratio meiotic drive system in Drosophila simulans. I: An autosomal suppressor. PLoS Biol 5, e292 (2007).
28
AH Sturtevant, T Dobzhansky, Geographical distribution and cytology of “sex ratio” in Drosophila Pseudoobscura and related species. Genetics 21, 473–490 (1936).
29
C Montchamp-Moreau, V Ginhoux, A Atlan, The Y chromosomes of Drosophila simulans are highly polymorphic for their ability to suppress sex-ratio drive. Evolution 55, 728–737 (2001).
30
C Montchamp-Moreau, M Cazemajor, Sex-ratio drive in Drosophila simulans: Variation in segregation ratio of X chromosomes from a natural population. Genetics 162, 1221–1231 (2002).
31
J David, A new medium for rearing Drosophila in axenic conditions. Dros Inf Serv 36, 128 (1962).
32
MW Pfaffl, A Tichopad, C Prgomet, TP Neuvians, Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper--Excel-based tool using pair-wise correlations. Biotechnol Lett 26, 509–515 (2004).
33
CL Andersen, JL Jensen, TF Ørntoft, Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 64, 5245–5250 (2004).
34
J Vandesompele, et al., Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3, RESEARCH0034 (2002).
35
N Silver, S Best, J Jiang, SL Thein, Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol Biol 7, 33 (2006).
36
; R Core Team, R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. Available at www.R-project.org. Accessed February 25, 2016. (2015).
37
KL Heckman, LR Pease, Gene splicing and mutagenesis by PCR-driven overlap extension. Nat Protoc 2, 924–932 (2007).
38
E Szewczyk, et al., Fusion PCR and gene targeting in Aspergillus nidulans. Nat Protoc 1, 3111–3120 (2006).
39
J-P Vert, N Foveau, C Lajaunie, Y Vandenbrouck, An accurate and interpretable model for siRNA efficacy prediction. BMC Bioinformatics 7, 520 (2006).
40
J-Q Ni, et al., A genome-scale shRNA resource for transgenic RNAi in Drosophila. Nat Methods 8, 405–407 (2011).
41
L Arnoult, et al., Emergence and diversification of fly pigmentation through evolution of a gene regulatory module. Science 339, 1423–1426 (2013).
42
S Holtzman, et al., Transgenic tools for members of the genus Drosophila with sequenced genomes. Fly (Austin) 4, 349–362 (2010).
43
R Dubruille, et al., Specialization of a Drosophila capping protein essential for the protection of sperm telomeres. Curr Biol 20, 2090–2099 (2010).
44
NC Riddle, et al., Plasticity in patterns of histone modifications and chromosomal proteins in Drosophila heterochromatin. Genome Res 21, 147–163 (2011).
45
D Schübeler, et al., The histone modification pattern of active genes revealed through genome-wide chromatin analysis of a higher eukaryote. Genes Dev 18, 1263–1271 (2004).
46
B Xu, Z Yang, PAMLX: A graphical user interface for PAML. Mol Biol Evol 30, 2723–2724 (2013).
47
Z Yang, PAML 4: Phylogenetic analysis by maximum likelihood. Mol Biol Evol 24, 1586–1591 (2007).
48
SLK Pond, SD Frost, SV Muse, HyPhy: Hypothesis testing using phylogenies. Bioinformatics 21, 676–679 (2005).
49
W Delport, AF Poon, SD Frost, SL Kosakovsky Pond, Datamonkey 2010: A suite of phylogenetic analysis tools for evolutionary biology. Bioinformatics 26, 2455–2457 (2010).
50
JH McDonald, M Kreitman, Adaptive protein evolution at the Adh locus in Drosophila. Nature 351, 652–654 (1991).
51
S Guindon, O Gascuel, A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52, 696–704 (2003).
52
Y Benjamini, Y Hochberg, Controlling the false discovery rate: A practical and powerful approach to multiple testing. J R Stat Soc Series B Stat Methodol 57, 289–300 (1995).

Information & Authors

Information

Published in

Go to Proceedings of the National Academy of Sciences
Go to Proceedings of the National Academy of Sciences
Proceedings of the National Academy of Sciences
Vol. 113 | No. 15
April 12, 2016
PubMed: 26979956

Classifications

Data Availability

Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession nos. KU527662–KU527680).

Submission history

Published online: March 15, 2016
Published in issue: April 12, 2016

Keywords

  1. meiotic drive
  2. intragenomic conflict
  3. heterochromatin
  4. sex chromosomes

Acknowledgments

We thank B. Saint Léandre and C. Berling for helpful comments. We thank J. R. David, M. L. Cariou, J. L. Da Lage, C. Wicker, and C. T. Ting for materials. This work was supported by the CNRS UMR 9191 and Agence Nationale de la Recherche Grant ANR-12-BSV7-0014-01. Q.H. is funded by a French ministerial scholarship and Fondation pour la Recherche Médicale Grant FDT20140931121.

Notes

This article is a PNAS Direct Submission. D.C.P. is a guest editor invited by the Editorial Board.
See Commentary on page 3915.

Authors

Affiliations

Quentin Helleu
Laboratoire Évolution, Génomes, Comportement, Écologie, CNRS, IRD, Université Paris-Sud and Université Paris-Saclay, 91198 Gif-sur-Yvette, France;
Pierre R. Gérard
Laboratoire Évolution, Génomes, Comportement, Écologie, CNRS, IRD, Université Paris-Sud and Université Paris-Saclay, 91198 Gif-sur-Yvette, France;
Raphaëlle Dubruille
Laboratoire de Biométrie et Biologie Evolutive, CNRS UMR5558, Université Claude Bernard and Université de Lyon, 69100 Villeurbanne, France;
David Ogereau
Laboratoire Évolution, Génomes, Comportement, Écologie, CNRS, IRD, Université Paris-Sud and Université Paris-Saclay, 91198 Gif-sur-Yvette, France;
Benjamin Prud’homme
Aix-Marseille Université, CNRS UMR7288, Institut de Biologie du Développement de Marseille-Luminy, 13288 Marseille cedex 9, France
Benjamin Loppin
Laboratoire de Biométrie et Biologie Evolutive, CNRS UMR5558, Université Claude Bernard and Université de Lyon, 69100 Villeurbanne, France;
Catherine Montchamp-Moreau1 [email protected]
Laboratoire Évolution, Génomes, Comportement, Écologie, CNRS, IRD, Université Paris-Sud and Université Paris-Saclay, 91198 Gif-sur-Yvette, France;

Notes

1
To whom correspondence should be addressed. Email: [email protected].
Author contributions: Q.H., P.R.G., R.D., B.L., and C.M.-M. designed research; Q.H., P.R.G., R.D., D.O., and B.P. performed research; Q.H., P.R.G., R.D., B.L., and C.M.-M. analyzed data; and Q.H., P.R.G., R.D., B.P., B.L., and C.M.-M. wrote the paper.

Competing Interests

The authors declare no conflict of interest.

Metrics & Citations

Metrics

Note: The article usage is presented with a three- to four-day delay and will update daily once available. Due to ths delay, usage data will not appear immediately following publication. Citation information is sourced from Crossref Cited-by service.


Citation statements




Altmetrics

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.

Cited by

    Loading...

    View Options

    View options

    PDF format

    Download this article as a PDF file

    DOWNLOAD PDF

    Get Access

    Login options

    Check if you have access through your login credentials or your institution to get full access on this article.

    Personal login Institutional Login

    Recommend to a librarian

    Recommend PNAS to a Librarian

    Purchase options

    Purchase this article to get full access to it.

    Single Article Purchase

    Rapid evolution of a Y-chromosome heterochromatin protein underlies sex chromosome meiotic drive
    Proceedings of the National Academy of Sciences
    • Vol. 113
    • No. 15
    • pp. 3903-E2208

    Media

    Figures

    Tables

    Other

    Share

    Share

    Share article link

    Share on social media