Table S3.

Primers

NameSequence
VEGF-A FWD 1CAAATGTGAATGCAGACCAAAG
VEGF-A REV 1TGTGTCAGTCTTTCCTGGTGA
VEGF-A FWD 2CTCACCAAAGCCAGCACATAG
VEGF-A REV 2GACACAGAACTACCCATAGCCG
VEGF-A FWD 3CTCACCAAAGCCAGCACATAG
VEGF-A REV 3ACACAGAACTACCCATAGCCG
VEGF-A exon 1 FWDCGG TGGTACTTGAAAGAC
VEGF-A exon 8b REVCAGAGTGGTCCTTTCTGACTGTGTCTTGCTGGGTATCGGCGGC
VEGF-A exon 7 FWDATAAAGCAAGGCAAGAAATCCCTG
VEGF-A exon 7 FWD2GAAATCCCTGTGGGCCTTGCTAGA