Table 1. Primers used for genotyping and marker analysis
AlleleSize, bp3′ primerSequence5′ primerSequence
XPC wt 218 CH360 TATCTCCTCAAACCCTGCTC CH361 ATTGCGTGCATACCTTGCAC
XPC del 350 CH218 GCAGCGCATCGCCTTCTAT CH360 TATCTCCTCAAACCCTGCTC
K-ras2 exon 1 217 CH466 TGATAATCTTGTGTGAGACATGTTCT CH467 GTCCTTTACAAGCGCACGCA
K-ras2 exon 2 217 CH468 GTTTCTCCCTTCTCAGGACT CH469 ACTTCACATGCCAACTTTCTTATTCAACT