Table 1.

Primer sequences for cytokines and chemokines

Cytokine/chemokineSense primerAntisense primerNo. of PCR cycles
IL-12p35AGACGTCTTTGATGATGACCTCACTCTGTAAGGGTCTGCT35
IL-12p40CGTGCTCATGGCTGGTGCAAAGGAACACATGCCCACTTGCTG35
CXCL10ACCATGAACCCAAGTGCTGCCGTCGCTTCACTCCAGTTAAGGAGCCCT35
CXCL11TCTGCTGTCTTGGAACATGCCGTGTGCCTCGTGATATTTG35
CXCL2GAAGTCATAGCCACTCTCAAGGGGCCAACTCACCCTCTCCCCAGAAAC35
CCL3CCTCTGTCACCTGCTCAACACTGCCTCCAAGACTCTCAGG35
CCL4CCCACTTCCTGCTGTTTCTCGGGAGACACGCGTCCTATAA35
β-ActinGATGACGATATCGCTGCGCTGGTACGACCAGAGGCATACAGG28