Table 1.

Sequences of ZFN-induced mutations in the QQR target

Target after cleavageTTCTTCCCCAAAGAAGGGGTGCGCCGCGTGGGGAAGAAACCCCTTCTT
Insertions ACGCGCGCGT (25)
ACGCG-GCGT
ACGC-CGCGT
ACG--CGCGT
ACGCG---GT
ACG---GCGT
Deletions A-----GCGT (2)
<--374 bp-----239 bp-->
<--256 bp------18 bp-->
<--243 bp-----223 bp-->
<---62 bp-----403 bp-->
Substitutions t CGCG----T
Complex<--490 bp-----109 bp-->a (3)
T-CCCCACGCG----126 bp->a
t CCACGCGCGCG a
CC-ACGC-CGCGT
  • The target sequence after ZFN cleavage with the expected 4-nt 5′ overhangs is shown in the top section. Lower sections show sequences of MluI-resistant products recovered after nuclease induction. Deletions are indicated with dashes, insertions are indicated with bold upper case letters, and substitutions are indicated with bold lower case letters. Microhomologies at the junctions are underlined. The lengths of the long deletions on either side of the cleavage site are given. In cases where a mutation was recovered more than once, the number of instances is given at the right in parentheses.