Table S2.

Primers for cloning, 5′ and 3′ RACE of candidate genes, construction of overexpression plasmids, and qRT-PCR

Target gene and nameSequence (5′ → 3′)
Cloning
 Bm8846
  8846-F3ATGCTACGAACGCCACTACGC
  8846-F5CCGGGTCAAACTTTGGACTT
  8846-F6GCTGGACACAAGGATTCGTC
  8846-R3TTATGTATCTTTGTTTGCATCCTTGGC
  8846-R4GCTTCCAATCAACATCATCG
  8846-R5ACATTTATGTATCTTTGTTTGCATCC
  8846-R6TGGACTGCAGTGTGCAGCTCCA
 Bmspz-3
  9035-F3TGGTGTTAGCACGAGCGGACAG
  9035-F4CGATGAGAAACTCAGTGGGCTGTG
  9035-F5AGAGTGTATGTGGCATCGGTGCGA
  9035-F6GCATGTCATGTCTTGCCGCCATAAC
  9035-R9GTCGAAGCCGGACTGAAGCCTT
  9035–5RACE-F2AGTCAGTAGTGGTCGCGCGCGA
  9036-F4ATAGAACACTGCCATTGTATTGTTACG
  9036-R10CCGTCAAGGGAATGAAAATTACAAATC
  9036-R3CCGGTCGTGGTTTTGCTGCAAGTT
  9036-R4GCTTTGATTTGCGGAGAGTGAAGTGA
  9036-R5AGTTTCCAGCCGTTGGGCAATACAA
 Bmago-3
  9037-F3ATGATGGACTCTCCCTCACAATCT
  9037-F4CGCACACGTCGTTTGAGCGAA
  9037-F5AGATTTCATGATATGCCTCATTCCGG
  9037-R3CTGTTACGTATCCAGGCCAAACTT
  9037-R4TAGACGACTCTTGGCAGTTTCGTT
  9037-R5GTATGCTGATGCTCCAAAGCGT
  9037-R6GCACGCACTGTCCCACTAGAT
5′ and 3′ RACE
 Bm8846
  8846–3RACE-F1GCCAGCGGACTGCCTGTGGTAACAGATGC
  8846–3RACE-nest-F1ATCGTGCTCTTCTTGTCCAAGCT
  8846–5RACE-nest-R1GCGTAGTGGCGTTCGTAGCAT
  8846–5RACE-R1GGCAAGTGGACTGCAGTGTGCAGCTCCA
 Bmspz-3
  9035–5RACE-nest-R1ACTTTCCGCTCGTGACGTCC
  9035–5RACE-R1GAGTGGCGTGGGATCGTCTACACCGAACGGG
  9036–3RACE-F1TTCGACGCCGCCCGGCAGCCGAGTGAAG
  9036–3RACE-F2GCCTGACGCGCAGGCCGTCAACAGTACCG
  9036–3RACE-F3CTCGTTTACAGACGTGACCACA
  9036–3RACE-nest-F1GGTGGATGCGTGCGAAAGCAA
  9036–3RACE-nest-F2CCCTCAACTCCGCAAGGAAACT
  9036–3RACE-nest-F3ATCAGTACCAAAACTTGTTGGAGGC
 Bmago-3
  9037–3RACE-F3CCGAATCCCGGGACCGTGGTCGATCACTGT
  9037–3RACE-F4ACACTAGGATCTTCCTGAAGTCGA
  9037–3RACE-nest-F3AACGAGACGGGACTGGTACGAT
  9037–5RACE-nest-R3CCTATACTCACTCCTGAAGTACTA
  9037–5RACE-nest-R4TACTAGGAGTTGCACTTGCAATGGT
  9037–5RACE-R3GCCAGCATCAATGCTGCTGCGCGTCCTCT
Plasmid construction
 Spz3ZeFL, Spz3WTFL
  infu-spz3-F1CCACCGGTCGCCACCatggctttggtaaattttacgctcgc
  infu-spz3-R2AGAGTCGCGGCCGCTTCAAGGCTTACACCTGCAAACGCA
 Spz3ZeCKfib, Spz3WTCKfib
  infu2-spz3-FactaattcaaggatccaccggtcgccaccATGGCTTTGGTAAATTTTACGCTCGC
  FibHSigP-R1tgcatttgtataagcgacatactgcagagcgcagcacaagat
  Spz_CysKnot_FGCTTATACAAATGCAcaggcctckaacacacaaytg
  spz3CK-NotI-R1AGAGTCGCGGCCGCT
 Spz3Ze(1–60), Spz3WT(1–60)
  BamHI-spz3(1-60)-F1ACTAATTCAAGGATCatggctttggtaaattttac
  Bm_spz3_60aa_R(4mRFP)GTCCTCGGTGTTGTCttgattcgaagggggactgaa
  opt-mRFP-Fgacaacaccgaggacgtcatcaagga
  15bp-opt-mRFP-RTCTAGAGTCGCGGCCGCctactgggagccggagtggcggg
qRT-PCR
 BmrpL3
  rPL3_qPCR_03-FATCAAGGGTTGCTGCATGGGACCT
  rPL3_qPCR_03-RGGTTGATCTTTTCTAGTGCAGCCCTC
 Bm8846
  8846_qPCR02-FTGGTAACAGATGCTAAACCTTCGGGT
  8846_qPCR02-RTGTACAGTAGGACGAATCCTTGTGTC
 Bmspz-3
  spz3qPCR01-FCAAAACACAGCTCCACGCGGTAC
  spz3qPCR01-RCCGTTTCGTAGAAGTATCGGACCTTG
 Bmago-3
  9037_qPCR02-FGGGTTCTGTTGTTCACTCAGAGGGA
  9037_qPCR02-RGAGGGGTACCAATTCAGCGTCAGA
 BmToll-8
  BmToll8_qPCR01-FCAAGCATTGTCGGTTCTTTCTG
  BmToll8_qPCR01-RTTTCGGAGTGCTTGTGGATTT
 BmTH
  BmTH_qPCR02-FCGCCTTTCCACACACCTGAACC
  BmTH_qPCR02-RGGGATGCAAGGCCAATTTCTTGCG
 BmDDC
  BmDDC_qPCR02-FGATGAAGACATCCGCAACGGTCTCA
  BmDDC_qPCR02-RATCTCCAATTTCGTCAAGAGCGTCG
 Bmlac-2
  lac-2_qPCR01-FCGAACCACCAAGGATCTGTTACTATC
  lac-2_qPCR01-RGGCAATGAGACCAGACCACATTCGT
 Bmyellow
  Bmyellow_qPCR01-FGTCAGCGTTCCTAGGTGGCG
  Bmyellow_qPCR01-RTCGAAGCTCGGGTAGGGCGTT