Table S1.

PCR primers used in this study

PrimerForwardReverse
Axin 2CTCCCCACCTTGAATGAAGAACTGGGTCGCTTCTCTTGAA
BaxATGCGTCCACCAAGAAGCTGAAGCAATCATCCTCTGCAGCTCC
CD44AGAAAAATGGCCGCTACAGTATCTGCATGTTTCAAAACCCTTGC
CK1αGGTGCGGAAGATCGGATCTTTCACTGCCACTTCCTCGC
Cyclin D1TTGACTGCCGAGAAGTTGTGCCACTTGAGCTTGTTCACCA
Cyclin G1GCTGGCGCTATCTATCCTTGGGTCAAATCTCGGCCACTTA
Edn1TCTCCGAGGGCGATGTGTACTTCTCCACCGAGGTCCGA
GAPDHACAACTTTGGCATTGTGGAAGATGCAGGGATGATGTTCTG
KitLTCCATCATAGACAAACTTGGGAAATTCTGGCCTCTTCGGAGATT
Mc1rGACCGCTACATCTCCATCTTCTAGGAGGAGGAAGAGGTTGAAGT
Mdm2TGTGTGAGCTGAGGGAGATGCACTTACGCCATCGTCAAGA
MitfCAAATGGCAAATACGTTACCCGCAATGCTCTTGCTTCAGACTCT
p21TCCACAGCGATATCCAGACAAGACAACGGCACACTTTGCT
p53CCCCTGTCATCTTTTGTCCCTAGCTGGCAGAATAGCTTATTGAG
PomcCCTTGGTTTGGGTGGAAGATGGCGTTCTTGATGATGGCGTTC
PumaCAAGAAGAGCAGCATCGACACTCCAGGATCCCTGGGTAAG
Sox9GGAGCTCAGCAAGACTCTGGTGTAATCGGGGTGGTCTTTCT
TNFαGCCAGGAGGGAGAACAGAAACTCGGCCAGTGAGTGAAAGGGACA
Wnt7aTCTCTGCTTTGGCGTCCTCTACGCCAGGCCAGGAATCTTGTTG
β-CateninATGGAGCCGGACAGAAAAGCTGGGAGGTGTCAACATCTTCTT