Table 1

Oligonucleotides used for PCR amplification of strain H77 of HCV

DesignationSequence (5′ → 3′)*
H9261FGGCTACAGCGGGGGAGACATTTATCACAGC
H3′X58RTCATGCGGCTCACGGACCTTTCACAGCTAG
H9282FGTCCAAGCTTATCACAGCGTGTCTCATGCCCGGCCCCG
H3′X45RCGTCTCTAGAGGACCTTTCACAGCTAGCCGTGACTAGGG
H9375FTGAAGGTTGGGGTAAACACTCCGGCCTCTTAGGCCATT
H3′X-35RACATGATCTGCAGAGAGGCCAGTATCAGCACTCTC
H9386FGTCCAAGCTTACGCGTAAACACTCCGGCCTCTTAAGCCATTTCCTG
H3′X-38RCGTCTCTAGACATGATCTGCAGAGAGGCCAGTATCAGCACTCTCTGC
H1TTTTTTTTGCGGCCGCTAATACGACTCACTATAGCCAGCCCCCTGATGGGGGCGACACTCCACCATG
A1ACTGTCTTCACGCAGAAAGCGTCTAGCCAT
H9417RCGTCTCTAGACAGGAAATGGCTTAAGAGGCCGGAGTGTTTACC
  • * HCV sequences are shown in lightface text, non-HCV-specific sequences are shown in boldface, and artificial cleavage sites used for cDNA cloning are underlined. The core sequence of the T7 promoter in primer H1 is shown in italics.