Oligonucleotides encoding wild-type and mutant versions of the C-repeat/DRE

OligonucleotideC-repeat/DRE*Sequence
MT50 COR15a gatcATTTCATGGCCGACCTGCTTTTT
MT52M1COR15aCACAATTTCAaGaattcaCTGCTTTTTT
MT80M2COR15agatcATTTCATGGtatgtCTGCTTTTT
MT125M3COR15agatcATTTCATGGaatcaCTGCTTTTT
MT68COR15bgatcACTTGATGGCCGACCTCTTTTTT
MT66COR78-1gatcAATATACTACCGACATGAGTTCT
MT86COR78-2         ACTACCGACATGAGTTCCAAAAAGC
  • The C-repeat/DRE sequences tested are either wild-type versions found in the promoters of COR15a (7), COR15b (ref. 14; K. Wilhelm & M.F.T., unpublished data), or COR78/RD29A (6) or are mutant versions of the COR15a C-repeat/DRE (M1COR15a, M2COR15a, and M3COR15a) in which the entire C-repeat, CCGAC, had been altered. 

  • Uppercase letters designate bases in wild-type C-repeat/DRE sequences. The core C-repeats are indicated in bold type. Lowercase letters at the beginning of a sequence indicate bases added to facilitate cloning. The lowercase letters that are underlined indicate the mutations in the C-repeat/DRE sequence of COR15a.