Table 1

Primers and conditions for amplification of HHV-6 genes (nested reaction)

ORFPrimer sequence (3′ → 5′)Amplimer DNASize cDNA, bpPCR conditions
U16/17 AGAACTGCAAATCGTTCCG CGTAGAACAGAAGACCGGC 4013151 min at 94°C, 1 min at 55°C, 1 min + 3 sec/cycle at 72°C for 35 cycles; 10 min at 72°C
U39 GGCATAAGGAAACATCATGT GTAGAGCAAACGTTTTCGAT 353
U31 GGAGAATCTTGTAAGTATATGGTC CTCGGACTCATAGATCTCATACTG 6591 min at 92°C, 1 min at 58°C, 1 min at 72°C for 10 cycles; 1 min at 92°C, 1 min at 58°C, 1 min + 3 sec/cycle at 72°C for 20 cycles; 10 min at 72°C
U42 AGGTTTACCGCAGAGTTGCC CAAAACAACGCATCCGAGAC 4041 min at 94°C, 1 min at 61°C, 1 min +3 sec/cycle at 72°C for 35 cycles; 10 min at 72°C
U89/90 TCGCACCAATTAAAAAAATCC TCAAAGAAATATTGGAAGAGAGGTC 531424
U91 CAGACATTACACATTCATTTCA(C/G) CAACTGCACTGAAACCACTAC 385283
U94 CCCATTGGAACTGTGGTCT TTCAGGGCTATGCACTCACC 388
U81 AAATTGGTGGACAACGATAG ATTCTGGAATCGAGCACTCT 1841 min at 94°C, 1 min at 57°C, 1 min + 3 sec/cycle at 72°C for 35 cycles; 10 min at 72°C