Table 2

PCR primer pairs used to construct prey vectors

PlasmidPrimerPrimer sequence
pRDK589237935′-GTTCCTAGGTTATTGCACTATCCTGTTGAAAATATCT
(RAD1)PASC25′-AGGTCCGCTCGAGTTAAACAATATTTTACACAGGTGC
pRDK590231975′-AGACCTAGGAACTTCAGACATGGGTGTG
(RAD2)231915′-CCGCTCGAGACATGCAGAAACAAAGGTAATG
pRDK591 PASC545′-TCTCCTAGGTGACTACACTTTAAGAAGATTGGAAACAATGAAG
(RAD3)PASC325′-CCGCTCGAGAGTTTATAGCAAAAGCGTATCATTGC
pRDK592PASC35′-TGGAATTCAAGATGAACAATACTGATCCTACTTCA
(RAD10)PASC45′-CCGCTCGAGAGGATGGTAATAAGCATGGAACAG
pRDK593PASC85′-GGAATTCATGACTCCCGAACAAAAGGCCAAACTAGAGGCTAACAGGAAATTAGCAATAGAACGG
(RAD14)PASC55′-CCGCTCGAGTTCAGTTTTTCCGAGATAGTTAATTATGTACGAGTGACA
pRDK594231955′-GGGAATTCATCATGACGGACGTTGAAGGC
(RAD25)231965′-CCGCTCGAGGGTGACAATGAAACCAAGCCTATTC