Table 1

Primers used

PrimerPrimer sequence (5′–3′)Ref.
KAR3AATAGCGAAACTTCGAC 15
KAR7CCTCTAGGTCTATTTTA 15
KAR8GGTGGTAAGATATTCACTC 16
KAR9GTCACAACAGGTACACC 16
KAR22GATAAAGAGATCAAAGCC 12
KAR23ATCTGCTTCCATGTGGG 12
KAR24AAAACCGGTCAAGAGGG 29
KAR25CAAAAGCTACTGTGAATGG 29
KAR82CAAATGCAACGCCGAATGG 29
KAR85CGCCTGCGAACCGACACGC 12
KAR86GCAGCAAGCCTCCACTCCG 12
KAR87CGCACAGCCAAGCGTCCGC 12
KAR90GATGTAATGAGAATGCAACATCCAGTAACGACC 16
KAR91AACTGGTCATAGAAATAAGCGGACATATAGGGC 46
KAR92TAAATTGTTATCATGCATATCCTGCTCATGCGG 15
KAR94TATGATACTGAAAACACCTCThis study
KAR95GATGCTAACAGCAGAGCATAThis study
KAR96TGCTACTTACCCAATGGCACThis study
KAR97GAGCCAGGCTTATTTGGGCGThis study