Table 1

Primers used for amplification of cDNA fragments for probes

GeneSense primerAntisense primer
Catalase CAGCTCCGCAATCCTACACC CAGCGTTGATTACAGGTGATCC
NQO1 TTCAGGGTGTCCACGGGG ACTTCATTCATTTTGTTGTTATGG
SOD1 AAGCATGGCGATGAAAGCGG ATTACAGTTTAATGGTTTGAGGG
CGS1c ATGTTTTGGAATGCACCATGTCC TGAGCTGGAGTTAAGAGCCCC
UGT1a6 CTTCCTGCAGGGTTTCTCTTCC CAACGATGCCATGCTCCCC
HO1 TACACATCCAAGCCGAGAATGC GCGGTGTCTGGGATGAGCTAGTGC
  • NQO1, NAD(P)H: quinone oxidoreductase; SOD1, superoxide dismutase; GCS1c, glutamate cysteine ligase regulatory subunit; UGT1a6, UDP glycosyl transferase 1a6; HO1, heme oxygenase 1.