Table 2

Oligonucleotide primers used for DNA amplification and sequencing

Primer nameOligonucleotidePositionBases sequenced*
Kit A5′-CAAGATCTATCGCAGCTACCGCGATGAGAGGC7–30394
Kit B3′-TTCCCATACAAGGAGCGGTCAAC401–379
Kit C5′-TGAATGGATCACGGAAAAGGCAG261–383353
Kit D3′-TCCGACAGCACTGACTTGCC614–595
Kit E5′-TGCATTGTTCTGTGGACCAGG572–592485
Kit F3′-GGTGTTCAGGTTTGGGGAATG1057–1037
Kit G5′-GACTTCAATTATGAACGTCA817–836504
Kit H3′-GGAATCCTGCTGCCACACAT1321–1302
Kit I5′-TCCTGACTTACGACAGGCTC1265–1248585
Kit J3′-CCATAAGCAGTTGCCTCAAC1850–1832
Kit K5′–CCTTATGATCACAAATGGGA1750–1769466
Kit L3′-ACAACATAAGAAACTCCAGG2216–2197
Kit M5′-GATCATGCAGAAGCTGCACT2107–2126486
Kit N3′-AAAATCCCATAGGACCAGAC2594–2575
Kit O5′-CATCATGGAGGATGACGAGTTGG2286–2308342
Kit P5′-TGTATTCACAGAGACTTGGC2383–2402214
Kit Q3′-GGGGCTGCTTCCTAAAGAGAACAG2628–2605
Kit R5′-CTGTGAAGTGGATGGCACCT2516–2535479
Kit S3′-GAAGAGATCATTCCTGGAGG2995–2976
  • * Bases sequenced = amplimer size minus primers.